Antiviral small peptide and application thereof
By providing the antiviral peptide NVAVAPKDAQPTVN and its encoded nucleic acid molecule, the problem of the lack of ChiVMV resistance genes in tobacco has been solved, realizing the stable improvement of plant resistance to ChiVMV and the preparation of antiviral drugs, which can be applied to tobacco breeding and virus control.
Patent Information
- Application Number
- CN202511961690.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-03-20
AI Technical Summary
Existing technologies lack directly usable ChiVMV resistance genes in tobacco, existing control measures cannot establish stable genetic resistance at the plant level, and there are no technical solutions for using small peptide preparations to resist ChiVMV in tobacco.
This invention provides an antiviral peptide NVAVAPKDAQPTVN and its encoded nucleic acid molecule, which significantly enhances plant resistance to ChiVMV through exogenous application or gene expression, and can be used to prepare antiviral drugs and transgenic plants.
It significantly improves tobacco resistance to ChiVMV, reduces plant symptoms, decreases virus accumulation, and provides a stable disease resistance management strategy and new molecular breeding resources.
Smart Images

Figure CN121698962A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular biology technology, and particularly relates to an antiviral small peptide and application thereof. BACKGROUND
[0002] Chilli veinal mottle virus (ChiVMV) belongs to Potyvirus and is one of the important viruses that mainly harm solanaceous crops in China and Asia. The virus can cause significant symptoms such as mottling, vein deep green, leaf curling and growth inhibition in tobacco, and is an important disease that restricts the high quality and stable yield of main tobacco varieties such as K326.
[0003] Current production prevention and control of ChiVMV mainly relies on agricultural management, disease-free seedlings, vector insect control and limited biocontrol agents or chemical agents. However, these means are mostly exogenous environmental prevention and control measures, which are greatly affected by ecological environment and management conditions, and cannot establish stable genetic resistance at the plant level. Therefore, obtaining resistance factors that can be used for tobacco breeding has always been the key direction of controlling ChiVMV.
[0004] In terms of genetic resistance resources, a number of resistance genes against Potyvirus have been resolved in peppers, such as pvr series, Pvr4, Pvr7, etc., and specific genetic loci against ChiVMV have been located. However, most of these resistance resources are specific natural variation loci in peppers, which are quite different from tobacco in genetic background, and are difficult to be directly used for tobacco breeding. There is no public report of successfully introducing stable resistance into flue-cured tobacco.
[0005] In the genetic resources of tobacco itself, some studies have focused on the role of host defense-related genes, kinases, autophagy-related factors, etc. in ChiVMV infection, but these genes mostly show broad-spectrum stress response or regulatory genes, rather than major disease-resistant genes that can be stably used in industrial breeding. So far, there is no ChiVMV-specific resistance gene that can be directly applied to main flue-cured tobacco varieties with stable effect.
[0006] At the same time, plant endogenous small peptides are gradually considered to play an important role in immune regulation, including inducing defense response and mediating immune signal amplification. Small peptides have the advantages of small molecular weight, clear structure, easy artificial synthesis or plant expression, etc. However, there is no report in the public literature that a small peptide with a clear structure can directly improve the resistance of tobacco to ChiVMV, and there is no technical solution for using a small peptide preparation to prevent and control ChiVMV in tobacco. SUMMARY
[0007] In order to solve the problems of lack of ChiVMV resistance genes that can be directly used in tobacco, and inability of existing prevention and control measures to form plant internal resistance in the prior art, the application aims to provide an antiviral small peptide and application thereof, which is structurally stable, can significantly improve plant resistance to ChiVMV through exogenous application or gene expression, and has important application value.
[0008] The application provides an antiviral small peptide, and the amino acid sequence is shown as SEQ ID NO. 1: NVAVAPKDAQPTVN.
[0009] The application further provides a nucleic acid molecule encoding the antiviral small peptide.
[0010] The application further provides application of the antiviral small peptide or the nucleic acid molecule, including the following any one of the following: application in inhibiting virus infection, application in preparing an antiviral drug, application in preparing a transgenic plant with antiviral ability.
[0011] Further, the virus is pepper vein banding virus.
[0012] Further, the mode of inhibiting virus infection includes spraying, leaf injection or immersion of the plant, and the application time includes starting application before virus infection or starting application after virus infection.
[0013] The application further provides an antiviral drug, including the antiviral small peptide or the nucleic acid molecule.
[0014] Further, the antiviral drug takes the antiviral small peptide with the amino acid sequence shown as SEQ ID NO. 1 as an active ingredient, and the concentration is 1-50 μM.
[0015] Further, the concentration of the antiviral small peptide is 5-10 μM.
