Electrochemiluminescence detection kit based on lanthanide complex and preparation method thereof

Abstract

The invention belongs to the field of tumor marker detection and application, and particularly relates to an electrochemiluminescence detection kit based on a lanthanide complex and a preparation method, the lanthanide complex Tb-dCOP constructed according to a specific molar ratio is used as a core electrochemiluminescence material, the lanthanide complex Tb-dCOP has relatively high conductivity and stability, can generate an extremely strong ECL signal, and can be used for detecting tumor markers. According to the kit, AgNPs (at) ZnONFs are used as a co-reaction reagent and a signal stabilizer and are combined with a DNA chain fixing carrier, an efficient sensing interface is constructed, ultra-sensitive detection of microRNA-21 (miRNA-21) is achieved through a dendritic double-chain hybridization chain reaction (D-HCR), and the detection limit reaches 46.8 amol / L. Compared with the prior art, the kit has the advantages that the sensitivity is high, and the sensitivity is high. The invention effectively overcomes the problems of low sensitivity and poor accuracy in detection of tumor markers such as miRNA-21 and the like in the prior art, and has the advantages of lower detection limit, better stability, wider linear range and the like.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of tumor marker detection, and particularly relates to an electrochemiluminescence detection kit based on lanthanide complexes and a preparation method. BACKGROUND

[0002] MicroRNA (miRNA) is an endogenous, single-stranded, non-coding RNA with 22 nucleotides, which is involved in cell proliferation, differentiation and apoptosis process, and its abnormal expression (up-regulation or down-regulation) is closely related to the occurrence and development of tumors. In addition, miRNA can stably exist in plasma, serum or body fluid, has the characteristics of easy access and long-term preservation, and is an ideal tumor molecular marker. For example, miRNA-21 in the miRNA family has high sensitivity and specificity for early diagnosis of breast cancer. Therefore, sensitive and efficient monitoring of the content change of miRNA-21 in the serum or saliva of patients is a powerful basis for early diagnosis and prognosis evaluation of breast cancer.

[0003] At present, the detection of miRNA mostly adopts Northern blot hybridization method, microarray analysis method and real-time quantitative polymerase chain reaction (RT-PCR) technology, however, these methods generally have problems of high detection cost, insufficient sensitivity and specificity, long time consumption and complicated sample pretreatment, etc., which limit their wide application in clinic. Therefore, developing a new miRNA detection technology with high sensitivity, good specificity, simple and rapid operation has become an urgent need of laboratory research and clinical diagnosis.

[0004] The electrochemiluminescence (ECL) biosensor effectively combines the high sensitivity of ECL technology and the high specificity of biological recognition, can significantly improve the sensitivity and selectivity of related biomolecule detection, and shows broad development prospects in nucleic acid detection, clinical disease diagnosis, drug detection, food safety control, environmental monitoring and other researches. ECL is a phenomenon that luminescent materials produce luminescence after electrochemical oxidation-reduction reaction on the electrode surface. Therefore, the luminescent body is the key to the construction of ECL biosensor, and its performance directly determines the application potential of the sensor. Traditional ECL luminescent bodies have limitations: inorganic complexes such as ruthenium bipyridine have stable luminescence but high cost; organic matters such as luminol have poor water solubility, unstable luminescence and easy signal decay; although nanomaterials such as quantum dots and noble metal nanoclusters have strong anti-blinking ability and long life, they have harsh preparation conditions and may have biological toxicity. In addition, traditional luminescent bodies generally have poor conductivity, resulting in low ECL efficiency. In view of this, designing and synthesizing new ECL luminescent bodies with high conductivity, stability and low toxicity and exploring their ECL performance are still one of the hotspots in the current research of electrochemiluminescence biosensors.

[0005] The existing ECL sensor still faces many technical bottlenecks in practical application: first, the detection performance is difficult to meet the analysis needs of low-abundance biomarkers, and the detection limit of most sensors for miRNA can only reach the pmol L-1 level, the linear range is narrow, and it cannot cover the wide concentration fluctuation range of biomarkers in clinical samples; at the same time, the detection stability for miRNA is poor, the signal drift is obvious during continuous detection, the repeated detection results have large differences, and it is difficult to ensure the reliability of the analysis results. Second, the performance of the core component of the sensor, the electrochemiluminescence material, has short boards, and the traditional materials generally have the problems of poor conductivity and large electrochemical impedance, which leads to low electron transfer efficiency and slow ECL signal response; and the stability is insufficient, and it usually starts to decompose at 300-400℃, which limits the application of the material in high-temperature preparation or complex environment; in addition, most materials have no infrared fluorescence emission characteristics, are easily interfered by biological tissue autofluorescence in biological sample detection, have large photochemical damage, have weak tissue penetration ability, and can only be used for surface sample detection, and the application scene is limited.

