Plant genetic transformation system based on direct delivery, genetic transformation method and application

By modifying the vector and the direct delivery method of Agrobacterium, the problems of low efficiency and long time of genetic transformation in legumes were solved, achieving efficient and simple genetic transformation and obtaining highly efficient positive plants and seeds.

CN121699993APending Publication Date: 2026-03-20YAZHOUWAN NATIONAL LABORATORY +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202610213942.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-13
Publication Date
2026-03-20

AI Technical Summary

Technical Problem

Existing technologies for plant genetic transformation are characterized by low efficiency and long processing times, especially in legumes such as soybeans, where tissue culture procedures are complex and susceptible to contamination, affecting transformation efficiency.

Method used

By modifying the vector, replacing the LUC expression cassette with a modular expression cassette integrating epitope tags, introducing efficient restriction enzyme sites and Kozak sequences, and inserting the Kozak sequence in the region immediately upstream of the multiple cloning site, a recombinant modified vector was constructed. Genetic transformation was then directly delivered using modified Agrobacterium, avoiding operation under aseptic conditions.

Benefits of technology

It achieves efficient plant genetic transformation, shortens the transformation cycle, improves the efficiency of obtaining positive plants, simplifies the operation process, reduces the risk of contamination, and can obtain positive regenerated branches within 2 weeks and harvest T0 generation seeds within 4 months.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121699993A_ABST
    Figure CN121699993A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of plant genetic transformation, and provides a plant genetic transformation system based on direct delivery, a genetic transformation method and application. An original vector pMKV057 is directionally modified to obtain a modified vector, and the modification method comprises the following steps: replacing an LUC expression cassette of the vector with a modular expression cassette integrated with an epitope tag; the method comprises the following steps: designing multiple cloning sites on a vector, introducing restriction enzyme cutting sites HindIII and EcoRI or HindIII and XbaI, and inserting a Kozak sequence into a 5'end upstream adjacent region of a nucleotide sequence of the multiple cloning sites to obtain a modified vector. And transforming the modified vector into agrobacterium tumefaciens to carry out plant genetic transformation. Through the technical scheme, the problems of low plant genetic transformation efficiency and long transformation time in related technologies are solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic transformation technology, specifically to a plant genetic transformation system, genetic transformation method, and application based on direct delivery. Background Technology

[0002] Genetic transformation technology is a crucial foundation for plant genetics research and modern molecular design breeding. The delivery of exogenous genes primarily relies on Agrobacterium tumefaciens-mediated transformation and gene gun bombardment. However, traditional gene delivery methods require sophisticated and time-consuming tissue culture procedures and have limited success rates.

[0003] Ectopic expression of specific developmental regulatory genes (DRs) can improve plant regeneration efficiency. For example, overexpression of ZmWUS2 in maize promotes somatic embryogenesis and improves transformation efficiency. Recent studies in soybean have demonstrated that the expression of chimeric growth regulators (GRFs) and their interactions (GIFs) significantly enhances soybean regeneration and transformation efficiency. Ispenyltransferase (ipt), an enzyme involved in cytokinin synthesis, has also become a subject of research. Overexpression of ipt increases cytokinin levels in plants, thereby stimulating axillary bud proliferation and promoting adventitious bud formation in various plants. However, these studies largely rely on or partially borrow from plant tissue culture processes, which are complex and require some steps to be performed under sterile conditions.

[0004] Legumes (such as soybeans) are among the world's most important crops and a significant source of plant protein in food and feed. Although various genetic transformation methods for legumes have been developed using Agrobacterium-mediated transformation, tissue culture remains a core bottleneck in these technologies. Many factors, including plant genotype, Agrobacterium concentration, co-culture time, and culture medium composition, significantly impact transformation efficiency. Furthermore, tissue culture is susceptible to fungal and bacterial contamination, further reducing efficiency and often resulting in lengthy transformation times. Therefore, developing innovative genetic transformation methods has become an urgent research need. Summary of the Invention

[0005] This invention proposes a plant genetic transformation system, genetic transformation method, and application based on direct delivery, which solves the problems of low efficiency and long transformation time in related technologies.

[0006] The technical solution of the present invention is as follows: This invention proposes a modified carrier, wherein the modified carrier is subjected to the following directional modification: A1. Replace the LUC expression box of the carrier with a modular expression box that integrates epitope tags; A2. Design a multiple cloning site on the vector, introduce restriction enzyme sites HindIII and EcoRI or HindIII and XbaI, and insert a Kozak sequence in the region immediately upstream of the 5' end of the nucleotide sequence of the multiple cloning site.

