InDel molecular marker linked with cucumber corynespora leaf spot disease, PCR (Polymerase Chain Reaction) detection primer, kit and application

By developing InDel molecular markers and PCR detection primers for the 19 Mb ~ 24 Mb region of cucumber chromosome 5, the problem of unclear inheritance of resistance to cucumber Corynebacterium leaf spot was solved, enabling rapid identification of cucumber disease-resistant genotypes and assisting in breeding, thus improving breeding efficiency.

CN121759635APending Publication Date: 2026-03-31TIANJIN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610097029.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-23
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

The genetic characteristics and resistance mechanisms of cucumber caudatops leaf spot are not clear in the existing technology, and the number of disease resistance genes and linked molecular markers is insufficient, making it difficult to meet the needs of cucumber disease resistance breeding.

Method used

An InDel molecular marker closely linked to resistance to cucumber clostridial leaf spot disease was developed, located in the approximately 1.4 Mb region of chromosome 5 (19 Mb ~ 24 Mb). Corresponding PCR primers and detection kits were designed for rapid detection of cucumber resistance genotypes.

Benefits of technology

It enables accurate screening of cucumber genotypes resistant to Corynebacterium leaf spot, and can quickly and easily identify whether cucumbers contain disease-resistant genes, thus assisting in cucumber breeding to obtain high-yielding and high-quality disease-resistant new varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759635A_ABST
    Figure CN121759635A_ABST
Patent Text Reader

Abstract

The invention discloses an InDel molecular marker linked with cucumber corynespora leaf spot, a PCR (Polymerase Chain Reaction) detection primer, a kit and application. According to the invention, a resistant cucumber material and a high-susceptibility material are utilized to construct an F2 group, and BSA-Seq, a molecular marker and other methods are utilized to preliminarily locate a cucumber corynespora leaf spot resistant gene in an interval of about 5.0 Mb in 19 Mb-24 Mb on Chr5; the InDel molecular marker closely linked with the resistance to the corynespora leaf spot disease is developed, and the InDel molecular marker is applied to molecular marker detection and seedling-stage disease resistance identification on 143 cucumber test varieties, so that the high correlation between the molecular marker and the resistance to the cucumber corynespora leaf spot disease is verified; whether cucumbers contain the anti-corynespora leaf spot gene or not can be simply and rapidly detected, then the cucumber anti-corynespora leaf spot disease resistance is detected or detected in an auxiliary mode, and the molecular marker has an application prospect in cucumber anti-corynespora leaf spot molecular marker auxiliary breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to InDel molecular markers linked to vegetable diseases, and more particularly to InDel molecular markers closely linked to resistance to cucumber caudatops leaf spot, PCR detection primers, detection kits, and their applications in cucumber germplasm resource selection and molecular marker-assisted breeding, belonging to the field of molecular detection or molecular marker-assisted breeding of cucumber caudatops leaf spot. Background Technology

[0002] cucumber( Cucumis Sativus Cucumber (L.) is China's largest greenhouse vegetable producer, playing a crucial role in stabilizing and balancing the domestic vegetable market supply. Cucumber leaf spot, also known as 'target spot,' 'brown spot,' or 'yellow spot,' is a globally distributed fungal disease caused by the fungus *Corynespora cassiicola* (Berk. and Curt.) Wei, a member of the Deuteromycetes. This disease primarily affects cucumber leaves, developing rapidly (within 2-3 days under suitable conditions), exhibiting diverse symptoms that are difficult to identify in the early stages. Chemical control is challenging and costly, particularly prevalent in northern regions during spring, autumn, and overwintering protected cultivation, while in southern regions it is more common in spring and autumn open fields. The disease incidence rate in typical affected fields is 10-15%, but in severe cases, yield losses can reach 60-70%, or even total crop failure, seriously jeopardizing the healthy development of the cucumber industry.

[0003] The most effective method for addressing cucumber Corydalis leaf spot disease is to discover resistance genes and use marker-assisted breeding to combine these genes with other desirable traits, thereby obtaining high-yielding, high-quality cucumber varieties resistant to the disease. However, due to the complex pathogenesis and severe physiological race differentiation of cucumber Corydalis leaf spot disease, its genetic characteristics and resistance mechanisms remain unclear. The number of currently available resistance genes and linked molecular markers is insufficient to meet the needs of cucumber disease resistance breeding. Summary of the Invention

[0004] One of the objectives of this invention is to provide an InDel molecular marker that is closely linked to resistance to Cucumber Corynebacterium leaf spot disease.