[0006] In the excitation and reaction system design of electrochemiluminescence materials, the existing technology also has defects: on the one hand, the material excitation potential is high, and it is easy to react with oxygen in water medium, which leads to the decrease of the chemical stability of the material, and the high excitation potential is easy to cause oxidation damage to biological molecules, destroy the integrity of the sample, and then affect the detection accuracy; on the other hand, the excitation potential adjustment range is narrow, and the controllability is poor, it is difficult to adjust the excitation conditions according to the characteristics of different biological samples, and the adaptability is insufficient. At the same time, the action mode of ECL reagent and electrode and the participation mechanism of the co-reaction accelerator are unreasonable, and in the traditional scheme, the ECL reagent is in contact with the electrode through solution dispersion, rather than being directly fixed, which leads to insufficient reaction of the reagent with the electrode and low electron transfer efficiency; the synergistic effect of the co-reaction accelerator and the test base solution is weak, and it cannot effectively promote the direct ECL reaction of lanthanide elements, and the ECL efficiency is low, and the signal strength is insufficient.

[0007] In addition, the preparation and detection process of the existing ECL sensor is complex, the synthesis steps are complicated, and the reaction conditions are harsh, and the operation difficulty is large; some detection methods rely on external light source assisted excitation, which not only increases the equipment cost and operation complexity, but also easily introduces light interference, further reducing the detection accuracy. The above technical defects together lead to that the existing ECL sensor is difficult to balance high sensitivity, high stability, high accuracy and wide applicability in biomarker detection, and cannot meet the urgent needs of precise analysis technology in the fields of clinical diagnosis, biomedical research and the like, therefore, developing electrochemiluminescence materials with better performance and high-efficiency ECL sensors based on the materials has become a key problem to be solved in the field. SUMMARY

[0008] In view of the above, one of the purposes of the present application is to provide a preparation method of a series of lanthanide complex electrochemiluminescence materials with enhanced conductivity and stability; the second purpose of the present application is to provide a preparation method of a lanthanide complex and dendrimer-based double-stranded hybridization chain reaction (D-HCR) electrochemiluminescence miRNA detection kit; the third purpose of the present application is to provide a lanthanide complex and D-HCR-based miRNA detection kit; and the fourth purpose of the present application is to provide a use method of the lanthanide complex and D-HCR-based miRNA detection kit.

[0009] To achieve the above purposes, the present application provides the following technical solutions. 1. A preparation method of a series of lanthanide complex electrochemiluminescence materials (Tb-dCOP) with enhanced conductivity and stability The lanthanide complex electrochemiluminescence material is prepared by a solvothermal method using tetrathiafulvalene-3,4,5,6-tetra(4-benzoic acid) (H4TTFTB) and isonicotinic acid (INA) as ligands and Tb 3+ as a metal center.

[0010] Preferably, the molar ratio of H4TTFTB and INA is 5:1-1:5.

[0011] Within the molar ratio range, H4TTFTB and INA can obtain lanthanide complex electrochemiluminescence materials with enhanced conductivity and stability in different morphologies and sizes; the lanthanide complex electrochemiluminescence materials with enhanced conductivity and stability in different morphologies and sizes also have different ECL luminescence intensities. When the molar ratio of H4TTFTB and INA is 2:1, the ECL luminescence intensity of the synthesized lanthanide complex electrochemiluminescence material with enhanced conductivity and stability is the strongest.

[0012] Preferably, Tb 3+ exists in the form of a terbium salt, and the terbium salt is one of terbium nitrate [Tb(NO3)3] and terbium chloride (TbCl3).

[0013] 1) A specific preparation method of a lanthanide complex electrochemiluminescence material [Tb-dCOP(2:1)] with the highest conductivity and stability H4TTFTB (0.016 mmol) and INA (0.008 mmol) were dissolved in 1.5 mL DMF and 0.5 mL EtOH, and stirred until a clear solution was formed. Then, 2 mL of Tb(NO3)3 solution (0.006 mmol / L, dissolved in 1:1 EtOH / H2O mixed solvent) was slowly added dropwise. After stirring for 10 min, the mixture was solvothermal reacted at 50°C for 24 h. The product was collected by centrifugation and washed repeatedly with water and ethanol, and finally freeze-dried to obtain a lanthanide complex electrochemiluminescence material with enhanced conductivity and stability (Tb-dCOP (2:1), where 2:1 is the molar ratio of H4TTFTB to INA).

[0014] Preferably, the stirring temperature is room temperature, and the stirring time is 10 min; or the temperature of the hydrothermal reaction is 50°C, and the reaction time is 24 h; or the centrifugation speed is 6000 r / min, the centrifugation time is 5 min, and the centrifugation frequency is 4-5 times.

[0015] 2. A preparation method of a lanthanide complex and D-HCR electrochemiluminescence kit, the kit comprising a working electrode and a detection solution, the method comprising the following steps: (1) Preparing a working electrode 1) Synthesizing AgNPs@ZnONFs composite 0.1363 g of ZnCl2 and 0.3750 g of urea were added to 30 mL of water, and magnetically stirred for 30 min until the solids were completely dissolved. Then, after hydrothermal reaction at 85°C for 24 h, the product was centrifuged, washed with water and anhydrous ethanol, and freeze-dried to obtain ZnONFs. 0.38 g of ZnONFs was dissolved in 5 mL of H2O, and magnetically stirred to obtain a uniform dispersion of ZnONFs. Then, 5 mL of AgNO3 solution (0.93 mol / L) was added dropwise to the dispersion under stirring. After the addition was completed, the dispersion was transferred to a reaction kettle for hydrothermal reaction at 50°C for 1 h. Finally, the obtained AgNPs@ZnONFs was washed with water and anhydrous ethanol for 4-5 times, and then dried in an oven at 80°C for 24 h.

