SNP (Single Nucleotide Polymorphism) marker related to golden red paramisgurnus dabryanus body color character and application thereof

By screening for SNP markers related to the body color of the golden-red large-scaled loach and designing a targeted mating scheme, the problems of maintaining genetic diversity and breeding efficiency in the breeding of the golden-red large-scaled loach were solved, and the increase of population genetic diversity and the transmission of excellent traits of body color were achieved.

CN121674590AActive Publication Date: 2026-03-17JIANGXI PROVINCIAL FISHERIES SCI RES INST (JIANGXI PROVINCIAL POYANG LAKE FISHERY RES CENT JIANGXI PROVINCIAL FISHERY RESOURCES ECOLOGICAL ENVIRONMENT MONITORING CENT) +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610201899.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-12
Publication Date
2026-03-17
Estimated Expiration
2046-02-12

AI Technical Summary

Technical Problem

In the breeding of the golden-red large-scaled loach, how to effectively utilize limited parental resources, maintain genetic diversity, improve breeding efficiency, and avoid inbreeding depression and loss of desirable traits is a key challenge.

Method used

By screening SNP markers associated with the body color trait of the golden-red large-scaled loach, a Mendelian mating scheme was designed. Utilizing the A/G polymorphism of the SNP mutation site located at 1353bp in the rp2 gene on chromosome 7 of the large-scaled loach, primer pairs were designed for PCR amplification, and genotypes were detected using a kit to achieve targeted mating and breeding.

Benefits of technology

It can effectively increase the genetic diversity of offspring, promote the breeding of new varieties of golden-red large-scaled loach, and improve the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674590A_ABST
    Figure CN121674590A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to a golden red paramisgurnus dabryanus body color character and application thereof, and relates to the technical field of molecular markers. The SNP marker is located at the 1354bp position of an rp2 gene of a No.7 chromosome of paramisgurnus dabryanus, the polymorphic form of the SNP marker is A / G, an individual of an AA genotype has a golden red body color, and individuals of AG and GG genotypes have a wild body color. The invention further provides a primer pair and a kit for detecting the SNP marker and application of the primer pair and the kit in detecting the body color character of the golden red paramisgurnus dabryanus and breeding. The nucleotide sequence of the primer pair is shown as SEQ ID NO: 2-SEQ ID NO: 3. The molecular marker provided by the invention can be used for detecting the body color of the paramisgurnus dabryanus and breeding the body color character of the golden red paramisgurnus dabryanus, so that the genetic diversity of population offspring is effectively increased, and the breeding process of breeding of a new variety of the body color of the red paramisgurnus dabryanus is remarkably promoted.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to a SNP marker related to the body color trait of Paramisgurnus dabryanus and application thereof. BACKGROUND

[0002] The wild type Paramisgurnus dabryanus has a brown back. This population has excellent breeding performance, such as fast growth, short breeding cycle, high yield, and the like. In addition, it has important ecological values in water quality purification, biodiversity maintenance, and sustainable fishery development. At present, it has become the main breeding variety of Paramisgurnus dabryanus in China, and promotes the substantial increase of Paramisgurnus dabryanus breeding yield in China.

[0003] The golden red Paramisgurnus dabryanus is a breeding variety improved and bred from the Paramisgurnus dabryanus mutant. It has edible and ornamental values due to the golden red body color, and is welcomed by breeders and ornamental fish lovers in recent years. Moreover, it has a relatively high market price, and its economic value is much higher than that of Paramisgurnus dabryanus. Therefore, breeding the golden red Paramisgurnus dabryanus new variety can promote the development of aquaculture, and can also promote scientific research, ecological sustainable development, and the improvement of economic benefits, and has broad application prospect and important strategic significance.