[0005] A second objective of this invention is to provide PCR detection primers for detecting the InDel molecular marker, which is closely linked to resistance to Cucumber Corynebacterium leaf spot, and a PCR detection kit containing the PCR detection primers.

[0006] The third objective of this invention is to apply the InDel molecular marker, PCR detection primers, and PCR detection kit containing the PCR detection primers to detect the genotype of the InDel molecular marker closely linked to resistance to cucumber caudatops leaf spot, and to detect or assist in the detection of cucumber resistance to caudatops leaf spot.

[0007] To achieve the above objectives, the main technical solutions adopted by the present invention include: One aspect of the present invention is to provide an InDel molecular marker closely linked to resistance to Cucumber leaf spot disease, located in a region of approximately 1.4 Mb between 19 Mb and 24 Mb on chromosome 5, and whose nucleotide sequence is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0008] Another aspect of the present invention provides PCR detection primers for detecting InDel molecular markers closely linked to resistance to Cucumber Corynebacterium leaf spot disease, wherein the PCR detection primers consist of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.

[0009] Another aspect of the present invention provides a PCR detection kit for detecting InDel molecular markers closely linked to resistance to Cucumber Corynebacterium leaf spot disease. The PCR detection kit comprises: DNA polymerase, PCR amplification buffer, dNTPs, PCR primer pairs, and double-distilled water; wherein the PCR primer pairs consist of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4.

[0010] Another aspect of the present invention is to apply the InDel molecular marker, PCR detection primers, or PCR detection kit that are closely linked to resistance to Cucumber Corynebacterium leaf spot disease to detect the genotype of the InDel molecular marker that is closely linked to resistance to Cucumber Corynebacterium leaf spot disease, including: (1) Extract DNA from the cucumber sample to be tested; (2) Using the DNA extracted from the cucumber sample to be tested as the amplification template, a PCR amplification system was established using the upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and the downstream primer with the nucleotide sequence shown in SEQ ID No. 4 as PCR amplification primers, and PCR amplification was performed; (3) If the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.1, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AA; if the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.2, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is BB; if the amplification product has two bands and the nucleotide sequences of the two bands are as shown in SEQ ID No.1 or SEQ ID No.2 respectively, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AB.

[0011] In a preferred embodiment of the present invention, if the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AA, then the cucumber to be tested does not contain the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous susceptible, and has low resistance to Cucumber Coccidioides leaf spot, exhibiting susceptibility; if the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is BB, then the cucumber to be tested contains the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous resistant, and has high resistance to Cucumber Coccidioides leaf spot, exhibiting high resistance or resistance to Cucumber Coccidioides leaf spot; if the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AB, then it contains a heterozygous sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, and has a high probability of exhibiting susceptibility to Cucumber Coccidioides leaf spot.

[0012] In a preferred embodiment of the present invention, the PCR amplification system comprises: 20 ng cucumber genomic DNA, 25 ng upstream primer, 25 ng downstream primer, 0.20 mM dNTPs, and Mg... 2+ 1.5 mM, 1x PCR buffer, 1.0 unit of Taq DNA polymerase, and sterile double-distilled water to a final volume of 20 μL; The preferred PCR amplification program is: 95℃ pre-denaturation for 300 seconds; 95℃ denaturation for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 60 seconds, for 35 cycles; and a final extension at 72℃ for 350 seconds.

[0013] The reagents used for cucumber genomic DNA extraction in this invention include, but are not limited to, common DNA extraction methods in the prior art such as CTAB method, phenol-chloroform extraction method, silica gel membrane column method, and magnetic bead method; the reagents used for PCR product analysis include, but are not limited to, gel electrophoresis, fluorescent probe capture or sequencing methods.