[0016] 2) Modification of electrode preparation The substrate electrode was polished with 0.3 and 0.05 μm α-Al2O3 powder in turn, and then cleaned with ethanol and water by ultrasonic, and dried at room temperature for standby. Then, the Tb-dCOP (2:1) prepared in step 1 was dropped on the surface of the GCE, and dried at room temperature, and then the AgNPs@ZnONFs prepared in step 2 was dropped, and continued to dry at room temperature, and then the hairpin DNA1 (H1) was dropped, and incubated at 4℃ overnight. After the un-fixed H1 was washed away by Tris-HCl, the hexanethiol (HT) was dropped, and incubated at 4℃ for 30 min to block the non-specific adsorption sites. Then, the target miRNA-21 of different concentrations was dropped, and incubated at 37℃ for 1.5 h. Finally, the mixture of H2 and H3 was dropped, and incubated at 37℃ for 2 h to prepare the target electrode.

[0017] After the mixture of H2 and H3 was dropped, the miRNA-21 could open the H1 hairpin to trigger the D-HCR reaction of H2 and H3.

[0018] Preferably, the substrate electrode is a glassy carbon electrode (GCE, Φ = 4 mm).

[0019] Preferably, the Tb-dCOP (2:1) exists in the form of a dispersion solution, the concentration of the solution is 2.0 mg / mL, and the dropping volume is 10 μL. Preferably, the AgNPs@ZnONFs exists in the form of a dispersion solution, the concentration of the solution is 2.0 mg / mL, and the dropping volume is 10 μL. Preferably, the concentration of the hairpin DNA (H1) is 2 μmol / L, and the volume is 10 μL. Preferably, the concentration of the miRNA-21 is 1 fmol / L ~ 10 nmol / L, and the volume is 10 μL. Preferably, the mixture of H2 and H3 is the hairpin DNA2 (H2, both ends are modified with Fc) and the hairpin DNA3 (H3, both ends are modified with Fc) mixed in a volume ratio of 1:1, and the concentrations of H2 and H3 are both 2 μmol / L.

[0020] Preferably, the nucleotide sequence of the miRNA-21 is as shown in SEQ ID NO: 1, the nucleotide sequence of the H1 is as shown in SEQ ID NO: 2, the nucleotide sequence of the H2 is as shown in SEQ ID NO: 3, and the nucleotide sequence of the H2 is as shown in SEQ ID NO: 4.

[0021] 3) Preparation of detection solution The detection solution is a PBS buffer solution containing K2S2O8 Preferably, the concentration of K2S2O8 is 0.2 mol / L, and the concentration of the PBS buffer solution is 0.1 mol / L. 3. The preparation method of the miRNA-21 detection kit using the lanthanide complex and the D-HCR 4. The use method of the miRNA-21 detection kit based on the lanthanide complex and the D-HCR, and the method is as follows: The target electrode is placed in a PBS solution containing K2S2O8, the signal intensity is detected by using an electrochemiluminescence instrument, and the result is calculated according to a linear equation.

[0022] Compared with the prior art, the present application has the following beneficial effects: 1. The ECL sensor of the present application has high sensitivity, low detection limit and wide linear range, the detection range of miRNA-21 is 1 fmol / L-10 nmol / L, the detection limit is 46.8 amol / L, the stability is good, there is no obvious difference in the results of 15 consecutive determinations of miRNA-21, the accuracy is high, the recovery rate of miRNA-21 in serum is 102.33%-109.65%, and the relative standard deviation is 1.07%-2.78%; 2. The electrochemiluminescent material of the present application has good conductivity, small electrochemical impedance semicircle, and the Tb-dCOP (2:1) is less than 1000 Ω, the stability is high, and the initial decomposition starts at 483.3 DEG C; 3. The electrochemiluminescent material of the present application has the characteristics of infrared fluorescence emission, the maximum emission wavelength is 748.44 nm, the background interference is small, the photochemical damage is small, the tissue penetration is strong, and the application range is wider; 4. The electrochemiluminescent material of the present application has a low excitation potential, the excitation potential is-1.9-0 V, can emit signals in water medium in the presence of oxygen, improves the chemical stability in water, effectively reduces the oxidative damage of the excitation potential to biomolecules, and the excitation potential is controllable, which all help to improve the accuracy of detection; 5. The electrochemiluminescent material and the co-reaction accelerator of the present application are directly fixed on the electrode surface by coating, so that the ECL reagent directly interacts with the electrode, the co-reaction accelerator interacts with the test substrate, and the direct ECL of the lanthanide metal element is realized, and the electrochemiluminescence efficiency is enhanced; 6. The synthesis steps of the present application are simple and controllable, the operation is convenient, no external light source is needed, and the present application can be directly used for detecting the content of miRNA-21. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 The preparation flow chart of the series Tb-dCOP in the present application is shown in the figure; Figure 2 The SEM graph of the series Tb-dCOP prepared in Example 1 is shown in the figure; Figure 3Impedance signal comparison chart of series of Tb-dCOP / GCE sensors prepared in Example 2; Figure 4 ECL signal comparison chart of series of Tb-dCOP / GCE sensors prepared in Example 2; Figure 5 Elemental mapping and EDS of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 6 X-ray photoelectron spectroscopy (XPS) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 7 Ultraviolet-visible absorption spectrum (UV-Vis) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 8 Fourier transform infrared spectroscopy (FTIR) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 9 X-ray diffraction (XRD) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 10 Thermogravimetric analysis (TGA) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 11 Fluorescence spectrum (FL) chart of the best light emitting material Tb-dCOP (2:1) in Example 3; Figure 12 ECL spectral analysis detection chart of the best light emitting material Tb-dCOP (2:1) in Example 3, wherein curve a is Tb(NO3)3 / S2O8 2- system, curve b is O2 / S2O8 2- system, curve c is H4TTFTB / S2O8 2- system, curve d is IA / S2O8 2- system, curve e is Tb-dCOP (2:1) / S2O8 2 system; Figure 13 CV and ECL response of (A) bare GCE and (B) Tb-dCOP (2:1) / GCE in (a, a') 0.1 mol / L pH 7.4 PBS and (b, b') 0.1 mol / L pH 7.4 PBS containing 0.2 mol / L S2O8 2- .

