Application of gene ZmNPF6.8 in regulation and control of corn nitrogen absorption and utilization efficiency and corn single plant yield
By cloning and regulating the expression level of the maize ZmNPF6.8 gene, the unresolved issues of the NPF gene in nitrogen use efficiency and yield variation in maize were resolved, thereby improving the nitrogen uptake efficiency and yield of maize and providing a new method for maize breeding.
Patent Information
- Application Number
- CN202311335639.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-16
- Publication Date
- 2026-03-20
AI Technical Summary
The mechanism of NPF gene in maize in nitrogen use efficiency and yield variation has not been fully elucidated, resulting in low nitrogen fertilizer utilization and serious waste of environmental resources.
By cloning the maize ZmNPF6.8 gene and using the transposon mutator insertion method to change its expression level, the efficiency of nitrogen absorption and utilization and the yield per plant in maize can be regulated. This includes using transposons, fast neutrons, EMS mutagenesis and other methods to construct recombinant plant expression vectors to change the expression level of the ZmNPF6.8 gene.
The study successfully regulated the efficiency of nitrogen absorption and utilization in maize and the yield per plant, improving the efficiency of nitrogen absorption and yield in maize and providing a new approach for maize breeding.
Smart Images

Figure CN121699962A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, specifically to a gene ZmNPF6.8 related to high nitrogen absorption in maize, particularly yield and nitrogen transport in plants, and its applications. Background Technology
[0002] Corn (Zea mays L.) is one of the world's most important multi-purpose crops, widely used in the food, feed, chemical, and bioenergy industries. In corn cultivation, less than 30% of nitrogen fertilizer is assimilated and utilized, leaving as much as 70% unused. This significant nitrogen loss results in a serious waste of environmental resources.
[0003] Nitrogen is a crucial component of various secondary metabolites, including nucleic acids, chlorophyll, proteins, and plant hormones, playing varying degrees of role in maize growth, development, and yield formation. The absorption and utilization of nitrogen by maize largely determines its yield level. The NPF family of genes, a class of membrane protein genes containing 12 α-helix transmembrane structures, are widely involved in the process of nitrogen absorption and utilization in plants, playing a vital role and having significant application value in improving and enhancing crop nitrogen use efficiency and yield-related traits. Therefore, research on NPF genes has important breeding application value for improving the efficient utilization of nitrogen nutrition in maize and sustainably increasing maize yield.
[0004] Currently, the functions of many NPF genes in Arabidopsis (31 genes) and rice (16 genes) have been elucidated. However, only the biological functions of four NPF genes in maize have been reported. Compared to research in Arabidopsis and rice, the biological functions of NPF genes in nitrogen use efficiency in maize remain to be explored and elucidated. These genes are closely related to maize not only in nitrogen uptake but also in root formation and grain development. At present, the discovery of maize NPF genes is insufficient, and the mechanisms of action and contributions to yield variation of different NPF genes are not uniform. Therefore, it is necessary to conduct in-depth research on nitrogen transport NPF genes that affect nitrogen uptake efficiency and yield. Summary of the Invention
[0005] The purpose of this invention is to provide an application of the gene ZmNPF6.8 in regulating nitrogen uptake and utilization efficiency and yield per plant in maize. Through genomic variation analysis of genetic populations and investigation of nitrogen content traits in corresponding materials, this invention discovered that the maize ZmNPF6.8 gene is associated with nitrogen uptake and transport traits. Furthermore, using mutant materials with transposon mutator insertion, it was verified that changes in the expression level of the ZmNPF6.8 gene can affect nitrogen use efficiency and yield per plant in maize.
[0006] Specifically, the present invention provides the following technical solution:
[0007] Application of gene ZmNPF6.8 in regulating nitrogen absorption and utilization efficiency and yield per maize plant.
[0008] Application of the gene ZmNPF6.8 in breeding maize materials with efficient nitrogen absorption and high yield.
[0009] The gene ZmNPF6.8 has the nucleotide sequence described in (1) or (2) below:
[0010] (1) The coding region nucleotide sequence as shown in SEQ ID NO:3;
[0011] (2) The nucleotide sequence has more than 90% homology with the nucleotide sequence shown in SEQ ID NO:3 and constitutes the same functional protein nucleotide sequence.