[0004] The body color of the golden red Paramisgurnus dabryanus is controlled by a recessive homozygous gene, and the natural mutation rate is extremely low. In artificial selection, a considerable proportion of heterozygous individuals are eliminated due to the wild body color, which directly leads to the small size of the core breeding population. Under this background, the traditional breeding method will cause serious inbreeding depression with the increase of generations, which will increase the risk of degeneration of germplasm and loss of excellent traits. Therefore, how to use limited parent resources to effectively maintain the genetic diversity of the breeding population while carrying out seed production and breeding selection has become a key technical bottleneck restricting the development of the strain.

[0005] As a quality trait controlled by a major gene, the key genetic locus of the body color is clear, which provides a theoretical basis for genotype identification of Paramisgurnus dabryanus by using molecular marker technology. In recent years, with the rapid development of modern molecular biology technology and the further promotion of the post-genomic era, single nucleotide polymorphism (SNP) as a new generation of molecular marker technology has been widely used in molecular breeding research of aquatic animals, and provides strong technical support for the development and breeding of excellent varieties.

[0006] Therefore, screening of the molecular marker related to the body color trait for selection has important significance for improving breeding efficiency and developing new strains to improve biodiversity. SUMMARY

[0007] The present application aims to at least solve one of the technical problems in the prior art, and provides an SNP marker related to the body color trait of Paramisgurnus dabryanus with golden red color and an application thereof.

[0008] The present application aims to provide an SNP mutation site, a molecular marker and an application thereof related to the red mutation of the body color of Paramisgurnus dabryanus with large scales, and to effectively increase the genetic diversity of the offspring of a population by applying the SNP mutation site to the body color selection of Paramisgurnus dabryanus with large scales and designing a mating scheme according to Mendel's law.

[0009] The technical solution of the present application is as follows: In a first aspect, the present application provides an SNP marker related to the body color trait of Paramisgurnus dabryanus with golden red color, wherein the SNP marker is located at the 1353bp of the rp2 gene of chromosome 7 of Paramisgurnus dabryanus shown in SEQ ID NO: 4, and the polymorphic form thereof is A / G.

[0010] Optionally, the nucleotide sequence containing the SNP marker is shown in SEQ ID NO: 1, and the SNP marker is located at the 130bp of the sequence shown in SEQ ID NO: 1, and the polymorphic form thereof is A / G.

[0011] The SNP marker is located at the 1353bp of the rp2 gene of chromosome 7 of Paramisgurnus dabryanus shown in SEQ ID NO: 4 or the 130bp from the 5' end of SEQ ID NO: 1; when the SNP markers in the two chromosomes are A and A respectively, it is called AA genotype, and the body color of Paramisgurnus dabryanus with AA genotype is golden red, that is, the mutant Paramisgurnus dabryanus with golden red color; when the SNP markers in the two chromosomes are A and G respectively, it is called AG genotype, and the body color of Paramisgurnus dabryanus with AG genotype is brown, that is, the wild type Paramisgurnus dabryanus; when the SNP markers in the two chromosomes are G and G respectively, it is called GG genotype, and the body color of Paramisgurnus dabryanus with GG genotype is brown, that is, the wild type Paramisgurnus dabryanus.

[0012] Optionally, the genotype of the SNP marker is AA, AG or GG, wherein the body color of Paramisgurnus dabryanus with AA genotype is golden red, and the body color of Paramisgurnus dabryanus with AG or GG genotype is wild type brown.

[0013] In a second aspect, the present application provides a primer pair for detecting the SNP marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 2-SEQ ID NO: 3.

[0014] In a third aspect, the present application provides a kit for detecting the body color trait of Paramisgurnus dabryanus with golden red color, and the kit comprises the primer pair.

[0015] Fourthly, the present invention provides the application of the primer pair or the kit described herein in detecting the body color trait of the golden-red large-scaled loach.

[0016] Fifthly, the present invention provides a method for detecting the body color trait of the golden-red large-scaled loach, comprising the following steps: The genomic DNA of the loach to be tested was amplified by PCR using the primer pair or the kit described above to obtain the PCR amplification product. The genotype at the 130bp position of the PCR amplification product was detected.