[0007] As a further technical solution, the modular expression box integrating epitope tags includes a modular expression box integrating FLAG epitope tags or a modular expression box integrating MYC epitope tags. The modular expression box integrating the FLAG epitope tag contains a p35S promoter, a FLAG epitope tag, and a pearlcs E9 terminator; The modular expression box integrating the MYC epitope tag contains the GmUBI promoter, the MYC epitope tag, and the pearbcs E9 terminator.

[0008] As a further technical solution, the Kozak sequence is: GCCACCATGG, as shown in SEQ ID NO:3.

[0009] This invention also proposes a method for constructing a modified vector, comprising the following steps: removing the LUC expression cassette of the vector and replacing it with a modular expression cassette integrating an epitope tag; designing a multiple cloning site on the vector, introducing restriction enzyme sites HindIII and EcoRI or HindIII and XbaI, and inserting a Kozak sequence in the 5'→3' direction immediately adjacent to the 5' end of the nucleotide sequence of the multiple cloning site to obtain the modified vector.

[0010] The present invention also proposes a recombinant and modified carrier, wherein the recombinant and modified carrier is the modified carrier described above or the modified carrier obtained by the above construction method; The vector is obtained by inserting a foreign target gene into the original vector.

[0011] As a further technical solution, the exogenous target gene includes the ZmWUS2 gene or the ipt gene.

[0012] The exogenous target genes of the present invention include, but are not limited to, stress resistance-related genes, quality-related genes, yield-related genes, nutrient metabolism-related genes, reporter genes, selection marker genes and combinations thereof, such as the ZmWUS2 gene or the ipt gene.

[0013] As a further technical solution, when the exogenous target gene is the ZmWUS2 gene, the expression cassette expressing the ZmWUS2 gene in the recombinant vector includes the NOS promoter, the ZmWUS2 gene, and the terminator. The sequence of the ZmWUS2 gene is shown as nucleotides 279-1187 in SEQ ID NO:1.

[0014] As a further technical solution, when the exogenous target gene is the ipt gene, the expression cassette expressing the ipt gene in the recombinant vector includes the CaMV 35S promoter, the ipt gene, and a terminator. The sequence of the ipt gene is shown as nucleotides 851-1573 in SEQ ID NO:2.

[0015] The present invention also proposes a modified Agrobacterium, which is obtained by transforming the recombinant modified vector into Agrobacterium.

[0016] The present invention also proposes an Agrobacterium suspension containing the modified Agrobacterium.

[0017] This invention also proposes a method for preparing Agrobacterium suspension, comprising the following steps: The modified Agrobacterium was inoculated into a culture medium and cultured. After centrifugation and resuspension, it was cultured again in a co-culture medium, centrifuged, and the bacterial cells were collected. The bacterial cells were then resuspended using an infection solution to obtain an Agrobacterium suspension.

[0018] As a further technical solution, the OD of the Agrobacterium suspension 600 The value is 0.2 to 0.4.

[0019] As a further technical solution, the co-culture medium is YEP liquid medium supplemented with 2-morpholine ethanesulfonic acid, acetylsuccinone and antibiotics.

[0020] The present invention also proposes a plant genetic transformation system based on direct delivery, comprising a plant growth medium and an Agrobacterium suspension; wherein the Agrobacterium suspension is the above-mentioned Agrobacterium suspension or an Agrobacterium suspension prepared by the above-mentioned preparation method; and wherein the plant comprises soybean.

[0021] This invention also proposes a plant genetic transformation method based on direct delivery, comprising the following steps: Plant explants were infected with Agrobacterium suspension, cultured, and positive plants were identified to obtain transformed plants; the Agrobacterium suspension was the above-mentioned Agrobacterium suspension or the Agrobacterium suspension prepared by the above preparation method.

[0022] The present invention also proposes the application of the modified vector, the modified Agrobacterium, the Agrobacterium suspension, or the plant genetic transformation system in any of the following B1 to B7: B1. Improve the transformation efficiency of plant genomes; B2. Shorten the cycle of plant genetic transformation; B3. Cultivating genetically modified plants; B4. Verification of plant gene function; B5. Plant genome site-specific or multi-site editing; B6. Plant multi-gene co-transformation and trait stacking improvement; B7. Construction of plant molecular markers or reporter groups; The plants mentioned include legumes.

[0023] As a further technical solution, the legume includes soybean.

[0024] The direct delivery genetic transformation method of the present invention can be used for the genetic transformation of soybean materials to obtain transgenic soybean plants, seeds and their propagation materials; wherein, it includes wounding the apical meristem / apical bud region of soybean at a specific developmental stage, and delivering Agrobacterium suspension to the wound site to achieve the introduction of exogenous target genes, and inducing the formation of positive buds / positive plants under non-sterile conditions.