[0014] It should be noted that the detection method in this application utilizes the aforementioned functional molecular markers. If necessary, susceptible varieties such as the cucumber variety *Chinese long* can be used as controls. PCR amplification is performed using the genomic DNA of the cucumber to be tested as a template. If smaller electrophoretic bands are clearly visible in the gel electrophoresis, it indicates that the cucumber to be tested contains the *C. sarcodactylis* resistance gene; otherwise, it proves that the cucumber to be tested does not contain the *C. sarcodactylis* resistance gene. If necessary, Sanger sequencing can be performed to confirm the exact length of the electrophoretic bands and the specific sequence of the product.

[0015] This invention utilizes the horizontally resistant cucumber material 'LX-11-1' and the highly susceptible material 'P62-1-1' to construct an F2 population. Using BSA-Seq and molecular marker methods, the cucumber resistance gene against *Corynebacterium tumefaciens* leaf spot was preliminarily located within approximately 5.0 Mb of the 19 Mb-24 Mb range on Chr5. A set of InDel molecular markers closely linked to resistance to *Corynebacterium tumefaciens* leaf spot was developed. PCR primers designed using these InDel molecular markers were applied to 143 cucumber test varieties for molecular marker detection and seedling resistance identification. The results verified a high correlation between the molecular markers and resistance to *Corynebacterium tumefaciens* leaf spot in cucumbers. This invention provides a simple and rapid method for detecting whether cucumbers contain this resistance gene, thereby detecting or assisting in the detection of *Corynebacterium tumefaciens* resistance in cucumbers. It shows promise for molecular marker-assisted breeding of cucumbers resistant to *Corynebacterium tumefaciens* leaf spot. Attached Figure Description

[0016] Figure 1 The resistance phenotypes (a) and F2 population resistance phenotypes (b) of cucumber parents resistant to Corynebacterium leaf spot at different inoculation times are presented.

[0017] Figure 2 A schematic diagram of QTL mapping for cucumber resistance to Corynebacterium leaf spot.

[0018] Figure 3 A diagram of sequence variation for indel label amplification (a) and a schematic diagram of molecular label electrophoresis detection (b).

[0019] Figure 4 Statistical analysis of genotype and phenotype results in 143 high-generation cucumber inbred lines. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0021] Experimental Example 1: Identification of resistance to Corynebacterium leaf spot in cucumber seedlings An F2 population was constructed by planting the highly resistant cucumber variety 'LX-11-1' and the highly sensitive variety 'P62-1-1' in an artificial climate chamber. Figure 1 a) Artificial climate chamber conditions: 16-hour photoperiod, 22℃ during the day, 20℃ at night, and 80-90% humidity. Leaf spray inoculation was used. During the first and second true leaf stages, a handheld sprayer was used to evenly spray a conidial suspension with a concentration of 5×10⁴ spores / mL onto the leaf surface, ensuring the droplets cover the entire leaf surface without running off. The inoculation temperature was approximately 25-28℃. After inoculation, the RH was 100%, and the plant was kept moist at 26℃ in the dark for approximately 24 hours, followed by appropriate nighttime moistening to induce disease. 3-10 days after inoculation, once the infected materials had fully developed disease, the disease incidence was investigated and statistically analyzed. The disease severity was graded according to a 6-level grading standard, and the disease index was calculated. Seedling resistance was assessed on the parents and 693 F2 populations. The results are shown below. Figure 1 b. The identification results showed that there were more susceptible materials than resistant materials, suggesting that the resistance gene was recessive. However, since the ratio of resistant to susceptible materials did not meet the 3:1 rule, it is speculated that other QTLs were involved in regulating resistance to Corynebacterium leaf spot.

[0022] Experimental Example 2: Genetic mapping of the cucumber resistance gene cca5.1 to Corynebacterium leaf spot Through inoculation and identification, 50 highly resistant and 50 highly susceptible individual plants were selected from the F2 population to construct a mixed pool of resistant / susceptible plants. These plants, along with their parents, underwent high-depth (approximately 50X) genome resequencing. BSA-Seq bioinformatics analysis preliminarily located the cucumber resistance gene against Corynebacterium leaf spot in approximately 5.0 Mb of chromosome 5 (19 Mb ~ 24 Mb), and this site was tentatively named cca5.1. Figure 2 ).