[0017] Optionally, the body color of the loach to be tested with the genotype AA at the 130bp position of the PCR amplification product is golden red, and the body color of the loach to be tested with the genotype AG or GG at the 130bp position of the PCR amplification product is wild-type brown.

[0018] Sixthly, the present invention provides the application of the primer pair or the kit described herein in the breeding of *Parasitic maculatus*.

[0019] Seventhly, the present invention provides a breeding method for a golden-red large-scaled loach, comprising the following steps: Wild-type brown large-scaled loach with genotype AG was screened using the primer pairs or the kit described above and then cultured separately. During the breeding season, wild-type brown large-scaled loach with genotype AG is selectively bred with golden-red large-scaled loach with genotype AA, or wild-type brown large-scaled loach with genotype AG is selectively bred with wild-type brown large-scaled loach with genotype AG. Golden-red large-scaled loach with genotype AA were selected from the offspring for breeding.

[0020] This invention utilizes the aforementioned primers to detect the genotype of the SNP marker rp2-130 mutation site in potential broodstock individuals of *Parasitic scabra*, screening out individuals with the wild-type brown body color but the genotype AG. These individuals are then raised separately, and targeted mating is carried out during the breeding season: fertilization is performed between wild-type AG individuals and mutant AA individuals; fertilization is also performed between wild-type AG individuals and mutant AG individuals. Individuals with mutant body color are selected from the offspring for further breeding, thus realizing a breeding method for the golden-red body color trait of *Parasitic scabra*.

[0021] This invention has at least one of the following beneficial effects: This invention provides a SNP locus associated with the body color trait of the golden-red large-scaled loach. The SNP molecular marker is located at position 1354 bp of the rp2 gene on chromosome 7 of the large-scaled loach. An A / G base mutation exists at this locus, which is significantly correlated with the golden-red body color trait of the large-scaled loach. Individuals with the AA genotype have a golden-red body color, while individuals with the AG and GG genotypes have a wild-type body color. The molecular marker provided by this invention can be used for breeding of the golden-red large-scaled loach, effectively increasing the genetic diversity of offspring and significantly promoting the breeding process for new varieties of the red-colored large-scaled loach. Attached Figure Description

[0022] Figure 1 The diagram shows the sequencing peaks of the amplified products in Example 1 for the three genotypes. In the diagram, a represents genotype AA, b represents genotype GG, and c represents genotype AG. Detailed Implementation

[0023] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0024] Example 1: Identification of polymorphic sites in the rp2 gene of *Paramis gargarizans* (golden-red large-scaled loach) 1. Obtaining genomic DNA from different body colors of the large-scaled loach: Thirty individuals each of the mutant golden-red variety of *Parasitic scabra* and the wild-type coloration variety of *Parasitic scabra* were obtained as test samples. Genomic DNA was extracted from the fin tissue of the test samples: Genomic DNA was extracted from the caudal fin tissue of the fish using the Seville Tissue / Cell / Blood Genomic DNA Extraction Kit (G3633).

[0025] After extraction, the integrity of the DNA was detected by 2% agarose gel electrophoresis. The quality and concentration of DNA were determined by NanoDrop2000 micro-spectrophotometer. The purity was considered to be qualified if the A260 / A280 ratio was between 1.7 and 1.9, and the concentration was considered to be qualified if the DNA concentration was higher than 100 ng / µL. The qualified genomic DNA samples were stored at -20℃ for later use.

[0026] 2. Whole genome sequencing of *Parasitic scabra*: Whole-genome sequencing was performed on both the wild-type and mutant *Parasius maculatus*, obtaining the rp2 gene sequence on chromosome 7. The sequence of the rp2 gene on chromosome 7 of the mutant *Parasius maculatus* is shown in SEQ ID NO:4, and the sequence of the rp2 gene on chromosome 7 of the wild-type *Parasius maculatus* is shown in SEQ ID NO:5.