[0025] Applying the non-sterile, tissue culture-free soybean genetic transformation method of this invention to scenarios such as molecular breeding research and development, gene function verification, trait verification, candidate gene / regulatory element screening, and strain creation can shorten the cycle from construction and introduction to obtaining fruiting plants / seeds.

[0026] When the direct delivery genetic transformation system of the present invention is used for targeted or multi-site editing of plant genomes, the gene editing components include one or more of the following: a CRISPR / Cas system, a base editor, a guide editor, and a transposase-assisted editing system. The CRISPR / Cas system includes Cas9, Cas12a, and functional variants, as well as a guide RNA expression cassette that is compatible with the CRISPR / Cas system. The guide RNA expression cassette can be inserted into the modified vector for delivery, thereby achieving targeted editing of the plant genome and obtaining plants, seeds, and their propagation materials carrying the editing results of the target site. Alternatively, it can achieve multi-site editing of plants, redundancy analysis of gene families, or joint improvement of multiple traits to obtain materials with multi-site editing.

[0027] When the direct delivery genetic transformation system of the present invention is used for multi-gene co-transformation and trait stacking improvement in plants, two or more exogenous target genes are introduced in the same plant transformation event to achieve plant trait stacking improvement; the exogenous target genes can be inserted into the modified vector.

[0028] When the direct delivery genetic transformation system of the present invention is used for the construction of plant molecular markers or reporter groups, it introduces reporter genes, epitope tags or luminescent marker modules into the plant for plant protein localization, gene expression monitoring, protein interaction verification, tissue-specific expression analysis and genetic material tracking.

[0029] The direct delivery genetic transformation method of the present invention has been proven effective in soybeans and is expected to be extended to plant materials that are highly dependent on tissue culture or lack mature in vitro regeneration systems.

[0030] The working principle and beneficial effects of this invention are as follows: In this invention, by modifying the original vector to overcome its capacity limitations, replacing the promoter, redesigning the multiple cloning site (MCS), and introducing exogenous tag proteins, a simple, rapid, and efficient method for constructing transgenic plants with high positive plant transformation efficiency and a short time cycle was successfully developed. Positive regenerated branches can be obtained within 2 weeks after infection, and T0 generation seeds can be harvested within 4 months. Transgenic positive T0 generation plants were successfully obtained without in vitro rooting. Specific modifications included: removing the original LUC expression cassette from the vector and replacing it with a modular expression cassette integrating an epitope tag (FLAG or MYC) to facilitate the detection of foreign proteins; replacing the original AtUBQ10 promoter with the legume active promoter p35S or GmUBI; redesigning the multiple cloning site (MCS) to introduce a highly efficient single restriction enzyme cleavage site; and inserting an optimized Kozak sequence immediately upstream of the MCS to enhance translation efficiency. By eliminating redundant restriction sites outside the multiple cloning site (MCS) region without altering the coding amino acid sequence, conditions are created for subsequent multi-genome assembly and co-transformation of exogenous genes. Attached Figure Description

[0031] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0032] Figure 1 This is a flowchart illustrating the derivative vector of the present invention; Figure 2 This is a flowchart illustrating the preparation process of the Agrobacterium suspension of the present invention; Figure 3 This is a schematic diagram of the bud point of a soybean seedling at the first node stage according to the present invention; Figure 4 This is a flowchart of the soybean gene transformation process of the present invention; Figure 5 This is an electrophoretic detection image of the red bean transformation positive plants of this invention; Figure 6 This is a comparison diagram of the growth and development of wild-type control plants and red bean T0 generation plants of this invention. Detailed Implementation

[0033] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0034] Example 1 1. Acquisition of gene fragments, construction of expression cassettes, and sequence information (1) Obtaining the 35S promoter (p35S promoter) gene fragment: Using pH7WFG2 vector as template, PCR amplification was performed using primers p35S-F and p35S-R. The target fragment was separated and recovered by agarose gel electrophoresis, thus obtaining the p35S promoter gene fragment. The sequence of primer p35S-F is as follows: CGCGGCCGCACAGAGATTTAAATGACTAGAGCCAAGCTGATC, as shown in SEQ ID NO:4; The sequence of primer p35S-R is as follows: GCCGGATCCAAGCTTGAATTCCATGGTGGCGTCGACTAGAATAGTAAATTGTAATGTT, as shown in SEQ IDNO:5; The PCR reaction system consisted of: 25 μL 2×Phanta Max Buffer, 2 μL primer p35S-F (10 μM), 2 μL primer p35S-R (10 μM), 1 μL dNTP Mix (10 mM each), 1 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL DNA, and ddH2O added to bring the total volume to 50 μL. The PCR reaction program was as follows: S1, pre-denaturation at 95℃ for 3 min; S2, denaturation at 95℃ for 15 s; S3, annealing at 58℃ for 15 s; S4, extension at 72℃ for 2 min; repeat steps S2-S4 35 times; S5, complete extension at 72℃ for 5 min.