[0012] Alternatively, the gene ZmNPF6.8 has a nucleotide sequence as shown in SEQ ID NO:2, which is the UTR and intron sequence of the gene ZmNPF6.8.
[0013] The protein encoded by the gene ZmNPF6.8 has the following amino acid sequence as shown in (1) or (2):
[0014] (1) The amino acid sequence as shown in SEQ ID NO:1;
[0015] (2) An amino acid sequence with more than 90% homology and the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1.
[0016] This invention successfully cloned the full-length sequence of the ZmNPF6.8 gene, as shown in SEQ ID NO: 3. The corresponding binary vector was constructed and transformed into tobacco and maize protoplasts, suggesting that it encodes a membrane protein.
[0017] This invention regulates nitrogen uptake and utilization efficiency and yield per maize plant by altering the expression level of the protein encoded by the gene ZmNPF6.8; wherein the method for altering the expression level of the protein encoded by the gene ZmNPF6.8 includes:
[0018] (1) By artificially adding Ubiquitin or CaMV35S strong starter elements;
[0019] (2) The expression of the ZmNPF6.8 gene was altered by mutagenesis induced by transposons, fast neutrons, and EMS;
[0020] (3) The expression of ZMNPF6.8 gene was altered by interference, silencing, suppression, targeted knockout or site-directed mutation.
[0021] This invention utilizes the Mutator transposon insertion method to alter the expression levels of normally active mRNA and protein of the ZMNPF6.8 gene. By changing the expression of this gene, the nitrogen uptake and utilization efficiency and yield of maize can be adjusted, thereby enabling the cultivation of maize varieties and materials with high nitrogen uptake efficiency and high yield.
[0022] This study explores the application of altering the expression of the maize ZmNPF6.8 gene through expression cassettes, enhancer sequences, and gene knockout to influence nitrogen uptake and utilization efficiency and yield per plant, as well as the development of novel maize materials with high nitrogen uptake and yield.
[0023] In addition, expression cassettes, recombinant vectors, transgenic cell lines or transgenic recombinant bacteria containing the above-mentioned maize ZmNPF6.8 gene, or substances that alter the expression level of the maize ZmNPF6.8 gene using molecular biology methods, such as site-directed mutagenesis of promoter sequences, are all within the scope of protection of this invention.
[0024] Plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microbombardment. These plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated nucleotides to the 3' end of mRNA precursors; for example, the untranslated regions transcribed at the 3' end of Agrobacterium crown leptocyst-inducing (Ti) plasmid genes (such as the lipase N')s gene) and plant genes (such as the soybean storage protein gene) have similar functions. When constructing recombinant plant expression vectors using these genes, any enhanced or constitutive promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter; these can be used alone or in combination with other plant promoters.
[0025] Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0026] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.
[0027] This invention utilizes the constructed maize ChinaMu transposon insertion mutant library (Liang et al., 2019) to query the Mu transposon insertion location of ZmNPF6.8. The results show that a Mu insertion (zmnpf6.8) occurs in the fourth exon region of the ZmNPF6.8 gene. To rule out the influence of transposon insertion at other sites, we have backcrossed the mutant material into B73 for two generations, obtaining homozygous zmnpf6.8 mutants and wild-type materials. Compared with wild-type maize, the mutant maize exhibits varying degrees of decreased nitrogen uptake and utilization efficiency and yield per plant, indicating that the ZmNPF6.8 gene has a significant impact on nitrogen utilization and yield establishment in maize.
[0028] Compared with the prior art, the beneficial effects of the present invention are:
[0029] This invention reveals that the maize ZmNPF6.8 gene can regulate nitrogen uptake and utilization efficiency, affecting maize growth and yield development. Knocking out this gene leads to downregulation of its expression, resulting in reduced nitrogen uptake and utilization efficiency and lower yield per plant, indicating that changes in gene expression are positively correlated with nitrogen uptake and utilization efficiency and yield per plant, making it a significant major influencing factor. Its protein and encoding gene can be applied to plant genetic improvement.