[0024] Figure 14 Preparation flow chart of AgNPs@ZnONFs in Example 4 Figure 15 SEM, elemental mapping and EDS mapping of AgNPs@ZnONFs in Example 4 Figure 16 Preparation flow chart of miRNA-21 ECL sensor in Example 4 Figure 17 Characterization chart of preparation process of miRNA-21 ECL sensor in Example 4, wherein curves a-g in the chart are (a) bare GCE, (b) Tb-dCOP(2:1) / GCE, (c) AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE, (d) H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE, (e) HT / H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE, (f) miRNA-21 / HT / H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE and (g) H2-H3 / miRNA-21 / HT / H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE Figure 18 Sensitivity evaluation result chart of miRNA-21 ECL sensor in Example 5; wherein A is a light signal miRNA-21 concentration response chart, and B is a correction curve chart of ECL light signal and miRNA-21 concentration logarithm; Figure 19 Stability evaluation result chart of miRNA-21 ECL sensor in Example 5; Figure 20 Specificity evaluation result chart of miRNA-21 ECL sensor in Example 5; Figure 21 Repeatability evaluation result chart of miRNA-21 ECL sensor in Example 5; DETAILED DESCRIPTION

[0025] The technical solutions in the present application will be further described below in combination with the drawings and examples.

[0026] Synthesis of lanthanide complex electrochemiluminescent material with synergistically enhanced conductivity and stability in Example 1 1. Synthesis of series of lanthanide complex electrochemiluminescent material As Figure 1Tetrathiafulvalene-3,4,5,6-tetrakis(4-benzoic acid) (H4TTFTB) and isonicotinic acid (INA) were mixed in the amounts shown in Table 1, and then stirred in a mixed solvent of 1.5 mL DMF and 0.5 mL EtOH until H4TTFTB and INA were completely dissolved. Then 2 mL of a Tb(NO3)3·6H2O solution (0.006 mmol / L, dissolved in a 1:1 v / v EtOH / H2O mixed solvent) was slowly added dropwise, and stirred at room temperature for 10 min. Subsequently, the above mixed solution was placed in a polytetrafluoroethylene-lined autoclave, and reacted at 50°C for 24 h. After the reaction was completed, the precipitate was obtained by centrifugation at 6000 r / min for 5 min, and a series of lanthanide complex electrochemiluminescence materials Tb-dCOP was prepared.

[0027] Table 1. H4TTFTB and INA amount ratio 2. Morphology detection of series Tb-dCOP The prepared series of Tb-dCOP (Group A-Group G) were observed by scanning electron microscopy (SEM), and the results are shown in Figure 2 As can be seen from the results, the morphology and average size of Tb-TTFTB (1:0, only H4TTFTB as ligand) (Figure A), Tb-dCOP (5:1) (Figure B), Tb-dCOP (2:1) (Figure C), Tb-dCOP (1:1) (Figure D), Tb-dCOP (1:2) (Figure E), Tb-dCOP (1:5) (Figure F) and Tb-INA (0:1, only INA as ligand) (Figure G) are respectively chrysanthemum-like (20±3 μm), spherical (2±0.5 μm), petal-like (5±1 μm), rose-like (60±5 μm), hydrangea-like (23±0.5 μm), osmanthus-like (15±1 μm) and honeycomb-like (7±0.5 μm).

[0028] Example 2. Impedance detection and ECL detection of series Tb-dCOP materials 1. Preparation of series Tb-dCOP modified electrodes 1) Preparation of series Tb-dCOP electrochemiluminescence material dispersion: The series of Tb-dCOP electrochemiluminescence materials (Group A-Group G) prepared in Example 1 were dispersed in water, respectively, and magnetically stirred for 30 min to prepare a 2.0 mg / mL dispersion; 2) The bare glassy carbon electrode (GCE) was polished and cleaned with ethanol and water by ultrasonic, and dried at room temperature. Then, 10 μL of the dispersion prepared in step 1) was dropped on the surface of the polished GCE and dried at room temperature to prepare the ECL sensor Tb-dCOP / GCE. The ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group A is marked as group a, the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group B is marked as group b, the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group C is marked as group c, the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group D is marked as group d, the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group E is marked as group e, the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group F is marked as group f, and the ECL sensor prepared by the lanthanide complex electrochemiluminescent material of group G is marked as group g.