[0016] Further, the antiviral drug further includes a spreading agent, a moisturizing agent or a sustained-release component.
[0017] The application further provides a method for preparing a transgenic plant with pepper vein banding virus resistance, which expresses the antiviral small peptide through genetic transformation.
[0018] The application has the following beneficial effects: The antiviral small peptide can significantly improve the resistance of plants, especially tobacco, to ChiVMV. The antiviral small peptide is safe, stable, and easy to prepare, and is suitable for large-scale application.
[0019] The application can be applied to inhibit virus infection, significantly improve the resistance of tobacco to ChiVMV, and significantly reduce the virus accumulation amount of the upper leaves of the plant after spraying. The spraying effect before and after inoculation is better, and the resistance enhancement effect is further increased. The application proposes a new antiviral management strategy.
[0020] The application can be applied to prepare antiviral drugs, significantly improve the resistance of tobacco to ChiVMV, and has high green prevention and control value, and does not depend on conventional chemical agents, and can be used with existing biological control measures.
[0021] The application can be applied to antiviral breeding, and the expression of the antiviral small peptide can give the tobacco stable resistance, and provide a new molecular resource for creating new disease-resistant strains. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 Fig. 2 is a chart of the resistance effect of each treatment of Example 2 to ChiVMV.
[0023] Figure 2 Fig. 2 is a chart of the resistance effect of each treatment of Example 2 to ChiVMV. P < 0.001 indicates that there is a significant difference, and n.s indicates that there is no significant difference.
[0024] Figure 3 Fig. 3 is a chart of the virus accumulation amount of the upper leaves of tobacco of each treatment of Example 3, wherein, P < 0.001 indicates that there is a significant difference, and n.s indicates that there is no significant difference. DETAILED DESCRIPTION
[0025] The application will be further described in detail below with reference to the specific embodiments. The embodiments given are only for the purpose of illustrating the application, and are not intended to limit the scope of the application. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to explain the application, and cannot be understood as limiting the application.
[0026] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques, conditions described in the literature in the art or according to the product instructions, unless otherwise specified.
[0027] An antiviral small peptide, the amino acid sequence of which is shown as SEQ ID NO. 1: NVAVAPKDAQPTVN. The nucleotide sequence of a nucleic acid molecule encoding the above-mentioned antiviral small peptide can be shown as SEQ ID NO. 2: ATGAATGTTGCTGTTGCTCCAAAAGATGCTCAGCCAACCGTTAAC, and it should be understood that the nucleotide sequence shown as SEQ ID NO. 2 is only an exemplary nucleotide sequence, and any nucleotide sequence capable of encoding the small peptide shown as SEQ ID NO. 1 shall fall within the protection scope of the present application.
[0028] Example 1, synthesis and storage of small peptides A purified small peptide with the sequence of NVAVAPKDAQPTVN (SEQ ID NO. 1) was prepared by using a solid-phase peptide synthesis (SPPS) method.
[0029] Dissolved in sterile purified water to prepare a 1 mM stock solution, and stored at -20 °C for standby use.
[0030] Example 2, spraying small peptides to improve the resistance of K326 to ChiVMV The materials used in the example are as follows: Tobacco variety K326 (susceptible to ChiVMV) was obtained from the germplasm preserved by the Yunnan Tobacco Agricultural Science Research Institute, ChiVMV virus was preserved by the Yunnan Tobacco Agricultural Science Research Institute, ChiVMV virus inoculum (collected from tobacco leaves infected with ChiVMV, ground and diluted with PBS solution at 1:1000), Small peptide working solution: 5-10 μM, BSA control solution: 5-10 μM.
[0031] The treatment process of the example is as follows: 1. Pre-inoculation spraying treatment (T1) The experimental group uniformly sprayed 5-10 μM small peptide working solution on the surface of K326 leaves at the 6-leaf stage, and stood for 24 h.
[0032] The control group was sprayed with the same concentration of BSA.
[0033] 2. Virus inoculation The ChiVMV was inoculated on the experimental group and the control group by using the conventional rubbing inoculation method.
[0034] 3. Double spraying treatment before and after inoculation (T2) On day 0 (before inoculation): spray 5-10 μM small peptide working solution.
[0035] On day 1: ChiVMV inoculation was performed.
[0036] Day 2: Spray the small peptides again at 5-10 μM.
[0037] The control group is sprayed with BSA at the same time point.
[0038] Symptom observation (7 dpi) is as shown in Figure 1 and Figure 2 , and is specifically as follows: Control group: obvious mottling, crinkling, and growth inhibition occur, and ELISA detection shows high virus accumulation.