[0030] This invention regulates the efficiency of nitrogen uptake and utilization in maize and the yield per plant by altering the expression level of the gene ZmNPF6.8, which is of great significance for future breeding work on high-efficiency and high-yield nitrogen-producing maize. Attached Figure Description
[0031] Figure 1 Analysis of the expression pattern of the ZmNPF6.8 gene.
[0032] Figure 2 Analysis of nitrogen uptake and utilization efficiency characteristics of two ZmNPF6.8 haplotype materials.
[0033] Figure 3 Analysis of transposon insertion sites and quantitative fluorescence expression levels in the ZmNPF6.8 gene mutant line.
[0034] Figure 4Analysis of nitrogen uptake and utilization in the ZmNPF6.8 mutant line during the seedling stage.
[0035] Figure 5 Analysis of the impact of the ZmNPF6.8 mutant on maize yield. Detailed Implementation
[0036] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0038] Example 1: Expression pattern of the ZmNPF6.8 gene
[0039] Expression pattern studies were conducted using the B73 inbred line. The ZmNPF6.8-GFP fusion protein was constructed, and transient expression in B73 maize mesophyll protoplasts was used as a homology verification for subcellular localization. The blank vector served as a control group. The results showed that a large amount of GFP was present inside the protoplasts, while the experimental group with the fusion protein showed that the ZmNPF6.8(Zm00001d016982)-GFP fluorescent signal was present in large quantities on the protoplast membrane, suggesting that the ZmNPF6.8 protein is a membrane protein (Figure 1A).
[0040] Then, qRT-PCR analysis was performed using a CFX Connect Real-Time PCR System (Bio-Rad Laboratories) in a two-step method: denaturation temperature 95℃, 30s; annealing extension 60℃, 30s; 40 cycles. Melting curves were set at 95℃, 15s; 60℃, 60s; 95℃, 15s to control the Cq values for quantitative PCR. The housekeeping gene ZmUPF1 (Zm00001d006438) was used as an internal control. Expression levels in tissues at different growth stages were calculated using the 2-ΔΔCt method, and one-way ANOVA with LSD multiple comparisons was performed using SPSS software (p<0.05). The results showed that ZmNPF6.8 was mainly expressed at higher levels in maize leaves (SN: 5mM KNO3; DN: 0.5mM KNO3). Figure 1 -B).
[0041] Finally, RNA in situ hybridization analysis was performed: First, after germination, B73 seedlings were transferred to hydroponics for 14 days, and samples were taken from leaves and roots, with three independent biological replicates. Then, young spikelets at the peak of ZmNPF6.8 gene expression were fixed in 50% FAA fixative, vacuum-sealed, dehydrated with gradient ethanol, cleared with gradient xylene, and embedded in paraffin for sectioning. The resulting paraffin sections were dewaxed, acetylated, dehydrated with gradient ethanol, and then subjected to probe hybridization. The tissue sites where the antisense probe showed a hybridization signal, while the sense probe showed no signal, were the expression sites of the target gene in vivo. The in situ hybridization results of this study showed that ZmNPF6.8 expression was higher in the vascular tissue of senescent leaves. Figure 1 -C).
[0042] This invention obtained descriptive results on the gene sequence by studying the expression level of the sequence shown in SEQ ID NO:3 and by overexpressing the sequence shown in SEQ ID NO:3 in protoplasts to obtain the amino acid sequence of SEQ ID NO:1, providing a basis for further applications to improve nitrogen absorption and assimilation efficiency.
[0043] Example 2: ZmNPF6.8 exhibits two phenotypic differential allelic haplotypes in a natural population.