[0029] 2, Impedance detection of the series of Tb-dCOP modified electrodes The impedance of the series of Tb-dCOP ECL sensors (a-g groups) was detected by an electrochemical workstation (CHI660E, Shanghai Chenhua Instrument Co., Ltd., China), and the results are shown in Figure 3 .

[0030] Preferably, the detection base solution is 0.1 mol / L PBS buffer solution containing 5.0 mmol / L [Fe(CN)6] 3- / 4- . As can be seen from the results, the impedance semicircle of group c is the smallest.

[0031] 3, ECL signal detection of the series of Tb-dCOP modified electrodes The signal of the series of Tb-dCOP ECL sensors (a-g groups) was detected by an MPI-E electrochemiluminescence analyzer (Xi'an Ruimei Electronic Science and Technology Co., Ltd., China), and the results are shown in Figure 4 .

[0032] Preferably, the detection base solution is 0.1 mol / L PBS buffer solution containing 0.2 mol / L K2S2O8.

[0033] As can be seen from the results, the ECL signal of group c is the largest.

[0034] Example 3 Performance detection of the lanthanide complex electrochemiluminescent material (group C) The lanthanide complex electrochemiluminescent materials (Group C) were analyzed by EDS elemental distribution, X-ray photoelectron spectroscopy (XPS), ultraviolet-visible absorption spectroscopy (UV-Vis), Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD), thermogravimetric analysis (TGA), fluorescence spectroscopy (FL), and ECL spectroscopy. The results are as follows: Figures 5-12 As shown.

[0035] Depend on Figure 5 It can be seen that Tb-dCOP(2:1) is mainly composed of C, N, O, S, and Tb elements, and each element is uniformly distributed in the mapped image. The mass percentages of C, N, O, S, and Tb are 69.00%, 0.39%, 18.70%, 7.26%, and 4.65%, respectively. Figure 6 It can be seen that Tb-dCOP(2:1) is mainly composed of C, N, O, S, and Tb elements. Specifically, the peaks at 284.28, 400.08, 530.68, and 162.88 eV correspond to the C1s, N1s, O1s, and S2p orbitals in Tb-dCOP(2:1), respectively, while the peaks at 1242.18 and 1276.18 eV correspond to Tb3d orbitals. 5 / 2 and Tb3d 3 / 2 ( Figure 6 A). Furthermore, characteristic peaks such as Tb-O, Tb-OH, and metal-O are visible in the peak fitting spectra of Tb3d and O1s, indicating that the -COOH groups in ligands H4TTFTB and INA coordinate with Tb. Figure 6 B and C). The N1s peak fitting spectrum results show that nitrogen did not participate in coordination (B and C). Figure 6 D). By Figure 7 It is known that H4TTFTB exhibits characteristic absorption peaks at 307 nm and 429 nm, with the 429 nm peak originating from charge transfer within its TTF unit. INA has a characteristic absorption peak at 289 nm. When Tb³⁺ coordinates with INA and H4TTFTB to form Tb-dCOP(2:1), the characteristic peaks at 307 nm and 289 nm both shift to around 305 nm, and a broad, long-wavelength absorption tail appears in the range of approximately 670 nm to 844 nm. This absorption is attributed to TTFTB. +▪ Electronic transitions within ligands correspond to π-electron transitions from the highest double-occupied molecular orbital (HDOMO) to the single-occupied molecular orbital (SOMO). Figure 8 It can be seen that, comparing the FTIR spectra of monomers H4TTFTB and INA, Tb-dCOP (2:1) at 3127 cm⁻¹... -1 An infrared absorption peak is present at 3650-3800 cm⁻¹, indicating the stretching vibration of the TTF portion in H₄TTFTB. -1An infrared absorption peak exists at 1666-1730 cm⁻¹, which is the stretching vibration peak of O-H bonds, and the presence of numerous hydrogen bonds broadens the peak shape. Furthermore, the peak is located at 1666-1730 cm⁻¹. -1 The absence of the characteristic peak of -COOH in Tb-dCOP (2:1) indicates that the -COOH in the H4TTFTB and INA ligands has been completely deprotonated to COO during the reaction. － At the same time, at 1400, 1525 and 1584 cm -1 A new sharp peak was observed at COO. － The presence of symmetric and asymmetric stretching vibration peaks indicates that Tb coordinates with the -COOH groups in H4TTFTB and INA, respectively. Furthermore, compared to H4TTFTB and INA, the stretching vibration peak intensity of COO⁻ in Tb-dCOP(2:1) is significantly enhanced, the peak shape is broadened, and it shifts towards lower wavenumbers. This phenomenon can be attributed to the presence of a hydrogen bond network and π–π conjugation effect in the system, further confirming the formation of hydrogen bonds in Tb-dCOP(2:1). Figure 9 The XRD pattern shows a broad diffraction peak in the range of 2θ from 16.51° to 37.04°, with corresponding d-spacing of 5.36–2.43 Å, indicating that π−π stacking plays a significant role in the formation of Tb-dCOP(2:1). Figure 10 It can be seen that the initial decomposition temperatures of Tb-INA (group A), Tb-H4TTFTB (group G), and Tb-dCOP are 220.4, 376.1, and 483.3 °C, respectively, indicating that the thermal stability of Tb-dCOP is significantly improved under the combined effects of hydrogen bonding network, π–π conjugation effect, and strong M⁽ᴴ⁾−O and M⁽ᴴ⁾−N coordination bonds. Figure 11 It can be seen that Tb 3+ The optimal excitation wavelength for both Tb-dCOP (2:1) and Tb is 276 nm. 3+ There is a strong emission peak at 552nm, corresponding to 5 D 4→ 7 F The 5 transition exhibits weak emission peaks at 488nm, 586nm, and 621nm, respectively. 5 D 4→ 7 F 6, 5 D 4→ 7 F 4, 5 D 4→ 7 F 3. Transition. Tb-dCOP (2:1) fluorescence emission spectrum and Tb3+ Similarly, an enhanced emission peak exists at 552 nm, a weak emission peak at 605 nm, but the emission peaks at 489 nm and 620 nm disappear. This indicates that the luminescent center of Tb-dCOP(2:1) is still Tb. 3+ And mainly at 552nm. 5 D 4→ 7 F The 5-phase transition produces luminescence because the ligands H4TTFTB and INA transfer the absorbed energy to Tb through an "antenna effect". 3+ Increase Tb 3+ The fluorescence emission of Tb-dCOP(2:1) was investigated using ECL spectroscopy. Figure 12 It can be seen that Tb-dCOP(2:1) / S2O8 2- (Curve e) and Tb(NO3)3 / S2O8 2- The optimal ECL emission wavelength of the system (curve a) is consistent, both being 748.44 nm, compared to O2 / S2O8. 2- (599.75nm, curve b), H4TTFTB / S2O8 2- (734.66nm, curve c) and IA / S2O8 2- (728.30 nm, curve d), the optimal emission wavelengths were redshifted by 148.69, 13.78 and 20.14 nm, respectively. This indicates that the emitting element in this work is Tb-dCOP(2:1), and the emission is from the Tb element in Tb-dCOP(2:1), exhibiting red light emission characteristics.