[0027] SEQ ID NO:4: A

[0028] SEQ ID NO:5:

[0029] Analysis and comparison revealed that the SNP marker associated with the body color trait of the golden-red Paramecium fasciatus is located at 1354 bp of the rp2 gene on chromosome 7 of Paramecium fasciatus, as shown in SEQ ID NO:4 (see underlined portion), and its polymorphism is A / G.

[0030] 3. Obtain the first-generation sequencing sequence of the mutant golden-red large-scaled loach. The first-generation sequencing sequence of the rp2 gene of the mutant golden-red large-scaled loach is shown in SEQ ID NO:1.

[0031] The SNP marker associated with the body color trait of the golden-red large-scaled loach is located at 130 bp of the sequence shown in SEQ ID NO:1 (see underlined part for details).

[0032] SEQ ID NO:1: accgttggcc ggttgccagg cacactcaat ggccagcagt ttgtcattca ggagtgtgagaactgcaaca tctacgtatt ggaccattca gcgactataa ccatcgacga ctgtgtgaactgccgcata atgttgggtcc aatcaaaggc agcgtattct tcagagactg taaagatatc aaatgcgtagtggcctgcca acagttccgc accagagact gcaagaaaat ggacgtcttt ttgtcctgtg ccacccagcccattatcgag tcttctacgg gcatgaagtt tggctgtttt cagtactact accctgattt ggctttccactttaaagatg caggccttag cattttcaat aacaactgga gcaatattca tgacttcaca cctgtgtctggagagaccaa ttggagtcta ctccccgaag aaactgttgt cctggatcat gtgccattac cggattctgagtcggagttt aaatccgtga gaatttcgac cgaggcaagc cggagcatag ttcccctgac caaaggaggccggcgcaagg agagtgaaga gtcctgtctg tttgttttct tcgctggaga ctacaccact gctaatgcccgcaagcttat tgatgaggtt agagatagtt taagaaagtt tccatcagtt gttgctcatc tgca.

[0033] 4. Amplify nucleotide fragments containing SNP sites 4.1 Primer design: Using the DNA sequence of the rp2 region of the gene shown in SEQ ID NO:1 as a template, primers were designed, including forward primer F: 5'- CTTCATGCTGACAGGCCTCA - 3' (SEQ ID NO:2); and reverse primer R: 5'- CAGATGAGCAACAACTGATGGA- 3' (SEQ ID NO:3).

[0034] The expandable region of the primer is a 674 bp sequence, as shown in SEQ ID NO:1, which contains the molecular marker site of the A / G mutation at position 130 bp.

[0035] 4.2 PCR Amplification: The PCR reaction system consisted of 20 µL, including: 10 µL 2×San Taq PCR Mix, 0.8 µL forward primer (10 µmol / L), 0.8 µL reverse primer (10 µmol / L), 2 µL template DNA (≥100 ng / μL), and 6.4 µL ddH2O. The PCR reaction conditions were: 98℃ pre-denaturation for 5 min, 35 amplification cycles (98℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s), and a final extension at 72℃ for 10 min. The PCR amplification products were obtained.

[0036] 5. Detect PCR amplification fragments and obtain SNP markers: The PCR amplification product from step 4 was subjected to first-generation sequencing, and the genotype at the 130 bp position of the PCR amplification product was determined to be the genotype of the SNP site.

[0037] Sequencing peak diagrams of the three genotypes are as follows Figure 1 As shown.

[0038] Example 2 Breeding applications were carried out, different mating schemes were designed based on body color, and population analysis was conducted on the polymorphic sites of the rp2 gene loci in different selected lines.