[0035] (2) Obtaining the GmUBI promoter gene fragment: Genomic DNA of soybean variety ZH13 was extracted as an amplification template and PCR amplification was performed using primers GmUBI-F and GmUBI-R to obtain the GmUBI promoter gene fragment (using Novizan P505 high-fidelity enzyme). The sequence of primer GmUBI-F is as follows: GCGCCCTATGTCGAGCTGCAGGAACTTGAAGGTGCATGTGACTCC, as shown in SEQ ID NO:6; The sequence of primer GmUBI-R is as follows: ATCTGTGATTGTTGACTCGACAGCCACCATGGAAGCTTGCTCTAGA, as shown in SEQ ID NO:7; The PCR reaction system consisted of: 25 μL 2×Phanta Max Buffer, 2 μL primer GmUBI-F (10 μM), 2 μL primer GmUBI-R (10 μM), 1 μL dNTP Mix (10 mM each), 1 μL Phanta Max Super-Fidelity DNA Polymerase, 1 μL DNA, and ddH2O added to bring the total volume to 50 μL. The PCR reaction program was as follows: S1, pre-denaturation at 95℃ for 3 min; S2, denaturation at 95℃ for 15 s; S3, annealing at 58℃ for 15 s; S4, extension at 72℃ for 2 min; repeat steps S2-S4 35 times; S5, complete extension at 72℃ for 5 min.

[0036] (3) Using the 35S promoter (p35S promoter) gene fragment as the upstream element, connect the FLAG epitope tag sequence and the pea rbcs E9 terminator sequence to construct a modular expression box of 35S promoter-FLAG-terminator, and obtain a modular expression box integrating the epitope tag FLAG; The specific sequence of the epitope tag FLAG is: TCCGGCGGAGGTGGCTCCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGACTACAAAGACCATGATGGAGACTATAAGGATCACGACATCGATTACAAGGACGATGACGATAAGTAG, as shown in SEQ ID NO:8.

[0037] (4) Using the GmUBI promoter gene fragment as the upstream element, the MYC epitope tag sequence and the pea rbcs E9 terminator sequence were linked to construct a modular expression cassette of GmUBI promoter-MYC-terminator, and the modular expression cassette integrating the epitope tag MYC was obtained. The specific sequence of the epitope tag MYC is as follows: GAGCAAAAGTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTT GAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGAGCTTGGGCGACCTCACCATGGAGCAAAAGCTCATTTCTGAAGAGGACTTG, such as SEQ Shown as IDNO:9.

[0038] (5) The Kozak sequence is: GCCACCATGG, as shown in SEQ ID NO:3.

[0039] 2. Modified Carrier - The original carrier pMKV057 was modified directionally. The directional modification method is as follows: 2.1 The original AtUBQ10 promoter, LUC expression cassette, and ZmWUS2 and ipt genes in the original vector pMKV057 were removed and replaced with a modular expression cassette integrating the epitope tag FLAG to obtain the intermediate vector; The exogenous gene ZmWUS2 was inserted into the above intermediate vector, and the specific multiple cloning site (MCS) was redesigned. The MCS sequence of the derived vector expressing the ZmWUS2 gene is: GAATTCAAGCTT, as shown in SEQ ID NO:10. The Kozak sequence was inserted immediately upstream of the MCS. The MCS sequence and Kozak sequence were designed in advance on primers, and after amplification, they were recombined to obtain the modified ZmWUS2 vector. The Kozak sequence was inserted in the region immediately upstream of the 5' end of the MCS nucleotide sequence in the 5'→3' direction.

[0040] 2.2 The original AtUBQ10 promoter, LUC expression cassette, and ZmWUS2 and ipt genes in the original vector pMKV057 were removed and replaced with a modular expression cassette integrating the epitope tag MYC to obtain the intermediate vector; The exogenous gene ipt was inserted into the above intermediate vector, and the specific multiple cloning site (MCS) was redesigned. The MCS sequence of the derivative vector expressing the ipt gene is: AAGCTTTGCTCTAGA, as shown in SEQ ID NO:11. The Kozak sequence was inserted immediately upstream of the MCS. The MCS sequence and Kozak sequence were designed in advance on primers, and after amplification, they were recombined to obtain the modified ipt vector. The Kozak sequence was inserted in the region immediately upstream of the 5' end of the MCS nucleotide sequence in the 5'→3' direction.