[0023] Experimental Example 3: Development of Sequence Functional Molecular Markers Linked to Resistance to Corynebacterium Leaf Spot Based on genotypic data from two parents and R-pool and S-pool in previous BSA studies, sequence variation information was extracted from the target region to screen for high-quality InDel molecular markers. Using software such as Primer3, 20 InDel markers were developed in the localization region and tested on F2 individuals. InDel-3, InDel-4, and InDel-5 markers co-segregated with disease resistance expression, further narrowing the cca5.1 gene region to 1.4 Mb. The InDel-5 marker region contained a 5 bp sequence insertion / deletion (…). Figure 3 a). Combining the polypropylene gel electrophoresis results with candidate region gene information, INDEL-5 was selected as the molecular marker closely linked to the anti-Cronobacter erythropoiesis gene. Figure 3 b).

[0024] The nucleotide sequence with a length of 192 bp is shown in SEQ ID No. 1: GGTCACGGAACTTTATCTCATGACTTTAAATTTTCGACAGTATTGTCAAGCCACTGAGAATTTATTGTGATAATTTTGTAGCTGTTTTCTTCTAAAAAAACAACAAGTATTCTAAAGGTGTTAAATACATGGAATTAAAATACTTTGTTGTTAAAGAAGAAGTTCATAAACAAAGGGTATCAATCGAACACA (SEQ ID No. 1).

[0025] The nucleotide sequence with a length of 197 bp is shown in SEQ ID No. 2: GGTCACGGAACTTTATCTCATGACTTTAAATTTTCGACAGTATTGTCAAGCCACTGAG AATTT AATTTATTGTGATAATTTTGTAGCTGTTTTCTTCTAAAAAAACAACAAGTATTCTAAAGGTGTTAAATACATGGAATTAAAATACTTTGTTGTTAAAGAAGAAGTTCATAAACAAAGGGTATCAATCGAACACA (SEQ ID No. 2).

[0026] The nucleotide sequence described in SEQ ID No. 2 has a 5 bp (AATTT) nucleotide fragment inserted between positions 58 and 59 as shown in SEQ ID No. 1.

[0027] Experiment Example 4: Detection of cucumber genotypes by using the InDel molecular marker INDEL-5 PCR detection primers were designed using the InDel molecular marker INDEL-5 identified in Experiment 3: Upstream primer: GGTCACGGAACTTTATCTCA (SEQ ID No. 3).

[0028] Downstream primer: TGTGTTCGATTGATACCCTT (SEQ ID No. 4).

[0029] The designed PCR primers were used to identify the genotypes of 143 high-generation cucumber inbred lines. DNA was extracted from these 143 high-generation cucumber inbred lines using the CTAB method, and the steps are as follows: (1) Put an appropriate amount of leaves into a 2mL round-bottom centrifuge tube, add steel balls, place it in liquid nitrogen for quick freezing, and grind the leaves into powder using a grinder. (2) Add 600 μL of CTAB extract, heat in a water bath at 65°C for 1 hour, and mix by inverting twice during the process; (3) Remove the centrifuge tube, cool it to room temperature, add 600 μL of chloroform:isoamyl alcohol (24:1) mixture, shake well, let stand for 15 minutes, and centrifuge at 12000 rpm for 15 minutes. (4) Take 600 μL of supernatant, add 600 μL of pre-cooled isopropanol, mix gently, and let stand at 4°C for 5 minutes. Centrifuge at 12000 rpm for 15 minutes; (5) Discard the supernatant, add 600 μL of 70% ethanol to wash, and centrifuge at 12000 rpm for 10 minutes; (6) Discard the supernatant, air dry, add 200 μL ddH2O to dissolve, and obtain cucumber leaf genomic DNA.

[0030] Using the extracted DNA from high-generation cucumber inbred lines as a template, a PCR amplification system was established using the upstream and downstream primers described in SEQ ID No. 3 and SEQ ID No. 4 as PCR amplification primers. The system consisted of 20 μL of the following: 20 ng of cucumber genomic DNA, 25 ng of the upstream primer shown in SEQ ID No. 3, 25 ng of the downstream primer shown in SEQ ID No. 4, 0.20 mM dNTPs, and Mg... 2+ 1.5 mM, 1x PCR buffer, 1.0 unit of Taq DNA polymerase, and sterile double-distilled water were added to a final volume of 20 μL. The PCR amplification tube was placed in a PCR instrument for amplification. The PCR amplification program was as follows: 95℃ pre-denaturation for 300 seconds; 95℃ denaturation for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 60 seconds, for 35 cycles; and a final extension at 72℃ for 350 seconds. The amplified products were stored at 4℃ before electrophoresis.