[0036] Luminescence mechanism of lanthanide complex electrochemiluminescent materials (Group C) Tb-dCOP(2:1) / S2O8 was studied using cyclic voltammetry (CV) and ECL. 2- The ECL luminescence mechanism. For example... Figure 13 As shown in Figure A, when bare GCE is placed in a location without S2O8 2− When placed in PBS, the ECL signal (curve a) and redox peak (curve aˊ) are essentially absent. However, when naked GCE is placed in PBS containing 0.1 mol / L S₂O₈, the signal is significantly different. 2− When PBS was used, a weaker ECL signal (1035 a.u., curve b) and a stronger reduction peak (-1.18 V) were observed, which were mainly attributed to S2O8. 2- The cathode is reduced to obtain the strong oxidizing intermediate SO4. •– As shown in Fig. 13B, when Tb-dCOP(2:1) / GCE is placed in a container without S2O8... 2−When in PBS, a weak ECL signal can be observed (33 au, curve a), which is mainly attributed to the reduction reaction of Tb-dCOP(2:1) to generate a negatively charged Tb-dCOP(2:1). •− However, when Tb-dCOP(2:1) / GCE is placed in a solution containing 0.1 mol / L S2O8... 2− When PBS was applied, the ECL signal (13205 au, curve b) was significantly enhanced, and its reduction peak (-1.69 V) shifted by -0.51 V relative to the bare GCE, mainly due to SO42-. •– and β-Tb-COP(2:1) •− The reaction produces an excited state Tb-dCOP(2:1). * When Tb-dCOP(2:1) * A strong ECL signal is generated when the excited state returns to the ground state.

[0037] Its light-emitting principle is shown in Equation 1-4.

[0038] S2O8 2− + e SO4 •− + SO4 2− (1) Tb-dCOP (2:1)+ e → Tb-dCOP(2:1) •− (2) Tb-dCOP(2:1) •− + SO4 •− → Tb-dCOP(2:1) * + SO4 2− (3) Tb-dCOP(2:1) * → Tb-dCOP(2:1) + hν (4) Example 4: A method for preparing an electrochemiluminescence reagent kit for lanthanide complexes and D-HCR, the kit comprising a working electrode and a detection solution, comprising the following steps: 1. Synthesis of AgNPs@ZnONFs complex 0.1363 g ZnCl2 and 0.3750 g urea were added to 30 mL of water and magnetically stirred for 30 min until the solids were completely dissolved. The mixture was then hydrothermally reacted at 85 °C for 24 h, followed by centrifugation, washing with water and anhydrous ethanol, and freeze-drying to obtain ZnONFs. 0.38 g ZnONFs were dissolved in 5 mL H2O and magnetically stirred to obtain a uniform dispersion. Then, under stirring, 5 mL of AgNO3 solution (0.93 mol / L) was added dropwise to the dispersion. After the addition was complete, the dispersion was transferred to a reaction vessel and hydrothermally reacted at 50 °C for 1 h. Finally, the obtained AgNPs@ZnONFs were washed 4-5 times with water and anhydrous ethanol and dried in an oven at 80 °C for 24 h. The preparation flow chart of AgNPs@ZnONFs is shown below. Figure 14 .