[0041] 3. Vector Modification - The NOS-ZmWUS2-T intermediate vector, obtained by inserting the exogenous target gene ZmWUS2 into the original vector pMKV057, was then directionally modified. The methods for obtaining the intermediate vector and the directionally modified vector are as follows: 3.1 Obtaining the intermediate vector: The original vector pMKV057 was double-digested with restriction endonucleases SwaI and XhoI. The digestion reaction was carried out by incubation at 37℃ for 2 hours. After purification, the digestion products were used for multi-fragment recombination with the pea rbcs E9 terminator gene fragment, the NOS promoter gene fragment, and the ZmWUS2 gene fragment (using Novizan C112CloneExpress). II. One-step cloning kit, wherein the optimal amount of cloning vector used is: [0.02 × number of base pairs of cloning vector] ng (0.03 pmol), and the optimal amount of insert fragment used is [0.04 × number of base pairs of insert fragment] ng (0.06 pmol) to obtain the recombinant product; the recombinant product is added to DH5α competent cells (the amount added does not exceed 1 / 10 of the total volume), incubated on ice for 30 min, heat-shocked in a 42℃ water bath for 45 s, and then placed on ice for 5 min. On a clean bench, 600 μL of antibiotic-free LB is added to the competent cells, and after culturing in a shaker at 37℃ for 1 h, the bacterial culture is centrifuged at 5000 rpm for 2 min, the supernatant is discarded, and the cells are resuspended in the residual supernatant. 50 μL is taken and spread on a kanamycin-resistant LB plate, and cultured overnight at 37℃. The NOS-ZmWUS2-T intermediate vector containing developmental regulatory factors is obtained by identification using bacterial detection primers. The primer sequences for bacterial detection are as follows: ZmWUS2-Bacterial Detection-F: GCCGCACAGAGATTTAAATAGCT, as shown in SEQ ID NO:12; ZmWUS2-Bacterial Detection-R:GATGCCCACATTATAGTGATTAGC, as shown in SEQ ID NO:13; The sequence of the NOS-ZmWUS2-T intermediate vector for developmental regulators is shown in SEQ ID NO:1, wherein nucleotides 1-180 are the NOS promoter sequence, nucleotides 279-1187 are the ZmWUS2 gene sequence, and nucleotides 1418-1725 are the terminator sequence.

[0042] 3.2 Targeted modification method: Modular expression cassettes integrating epitope tag FLAG were added to the NOS-ZmWUS2-T intermediate vector containing developmental regulatory factors to obtain a derivative vector expressing the ZmWUS2 gene; For the derived vector expressing the ZmWUS2 gene, a specific multiple cloning site (MCS) was redesigned. The MCS sequence of the derived vector expressing the ZmWUS2 gene is GAATTCAAGCTT, as shown in SEQ ID NO:10. Highly efficient single restriction enzyme sites EcoRI and HindIII were introduced. A Kozak sequence was inserted immediately upstream of the MCS. The MCS sequence and Kozak sequence were designed in advance on primers, and after amplification, they were recombined to obtain the modified ZmWUS2 vector. The Kozak sequence was inserted in the region immediately upstream of the 5' end of the MCS nucleotide sequence in the 5'→3' direction.

[0043] 4. Vector Modification - The original vector pMKV057 was modified by inserting the exogenous target gene ipt to obtain the CaMV 35S-ipt-T intermediate vector, followed by targeted modification. The methods for obtaining the CaMV 35S-ipt-T intermediate vector and the targeted modification methods are as follows: 4.1 Obtaining the intermediate vector: The original vector pMKV057 was double-digested with restriction endonucleases SwaI and XhoI. The digestion reaction was carried out by incubation at 37°C for 2 hours. After purification, the digestion products were used for multi-fragment recombination with the CaMV 35S promoter gene fragment and the ipt gene fragment (using Novizan C112 CloneExpress). II. One-step cloning kit, wherein the optimal amount of cloning vector used is: [0.02 × number of base pairs of cloning vector] ng (0.03 pmol), and the optimal amount of insert fragment used is [0.04 × number of base pairs of insert fragment] ng (0.06 pmol) to obtain the recombinant product; the recombinant product is added to DH5α competent cells (the amount added does not exceed 1 / 10 of the total volume), incubated on ice for 30 min, heat-shocked in a 42℃ water bath for 45 s, and then placed on ice for 5 min. On a clean bench, 600 μL of antibiotic-free LB is added to the competent cells, and after culturing in a shaker at 37℃ for 1 h, the bacterial culture is centrifuged at 5000 rpm for 2 min, the supernatant is discarded, and the cells are resuspended in the residual supernatant. 50 μL is taken and spread on a kanamycin-resistant LB plate, and cultured overnight at 37℃. The CaMV 35S-ipt-T intermediate vector containing developmental regulatory factors is obtained by identification using bacterial detection primers. The sequence of the CaMV 35S-ipt-T intermediate vector for developmental regulators is shown in SEQ ID NO:2, wherein nucleotides 1-833 are the CaMV 35S promoter sequence, nucleotides 851-1573 are the ipt gene sequence, and nucleotides 1582-1889 are the terminator sequence.