[0039] Obtaining materials for different breeding lines: Golden-red mutant individuals from the wild-type *Parasitic scabra* population were subjected to targeted mating and artificial selection. F1 families were constructed through reciprocal crosses between wild-type and mutant individuals. The following year, the F1 hybrids matured, and testcrosses were conducted between the F1 hybrids and *Parasitic scabra*, as well as self-crossing experiments, to obtain F2 families. Successfully fertilized parent fish were then cultured separately. The body coloration of the F1 and F2 generations is shown in the table below: Table 1: Body color ratio of different breeding lines Thirty individuals from the F1 hybrid generation, 30 individuals from the F2 testcross with different body colors, and 30 individuals from the F2 selfcross with different body colors were selected; the fins were removed, and genomic DNA was extracted from the fin tissues to be tested.

[0040] The chi-square test was used to analyze the above samples (results are shown in Table 2). The frequencies of the above SNP sites in different body colors basically conformed to Mendelian segregation. This verified that allele A at this SNP site was significantly positively correlated with body color mutations.

[0041] Table 2 Genotype frequencies of SNP sites in different breeding lines of *Paramecium chinense* Note: * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01).

[0042] In the breeding process of the golden-red large-scaled loach, individuals with the genotype AG can be selected from wild-type large-scaled loach and hybridized with golden-red large-scaled loach with the genotype AA to screen for a golden-red population with richer genetic diversity.

[0043] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A SNP marker associated with the body color trait of Jining Gray Large-scale Parabramis, characterized in that, The SNP marker is located at 1354bp of the rp2 gene of the chromosome 7 of Paramysis sinensis as shown in SEQ ID NO:4, and its polymorphic form is A / G.

2. The SNP marker of claim 1, wherein, The nucleotide sequence containing the SNP marker is shown in SEQ ID NO:1, and the SNP marker is located at 130bp of the sequence as shown in SEQ ID NO:1, and its polymorphic form is A / G.

3. The SNP marker according to any one of claims 1 to 2, wherein The genotype of the SNP marker is AA, AG or GG, wherein the Paramysis sinensis with the genotype AA has golden red body color, and the Paramysis sinensis with the genotype AG or GG has wild type brown body color.

4. A primer pair for detecting the SNP marker according to any one of claims 1 to 3, characterized in that, The nucleotide sequences of the primer pair are shown in SEQ ID NO:2-SEQ ID NO:

3.

5. A kit for detecting the gold red body color trait of Paramisgurnus dabryanus, characterized in that, The kit comprises the primer pair of claim 4.

6. The primer pair of claim 4 or the kit of claim 5 in the detection of the golden red body color trait of Paramysis sinensis.

7. A method for detecting the gold red body color trait of Paramisgurnus dabryanus, characterized in that, The method comprises the following steps: PCR amplification is performed on the genomic DNA of the test Paramysis sinensis using the primer pair of claim 4 or the kit of claim 5 to obtain a PCR amplification product; The genotype at 130bp of the PCR amplification product is detected.

8. The method of claim 7, wherein, The Paramysis sinensis with the genotype AA at 130bp of the PCR amplification product has golden red body color, and the Paramysis sinensis with the genotype AG or GG at 130bp of the PCR amplification product has wild type brown body color.

9. The primer pair of claim 4 or the kit of claim 5 in the breeding of Paramysis sinensis with golden red body color.

10. A method for breeding of Parasiklax barbatula in gold-red color, characterized in that, The method comprises the following steps: Wild type brown Paramysis sinensis with the genotype AG are screened out using the primer pair of claim 4 or the kit of claim 5, and are separately bred; During the breeding period, the wild type brown Paramysis sinensis with the genotype AG are mated with the golden red Paramysis sinensis with the genotype AA, or the wild type brown Paramysis sinensis with the genotype AG are mated with the wild type brown Paramysis sinensis with the genotype AG; The golden red Paramysis sinensis with the genotype AA are selected from the offspring and are bred.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying body color character of carp, primer and application

    CN115927653A

  • Gene related to body color character of paramisgurnus dabryanus, primer group of SNP (Single Nucleotide Polymorphism) marker and application of primer group

    CN120485198A