[0039] 2. Specific steps for preparing the working electrode The substrate electrode (GCE) was meticulously polished sequentially with 0.3 μm and 0.05 μm α-Al₂O₃ powders, ultrasonically cleaned with ethanol and water, and then air-dried at room temperature. Next, 10 μL of Tb-dCOP (2:1) (2 mg / mL) was drop-coated onto the GCE surface, and after air-drying at room temperature, 10 μL of AgNPs@ZnONFs (2 mg / mL) was immediately drop-coated, followed by further air-drying at room temperature. Immediately afterward, 10 μL of hairpin DNA (H1, 2 μmol / L) was drop-coated onto the electrode surface, capped, and incubated overnight at 4°C. Then, 10 μL of HT (1 mmol / L) was drop-coated and incubated at 4°C for 30 min to block non-specific adsorption sites. Subsequently, different concentrations of the target miRNA-21 were drop-coated, capped, and incubated at 37°C for 1.5 h. Finally, a mixture of 10 μL of H2 (both ends modified with Fc) and H3 (both ends modified with Fc, in a 1:1 volume ratio) was drop-coated onto the surface of the above electrode and incubated at 37 °C for 2 h to obtain the working electrode. The working electrode preparation flowchart is shown below. Figure 15 .

[0040] Preferably, the concentration of miRNA-21 is 1 fmol / L to 10 nmol / L, and the volume is 10 μL.

[0041] 3. Preparation of test solution The detection solution was a 0.1 mol / L PBS buffer solution containing 0.2 mol / L K2S2O8.

[0042] The specific testing methods are as follows: The target electrode is placed in the detection solution, and the signal intensity is detected using an electrochemiluminescence instrument. The result is calculated based on a linear equation.

[0043] The nucleotide sequences of miRNA-21, H1, H2, and H3 prepared according to the above method for the miRNA-21 detection kit are shown below: SEQ ID NO: 1 shows the nucleotide sequence of the mature miRNA-21: TAGCTTATCAGACTGATGTTGA This sequence is represented in DNA form in the sequence listing, and its corresponding naturally occurring RNA sequence is: UAGCUUAUCAGACUGAUGUUGA SEQ ID NO: 2 shows the nucleotide core sequence of the H1 probe: AAGTTCAACATCAGTCTGATAAGCTAGATCCTCCTGTGTGCCTCGCGATCCTCCTGTGTGCCTGCCAGACTGATGTTG SEQ ID NO: 3 shows the nucleotide core sequence of the H2 probe: TTTATAGGCACACAGGAGGAGACGACCTCCTGTATTCCTCCTGTACGTTT SEQ ID NO: 4 shows the nucleotide core sequence of the H3 probe: TTTGATGCCTCCTGTGTGCCTATACAGGAGGAATACAGGAGGTCGTTT Example 5: Sensitivity assessment of the miRNA-21ECL detection kit 1. Morphology, elemental distribution, and EDS characterization of AgNPs@ZnONFs like Figure 16 As shown, ZnONFs are flower-like, with AgNPs uniformly distributed on the surface of ZnONFs, and an average diameter of 150±50 nm. AgNPs@ZnONFs are mainly composed of Ag, Zn and O elements, with mass percentages of 13.1%, 54.3% and 32.6%, respectively.

[0044] 2. Characterization of the working electrode fabrication process The fabrication process of the working electrode was characterized using electrochemical cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Figure 17 As shown, in a solution containing 5.0 mmol·L −1 [Fe(CN)6] 3- / 4- In 0.1 mol / L PBS buffer solution, a high redox peak and a low surface electron transport resistance (Rc) can be observed on the naked GCE (curve a). etThe peak current value of the sensor continued to decrease after the GCE surface was modified with Tb-dCOP(2:1) (curve b), AgNPs@ZnONFs (curve c), H1 (curve d), HT (curve e), and miRNA-21 (curve f), respectively. et The value continues to increase. After modifying H2-H3 (curve g), the sensor peak current value increases slightly, R et The value continues to increase.

[0045] 2. Sensitivity assessment of the miRNA-21 detection kit A classic three-electrode system was used, consisting of a working electrode, an Ag / AgCl reference electrode, and a platinum wire electrode. The excitation potential ranged from -1.9 to 0 V. The detection buffer was 0.1 mol / L PBS (pH=7.4) containing 0.2 mol / L K₂S₂O₈. Working electrodes with different miRNA-21 concentrations (EP concentrations ranging from 1 fmol / L to 10 nmol / L) were immersed in 4 mL of the detection buffer. The ECL signal was measured using an MPI-E electrochemiluminescence analyzer (Xi'an Ruimai Electronic Science and Technology Co., Ltd., China). The results are as follows: Figure 18 As shown. Sensor ECL signal strength difference (Δ) I = I 0– I , I 0 and I (Representing the sensor ECL intensity at blank and different miRNA-21 concentrations, respectively) gradually increases with increasing target miRNA-21 concentration, and shows a good linear relationship with the logarithm of miRNA-21 concentration. The linear equation is Δ... I =970.0lg c +16228.2( R 2 =0.9986) (where c This refers to the concentration of miRNA-21. R The correlation coefficient is given, and the limit of detection (LOD) is 46.8 amol / L.

[0046] 2. Stability assessment of the miRNA-21 detection kit The prepared H2-H3 / miRNA-21 / HT / H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE working electrode (the concentration of miRNA-21 used in the electrode preparation process was 10) was used. -9 The sample (0.2 mol / L K₂S₂O₈ in 0.1 mol / L PBS (pH=7.4)) was placed in the detection base solution and scanned continuously for 15 cycles. The results are as follows: Figure 19As shown, the relative standard deviation (RSD) of the detection results is 1.6%, indicating that the obtained ECL signal has high stability.