[0044] 4.2 Targeted modification method: A modular expression cassette integrating the epitope tag MYC was added to the CaMV 35S-ipt-T intermediate vector containing developmental regulatory factors to obtain a derivative vector expressing the ipt gene; For the vectors expressing the ipt gene, a specific multiple cloning site (MCS) was redesigned. The MCS sequence of the vectors expressing the ipt gene is: AAGCTTTGCTCTAGA, as shown in SEQ ID NO:11. Highly efficient single restriction enzyme sites XbaI and HindIII were introduced. A Kozak sequence was inserted immediately upstream of the MCS. The MCS and Kozak sequences were designed in advance on primers, and the vectors were amplified and recombined to obtain the modified ipt vector. The Kozak sequence was inserted in the region immediately upstream of the 5' end of the MCS nucleotide sequence in the 5'→3' direction.

[0045] The expression frames of the vectors expressing the ZmWUS2 gene and the vectors expressing the ipt gene are shown above, as follows: Figure 1 As shown.

[0046] 5. Preparation of Agrobacterium suspension Using a chemical transformation method, 10 μL of a vector expressing the ipt gene was added to Agrobacterium tumefaciens GV3101-P19 strain, followed by ice bath for 30 min, flash freezing in liquid nitrogen for 5 min, and thawing in a water bath at 28°C for 5 min. 1 mL of LB medium (antibiotic-free) was added, and the culture was incubated in a shaker at 28°C for 3 h. After removal, the culture was centrifuged at 5000 rpm for 2 min, the supernatant was discarded, and the bacterial cells were resuspended in the residual LB medium and inoculated onto YEP agar plates containing gentamicin (50 μg / mL), rifampin (25 μg / mL), kanamycin (50 μg / mL), and tetracycline (25 μg / mL). A single colony was inoculated into 20 mL of YEP liquid medium containing gentamicin (50 μg / mL), rifampin (25 μg / mL), kanamycin (50 μg / mL), and tetracycline (25 μg / mL), and incubated overnight at 28°C with shaking at 200 rpm. The bacterial culture was centrifuged at 4000g for 10 min at room temperature, and the precipitate was resuspended in an optimized co-culture medium (the co-culture medium was YEP liquid medium supplemented with 10 mM 2-morpholinoethanesulfonic acid (MES), and supplemented with 20 μm acetylsuccinone and gentamicin (50 μg / mL), rifampin (25 μg / mL), kanamycin (50 μg / mL), and tetracycline (25 μg / mL), pH 5.6). The OD was adjusted. 600 =0.3, and cultured overnight at 28℃ with shaking at 200 rpm; the overnight culture was centrifuged at 4000g for 10 min at room temperature, the cells were collected and the liquid was removed; the cell concentration was resuspended to OD using the infection solution. 600 =0.3, and allowed to stand in the dark at room temperature for 3 hours to obtain Agrobacterium suspension; wherein, the composition of the infection solution includes 10 mM MES, 150 μm acetylsuccinone, 10 mM MgCl2; the pH of the infection solution is 5.6.

[0047] 6. Agrobacterium-mediated genetic transformation Infection and Cultivation: Soybean seeds (red beans) are buried 3 cm deep in vermiculite. After they sprout and grow for 7 days, soybean seedlings at the first node stage can be obtained. The main characteristic of soybean seedlings at the first node stage is that the single leaves are unfolded and the leaf edges do not touch.

[0048] Completely destroy the buds of soybean seedlings at the first node stage, quickly inoculate the wound with Agrobacterium suspension using a syringe, and hang the droplets at the wound. Then transfer the infected plants to the culture room and grow them at 26℃ with a photocycle of 16 hours of light and 8 hours of darkness. Positive regenerated branches can be obtained in 2 weeks, resulting in red bean T0 generation plants. The flowchart of the soybean gene conversion process is as follows: Figures 2-4 As shown, where, Figure 2 This is a flowchart of the preparation process of Agrobacterium suspension. Figure 3 This is a schematic diagram of the bud points of a soybean seedling at the first node stage. Figure 4 This is a flowchart of soybean gene conversion.