[0039] T1 (sprayed before inoculation): plant symptoms are reduced, new leaves are similar to healthy ones, and virus content is significantly reduced (P < 0.01).
[0040] T2 (sprayed before and after inoculation): the plant resistance is stronger, and almost no typical ChiVMV symptoms are shown; ELISA detection is performed, and the virus accumulation amount in the upper leaves of the tobacco per unit mass is calculated; the virus content in the T2 experimental group is the lowest, and is reduced by 70%-85% compared to the K326 plants that are not sprayed with small peptides and inoculated with ChiVMV.
[0041] Conclusion The anti-virus small peptides of the application can significantly enhance the resistance of K326 to ChiVMV, and the effect of "sprayed before and after inoculation" is the most significant.
[0042] Example 3, expression of small peptides in tobacco to improve resistance to ChiVMV by using Agrobacterium-mediated transient expression In this example, Agrobacterium-mediated transient expression is used to express the anti-virus small peptides of the application in tobacco leaves, so as to verify the enhanced effect of the small peptides on ChiVMV resistance under the expression conditions in the plant body.
[0043] A plant expression vector containing green fluorescent protein GFP (as a control) and a plant expression vector capable of encoding the nucleic acid molecule of the anti-virus small peptides of the application are constructed by using a pSAT1 binary expression vector (from Stony Brook University, USA), and the expression vectors are transformed into Agrobacterium EHA105 to obtain Agrobacterium engineering bacteria carrying the small peptide expression vector. After the Agrobacterium is cultured under suitable conditions, it is injected into tobacco leaves by using a conventional method, so that the anti-virus small peptides of the application are transiently expressed in the local area of the leaves. The control group is injected with Agrobacterium carrying an empty vector.
[0044] After the transient expression is completed, the tobacco plants are inoculated with ChiVMV virus, and are cultured under the same conditions. Seven days after the virus inoculation, the plants are observed for phenotypes and detected for virus content.
[0045] As shown in Figure 3As shown in the results, compared with the control group expressing green fluorescent protein GFP, the typical disease symptoms caused by ChiVMV were significantly reduced in the plants transiently expressing the anti-virus small peptides of the application in tobacco leaves, and the virus accumulation was significantly reduced. It is shown that the anti-virus small peptides of the application can effectively improve the resistance of tobacco to ChiVMV under the in vivo expression condition of tobacco.
[0046] The above-mentioned vectors and agrobacterium strains are only examples, and those skilled in the art can select other expression vectors and agrobacterium strains capable of realizing plant transient expression.
[0047] Example 4, preparation and application of the anti-virus drug An anti-virus drug, taking the anti-virus small peptides of the application as the active ingredient, is prepared according to the following components: The anti-virus small peptides of the application 10 μM, Tween-20 (spreading agent) 0.1%, Glycerol (moisturizing agent) 1%-3%, Sterile purified water to constant volume.
[0048] The anti-virus drug of the application can be used for preventive spraying in tobacco seedling stage and / or intervention in high-risk period of virus occurrence, and has good field applicability.
[0049] The above are only preferred embodiments of the application and are not used to limit the application. For those skilled in the art, the application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. within the spirit and principles of the application shall be included in the protection scope of the application.
Claims
1. An antiviral small peptide, characterized in that, The amino acid sequence is shown in SEQ ID NO.
1.
2. A nucleic acid molecule encoding the antiviral small peptide of claim 1.
3. The following application of the antiviral peptide of claim 1 or the nucleic acid molecule of claim 2, characterized in that, include: Applications in inhibiting viral infection, Applications in the preparation of antiviral drugs Application in the preparation of transgenic plants with antiviral capabilities.
4. The application according to claim 3, characterized in that, The virus in question is the pepper vein mottle virus.
5. The application according to claim 3, characterized in that, Methods for inhibiting viral infection include spraying the plant, injecting or dipping the leaves, and applying the solution either before or after viral infection.
6. An antiviral drug, characterized in that, It includes the antiviral peptide of claim 1 or the nucleic acid molecule of claim 2.
7. The antiviral drug according to claim 6, characterized in that, Its active ingredient is an antiviral peptide with an amino acid sequence as shown in SEQ ID NO.1, at a concentration of 1–50 μM.
8. The antiviral drug according to claim 7, characterized in that, The concentration of the antiviral peptide is 5–10 μM.
9. The antiviral drug according to claim 6, characterized in that, It also includes spreading agents, moisturizers, or slow-release ingredients.
10. A method for preparing transgenic plants with resistance to pepper vein mottle virus, characterized in that, The plants are made to express the antiviral peptide of claim 1 through genetic transformation.