[0047] 3. Specificity evaluation of the miRNA-21 detection kit In the preparation of the H2-H3 / miRNA-21 / HT / H1 / AgNPs@ZnONFs / Tb-dCOP(2:1) / GCE working electrode, the target miRNA-21 was replaced with interfering miRNA-141, miRNA-221, and miRNA-222 (all at a concentration of 1 μmol / L), respectively. The working electrode was then placed in the detection buffer for ECL detection. The results are as follows: Figure 20 As shown, the ECL signal of the interfering substance is similar to that of the blank signal. When the target miRNA-21 (1 nmol / L) is present, the ECL signal of the sensor is significantly reduced, indicating that the ECL sensor has high selectivity for miRNA-21.

[0048] 3. Reproducibility assessment of the miRNA-21 detection kit Under the same conditions, the same batch of sensors were fabricated using the same concentration of miRNA-21 (10 pmol / L), and then their ECL signals were detected. The results are as follows: Figure 21 As shown, the RSD of the detection results is 2.1%, indicating that the sensor has relatively good repeatability.

[0049] Detection of actual serum samples in the test case Serum samples from healthy individuals at Chongqing Ninth People's Hospital were selected for analysis. First, the serum was diluted 50-fold, then different concentrations of miRNA-21 were added to the serum, and the total miRNA-21 content was measured. The results are shown in Table 2.

[0050] Table 2. Analysis of actual samples As shown in Table 1, the recoveries of miRNA-21 ranged from 102.33% to 109.65%, with RSDs ranging from 1.07% to 2.78%. This indicates that the proposed biosensor can be used for the detection of actual samples and has certain application potential in clinical analysis.

[0051] It should be noted that, in this document, relational terms such as "first" and "second" are used only to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0052] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A method for preparing an electrochemiluminescence detection kit based on lanthanide complexes, characterized in that, Using tetrathiofulvalene-3,4,5,6-tetra(4-benzoic acid) (H4TTFTB) and isonicotinic acid (INA) as ligands, with Tb 3+ It is prepared by a solvothermal method with a metallic center.

2. The preparation method of the electrochemiluminescence detection kit based on lanthanide complexes as described in claim 1, characterized in that: The molar ratio of H4TTFTB to INA is 5:1 to 1:

5.

3. The preparation method of the electrochemiluminescence detection kit based on lanthanide complexes as described in claim 1, characterized in that: Tb 3+ It exists in the form of a terbium salt, wherein the terbium salt is one of terbium nitrate or terbium chloride.

4. The preparation method of the electrochemiluminescence detection kit based on lanthanide complexes as described in claim 1, characterized in that: The luminescent material has a petal-like morphology, an average size of 5±1μm, and a thermal decomposition temperature of 483.3℃.

5. The preparation method of the electrochemiluminescence detection kit based on lanthanide complexes as described in claim 1, characterized in that: H4TTFTB and INA were dissolved in DMF / EtOH, and then Tb(NO3)3 solution (solvent EtOH / H2O) was slowly added dropwise to carry out a hydrothermal reaction. The precipitate was collected by centrifugation to obtain lanthanide complex electrochemiluminescent materials. The stirring temperature was room temperature, and the stirring time was 10 minutes. Alternatively, the hydrothermal reaction temperature may be 50°C and the reaction time may be 24 hours. Alternatively, the centrifugation speed can be 6000 r / min, the time can be 5 min, and the number of cycles can be 4-5.

6. A method for preparing a working electrode of an electrochemiluminescent material and AgNPs@ZnONFs composite material as described in any one of claims 1-4, characterized in that: The electroluminescent material exists in the form of a dispersion, and the concentration of the solution is 2.0 mg / mL; The substrate electrode is a glassy carbon electrode; It also includes a PBS buffer solution containing K2S2O8; The nucleotide sequence of miRNA-21 is shown in SEQ ID NO: 1; the nucleotide sequence of H1 is shown in SEQ ID NO: 2; the nucleotide sequence of H2 is shown in SEQ ID NO: 3; and the nucleotide sequence of H3 is shown in SEQ ID NO:

4.

7. The preparation method of the electrochemiluminescence detection kit based on lanthanide complexes as described in claim 1, characterized in that: The working electrode is placed in the test solution, and the ECL signal is detected using an MPI-E electrochemiluminescence analyzer.

8. The application of the electrochemiluminescent material and AgNPs@ZnONFs composite material according to any one of claims 1-4, the kit according to claim 6, and the electrochemiluminescent sensor according to claim 7 in the detection of miRNA-21.

9. A method for detecting miRNA-21 levels using an electrochemiluminescent material according to any one of claims 1-4 and an AgNPs@ZnONFs composite material, a kit according to claim 6, and an electrochemiluminescent sensor according to claim 7, characterized in that: The working electrode was placed in a PBS solution containing K2S2O8, and the signal intensity was detected using an electrochemiluminescence sensor. The result was calculated based on a linear equation. The concentration of K2S2O8 is 0.2 mol / L; the concentration of the PBS solution is 0.1 mol / L.

Images