[0049] 7. Identification of positive plants The samples were ground using a grinder, and genomic DNA was extracted from the T0 generation of red bean plants using the CTAB method. (1) Take 0.5g of red bean T0 generation plant sample and add 1mL of CTAB extraction solution preheated at 65℃ to a 2mL centrifuge tube. Mix by inverting the tube once every 10min. (2) Centrifuge at 10000 rpm for 10 min, take the supernatant, add 0.8 mL of chloroform and isoamyl alcohol mixture (the volume ratio of chloroform and isoamyl alcohol is 24:1) to the supernatant, and gently invert to mix. (3) Centrifuge at 10,000 rpm for 10 min, take the supernatant into a new tube, add 700 μL of isopropanol pre-cooled at 4℃, mix by inverting, and incubate at -20℃ overnight; (4) Centrifuge at 10,000 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol, centrifuge at 10,000 rpm for 2 min, and discard the supernatant; (5) Add 1 mL of 75% ethanol, centrifuge at 10000 rpm for 2 min, and discard the supernatant; (6) Invert the centrifuge tube on a spread paper towel. After 30 minutes, straighten the centrifuge tube and dry the DNA. (7) Add 50 μL ddH2O to dissolve the DNA and store at -20℃.

[0050] Using genomic DNA as a template, polymerase chain reaction (PCR) was performed using the oligonucleotide primers listed in Table 1 below with P222 DNA polymerase to obtain PCR products. Table 1 Primer Information

[0051] The PCR reaction system consisted of: 10 μL 2×Rapid Taq Master Mix, 0.4 μL primer ipt-F (10 μM), 0.4 μL primer ipt-R (10 μM), 1 μL DNA, and ddH2O added to bring the total volume to 20 μL. The PCR reaction program is as follows: S1, 95℃ pre-denaturation for 3 min; S2, 95℃ denaturation for 15 s; S3, 58℃ annealing for 15 s; S4, 72℃ extension for 1 min; repeat steps S2~S4 35 times; S5, 72℃ complete extension for 5 min. The PCR products were detected by electrophoresis, and the results are as follows: Figure 5 As shown in the figure: WT is the wild-type adzuki bean control plant; T0 is the transformed adzuki bean T0 generation plant; The results showed that the modified vector (the IPT modified vector obtained in Part 4.2) was transformed into soybean germplasm red bean via Agrobacterium GV3101-P19, achieving a transformation efficiency of 56.6%; where transformation efficiency = number of positive plants / total number of plants × 100%. The growth and development of wild-type control plants and red bean T0 generation plants were compared, such as Figure 6 As shown; The results showed that, compared with the wild-type control plants, the branches of the positively transformed red bean T0 generation plants were able to develop normally and bear fruit.

[0052] The above are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A modified carrier, characterized in that, The modified carrier involves the following directional modification: A1. Replace the LUC expression box of the carrier with a modular expression box that integrates epitope tags; A2. Design a multiple cloning site on the vector, introduce restriction enzyme sites HindIII and EcoRI or HindIII and XbaI, and insert a Kozak sequence in the region immediately upstream of the 5' end of the nucleotide sequence of the multiple cloning site.

2. The modified carrier according to claim 1, characterized in that, The modular expression box integrating epitope tags includes a modular expression box integrating FLAG epitope tags or a modular expression box integrating MYC epitope tags. The modular expression box integrating the FLAG epitope tag contains a p35S promoter, a FLAG epitope tag, and a pea rbcsE9 terminator; The modular expression box integrating the MYC epitope tag contains the GmUBI promoter, the MYC epitope tag, and the pea rbcs E9 terminator.

3. The modified carrier according to claim 1, characterized in that, The Kozak sequence is: GCCACCATGG, as shown in SEQ ID NO:

3.

4. A method for constructing a modified carrier, used to construct the modified carrier according to any one of claims 1 to 3, characterized in that, Includes the following steps: The LUC expression cassette of the vector was removed and replaced with a modular expression cassette with an integrated epitope tag. Multiple cloning sites were designed on the vector, and restriction enzyme sites HindIII and EcoRI or HindIII and XbaI were introduced. A Kozak sequence was inserted in the 5'→3' direction in the region immediately upstream of the 5' end of the nucleotide sequence of the multiple cloning site to obtain the modified vector.

5. A recombinant and modified carrier, characterized in that, The recombinant and modified carrier is the modified carrier according to any one of claims 1 to 3 or the modified carrier obtained by the construction method according to claim 4; The vector is obtained by inserting a foreign target gene into the original vector.