[0044] In 2021, 149 natural genetic populations were cultivated hydroponically in the Liuhe Experimental Greenhouse of the Jiangsu Academy of Agricultural Sciences. The photoperiod was 8 / 16 (day / night), the day / night temperature was 22℃ / 25℃, and the light intensity was 200 μmol·m⁻¹. -2 ·s -1 The relative humidity was approximately 65%-75%. A modified Hoagland nutrient solution was used for cultivation, with the following formula: 4.0 mM CaCl2, 2.0 mM MgSO4, 2.0 mM KH2PO4, 4.6 mM H3BO3, 0.5 mM MnCl2, 0.2 mM ZnSO4, and 0.1 mM Na6Mo7O4. 24 0.2 mM CuSO4, 45 mM FeCl3, 5 mM KNO3. The total nitrogen content of the leaves was determined after 2 weeks of cultivation.
[0045] (1) Weigh 0.1g of plant leaf powder into a nitrogen determination tube, moisten the sample with 1ml of deionized water, add 5ml of concentrated sulfuric acid and let stand overnight. Set up 3 independent biological replicates for each sample.
[0046] (2) Digestion: Heat the digestion furnace to 250°C, place the nitrogen determination tube in, digest for 20 minutes, add 10 drops of 30% H2O2 catalyst, shake to mix, then heat the digestion furnace to 350°C and continue digestion for 5-6 hours until the sample is clear.
[0047] (3) Distillation titration: The completely digested sample is placed in an automatic Kjeldahl nitrogen analyzer (Hanon) for distillation. Each sample takes about 5 minutes. The distilled sample is then titrated with boric acid indicator, and the titration volume is recorded.
[0048] (4) Calculate the total nitrogen content (mg / g) of plant tissue according to the formula:
[0049] Total nitrogen content = (V - V0) × c(HCl) × 14.0 × 10 -3 / m
[0050] Note: Where V represents the volume of acid standard solution used in titrating the test sample, V0 represents the volume of acid standard solution used in titrating the blank, c: 0.01mol / L (HCl) represents the concentration of 0.01mol / L standard solution, and m represents the mass of the dried sample.
[0051] Phenotypic data analysis was performed using SAS 9.3 statistical software, categorizing traits by maximum, minimum, mean, standard deviation, coefficient of variation, skewness, and kurtosis (Pritchard et al., 2001). Using TASSEL 5.0 software, a mixed linear model (MLM) of population structure and kinship (Q+K) was employed to perform association analysis on total nitrogen content and SNP loci in a natural population composed of 149 maize inbred lines. The threshold for significant P-values was set to P < 10. -5 The results showed that the ZmNPF6.8 gene is the major QTL affecting nitrogen content in maize, and two haplotypes with significantly different phenotypes, Hap1 (TTC) and Hap2 (CGT), were widely observed. Three SNP sites in Hap1 and Hap2 correspond to key amino acids (Asp and Gly, Phe and Lys, Ala and Trp), with the Hap2 haplotype being the superior allelic haplotype. Figure 2 ).
[0052] Example 3: Obtaining the ZmNPF6.8 transposon insertion mutant line and determining its nitrogen translocation capacity and yield. This study created a maize ChinaMu mutant library (http: / / chinamu.jaas.ac.cn / cindex.html) by crossing the maize Mu active line with the B73 inbred line. Through this mutant library, a Mu insertion (zmnpf6.8) was found in the fourth exon region of the ZmNPF6.8 gene. Figure 3-A), the insertion site is located at position 181884791 on chromosome 5, and the seed bank number obtained is M3T00800185. To exclude the influence of transposon insertion at other sites, the mutant material was backcrossed into B73 for two generations, resulting in a homozygous mutant (zmnpf6.8) and wild-type material (WT). The template sequence was obtained by searching the maize B73_RefGen_v4 reference genome in Phytozome (https: / / phytozome-next.jgi.doe.gov / ).
[0053] Primers were designed using Primer Premier 5.0 software based on the insertion site (as shown in SEQ ID NO: 4-6), with an annealing temperature (Tm) of approximately 59°C.
[0054] P1:GAGCAGGATGGAGAGGAATAGG;
[0055] P2:GCGATCAACGAGACTGAGCAG;
[0056] Tir6:AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC.
[0057] Then use Max Super-Fidelity DNA Polymerase (Vazyme) was used for PCR amplification of the ZmNPF6.8 gene sequence. A 1.5% (M / V) agarose gel was prepared using Solarbio agarose. An appropriate amount of 1×TAE buffer was added, and the gel was microwaved for 2 minutes until completely dissolved. After cooling, 5 μL of Eppendorf dye was added, mixed well, poured into a mold, and allowed to solidify. The gel was then transferred to an electrophoresis tank, with 1×TAE used as a buffer solution. After loading the sample, agarose gel electrophoresis was performed at 120V for 1 hour. Figure 3 -B), and finally ultraviolet development and photography.
[0058] qPCR primers (F: CGCCGTCTTCGTCGTCTTC; R: GTTCAGCCTTCATGCCCAATTC (SEQ ID NO: 7-8)) for mutant materials were designed using Primer Premier 5.0 software. qRT-PCR was performed using a two-step method on a CFX ConnectReal-Time PCR System (Bio-Rad Laboratories), with the housekeeping gene ZmUPF1 (Zm00001d006438) as an internal control. The relative expression levels of wild-type and ZmNPF6.8 mutant materials were calculated using the 2-ΔΔCt method. One-way ANOVA with LSD multiple comparisons was performed using SPSS software (p < 0.05). The results showed that the expression level of ZmNPF6.8 in the mutant material was significantly downregulated. Figure 3 -C). An investigation of total nitrogen content-related traits in maize was conducted on the ZmNPF6.8 mutant. The expression levels of the mutant gene were significantly downregulated. Simultaneously, under both nitrogen-sufficient (SN: 5mM KNO3) and nitrogen-deficient (DN: 0.5mM KNO3) conditions, the total nitrogen content, nitrate content, and other nitrogen-related traits in the mutant plants decreased to varying degrees. Figure 4 A yield survey of the ZmNPF6.8 mutant line revealed varying degrees of yield reduction in the mutant plants under three soil fertility gradients (sufficient nitrogen, 50% nitrogen, and 25% nitrogen). Figure 5 ).
[0059] Therefore, downregulation of the ZmNPF6.8 gene expression level has a significant impact on total nitrogen content-related traits and yield per plant in maize. By altering the expression level of the ZmNPF6.8 gene, changes in nitrogen uptake and utilization efficiency and yield per plant in maize can be regulated, which is of great significance for future nitrogen-efficient and high-yield breeding work in maize.
[0060] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.
Claims
1. Application of gene ZmNPF6.8 in regulating nitrogen absorption and utilization efficiency and yield per maize plant.
2. Application of gene ZmNPF6.8 in breeding maize materials with efficient nitrogen absorption and high yield.
3. The application according to claim 1 or 2, characterized in that: The gene ZmNPF6.8 has the following nucleotide sequence as described in (1) or (2): (1) The coding region nucleotide sequence as shown in SEQ ID NO:3; (2) It has more than 90% homology with the nucleotide sequence shown in SEQ ID NO:3 and constitutes the nucleotide sequence of a protein with the same function.
4. The application according to claim 1 or 2, characterized in that: The gene ZmNPF6.8 has the nucleotide sequence shown in SEQ ID NO:
2.
5. The application according to claim 1 or 2, characterized in that: The protein encoded by the gene ZmNPF6.8 has the following amino acid sequence as shown in (1) or (2): (1) The amino acid sequence as shown in SEQ ID NO:1; (2) An amino acid sequence with more than 90% homology and the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:
1.
6. The application according to claim 5, characterized in that: By altering the expression level of the protein encoded by the gene ZmNPF6.8, the nitrogen uptake and utilization efficiency and yield per maize plant can be regulated. Among them, the methods for altering the expression level of the protein encoded by the gene ZmNPF6.8 include: (1) artificially increasing the strong promoter element Ubiquitin or CaMV35S; (2) altering the expression of the ZmNPF6.8 gene through mutagenesis by transposons, fast neutrons, or EMS; and (3) altering the expression of the ZMNPF6.8 gene through interference, silencing, inhibition, targeted knockout, or site-directed mutagenesis.
7. The application according to claim 6, characterized in that: The expression levels of normal-active mRNA and protein of the ZMNPF6.8 gene were altered using the Mutator transposon insertion method.