6. The recombinant and modified carrier according to claim 5, characterized in that, The exogenous target gene includes the ZmWUS2 gene or the ipt gene.

7. The recombinant and modified carrier according to claim 6, characterized in that, When the exogenous target gene is the ZmWUS2 gene, the expression cassette for expressing the ZmWUS2 gene in the recombinant vector includes the NOS promoter, the ZmWUS2 gene, and a terminator. The sequence of the ZmWUS2 gene is shown as nucleotides 279-1187 in SEQ ID NO:

1.

8. The recombinant and modified carrier according to claim 6, characterized in that, When the exogenous target gene is the ipt gene, the expression cassette expressing the ipt gene in the recombinant vector includes the CaMV 35S promoter, the ipt gene, and a terminator; The sequence of the ipt gene is shown as nucleotides 851-1573 in SEQ ID NO:

2.

9. A modified Agrobacterium, characterized in that, The modified Agrobacterium was obtained by transforming the recombinant modified vector according to any one of claims 5 to 8 into Agrobacterium.

10. An Agrobacterium suspension, characterized in that, It contains the modified Agrobacterium as described in claim 9.

11. A method for preparing an Agrobacterium suspension, used to prepare the Agrobacterium suspension of claim 10, characterized in that, Includes the following steps: The modified Agrobacterium was inoculated into a culture medium and cultured. After centrifugation and resuspension, it was cultured again in a co-culture medium, centrifuged, and the bacterial cells were collected. The bacterial cells were then resuspended using an infection solution to obtain an Agrobacterium suspension.

12. The method for preparing an Agrobacterium suspension according to claim 11, characterized in that, The OD of the Agrobacterium suspension 600 The value is 0.2 to 0.

4.

13. The method for preparing an Agrobacterium suspension according to claim 11, characterized in that, The co-culture medium consists of YEP liquid medium supplemented with 2-morpholine ethanesulfonic acid, acetylsuccinone, and antibiotics.

14. A plant genetic transformation system based on direct delivery, characterized in that, It includes a plant growth medium and an Agrobacterium suspension; the Agrobacterium suspension is the Agrobacterium suspension according to claim 10 or the Agrobacterium suspension prepared by any one of claims 11 to 13; the plant includes soybean.

15. A method for plant genetic transformation based on direct delivery, characterized in that, Includes the following steps: Plant explants were infected with Agrobacterium suspension, cultured, and positive plants were identified to obtain transformed plants; the Agrobacterium suspension was the Agrobacterium suspension according to claim 10 or the Agrobacterium suspension prepared by any one of claims 11 to 13.

16. The use of the modified vector according to any one of claims 1 to 3, the modified Agrobacterium according to claim 9, the Agrobacterium suspension according to claim 10, or the plant genetic transformation system according to claim 14 in any one of the following B1 to B7: B1. Improve the transformation efficiency of plant genomes; B2. Shorten the cycle of plant genetic transformation; B3. Cultivating genetically modified plants; B4. Verification of plant gene function; B5. Plant genome site-specific or multi-site editing; B6. Plant multi-gene co-transformation and trait stacking improvement; B7. Construction of plant molecular markers or reporter groups; The plants mentioned include legumes.

17. The application according to claim 16, wherein the legume includes soybean.

18. The application according to claim 16, characterized in that, When the application is plant genome site-specific or multi-site editing, the gene editing components include one or more of the following: CRISPR / Cas system, base editor, guide editor, transposase-assisted editing system. The CRISPR / Cas system includes Cas9, Cas12a and functional variants, as well as a guide RNA expression cassette that is compatible with the CRISPR / Cas system. The guide RNA expression cassette can be inserted into the modified vector for delivery.

19. The application according to claim 16, characterized in that, When the application is plant multi-gene co-transformation and trait stacking improvement, two or more exogenous target genes are introduced in the same plant transformation event to achieve plant trait stacking improvement; the exogenous target genes can be inserted into the modification vector.

20. The application according to claim 16, characterized in that, When the application is the construction of plant molecular markers or reporter groups, reporter genes, epitope tags, or luminescent marker modules are introduced into plants for plant protein localization, gene expression monitoring, protein interaction verification, tissue-specific expression analysis, and genetic material tracking.

Citation Information

Patent Citations

  • Non-heading Chinese cabbage regeneration method in non-tissue culture mode

    CN115216490A

  • Efficient genetic transformation method for bitter gourds

    CN115216491A

  • Delivery of developmental regulators to plants for the induction of meristematic tissue with genetic alterations

    US20210269813A1