[0031] In the electrophoresis diagram, if only a 192 bp band is observed, the genotype is determined to be AA; if only a 197 bp band is observed, the genotype is determined to be BB; if both 192 bp and 197 bp bands are observed, the genotype is determined to be AB. Specifically, genotype AA indicates homozygous susceptibility, BB indicates homozygous resistance, and AB indicates heterozygous genotype. The correspondence between genotype and phenotype is shown in [reference needed]. Figure 4 See Table 1.

[0032] Table 1. Results of marker detection and disease susceptibility phenotype survey of 143 cucumber inbred lines.

[0033] The results showed that all materials with the BB genotype were highly resistant or resistant to Corynebacterium leaf spot, while most materials with the AA and AB genotypes were susceptible to the disease.

[0034] Since the cca5.1 resistance gene is recessive, 19 samples were identified as having the BB genotype, with a susceptibility level of 0 to 1, indicating either high resistance or resistance to Cucumber Corynebacterium leaf spot. The marker concordance rate was 100% (susceptibility level 0-1, high resistance and resistance). 124 samples were identified as having the AA or AB genotype, of which 108 (87.1%) were susceptible (susceptibility level ≥ 3). These results demonstrate that the InDel molecular marker INDEL-5 can accurately screen for highly resistant Cucumber Corynebacterium leaf spot resources.

Claims

1. Application of reagents for detecting InDel molecular markers closely linked to resistance to *Corynebacterium cucumeris* leaf spot in the detection of genotypes of InDel molecular markers closely linked to resistance to *Corynebacterium cucumeris* leaf spot, or in the determination of resistance levels to *Corynebacterium cucumeris* leaf spot. The InDel molecular marker is located in a region of approximately 1.4 Mb between 19 Mb and 24 Mb on chromosome 5, and its nucleotide sequence is shown in SEQ ID No. 1 or SEQ ID No.

2.

2. The application according to claim 1, characterized in that, include: (1) Extract DNA from the cucumber sample to be tested; (2) Using the DNA extracted from the cucumber sample to be tested as the amplification template, a PCR amplification system was established using the upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and the downstream primer with the nucleotide sequence shown in SEQ ID No. 4 as PCR amplification primers, and PCR amplification was performed; (3) If the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.1, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AA; if the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.2, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is BB; if the amplification product has two bands and the nucleotide sequences of the two bands are as shown in SEQ ID No.1 or SEQ ID No.2 respectively, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AB.

3. The application according to claim 2, characterized in that, If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AA, then the cucumber does not contain the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous susceptible, and has low resistance to Cucumber Coccidioides leaf spot, exhibiting susceptibility. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is BB, then the cucumber contains the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous resistant, and has high resistance to Cucumber Coccidioides leaf spot, exhibiting highly resistant or resistant to Cucumber Coccidioides leaf spot. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AB, then the cucumber contains a heterozygous sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, and has a high probability of exhibiting susceptibility to Cucumber Coccidioides leaf spot.

4. The application according to claim 2, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 300 seconds; 95℃ denaturation for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 60 seconds, 35 cycles; and a final extension at 72℃ for 350 seconds.

5. The application of PCR primer pairs in detecting the genotype of InDel molecular markers closely linked to resistance to Cucumber Corynebacterium leaf spot or in determining the level of resistance to Cucumber Corynebacterium leaf spot, characterized in that, include: (1) Extract DNA from the cucumber sample to be tested; (2) Using the extracted DNA from the cucumber sample to be tested as the amplification template, a PCR amplification system was established using the PCR primer pair as the PCR amplification primers and PCR amplification was performed; the PCR primer pair consisted of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4; (3) If the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.1, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AA; if the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.2, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is BB; if the amplification product has two bands and the nucleotide sequences of the two bands are as shown in SEQ ID No.1 or SEQ ID No.2 respectively, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AB.

6. The application according to claim 5, characterized in that, If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AA, then the cucumber does not contain the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous susceptible, and has low resistance to Cucumber Coccidioides leaf spot, exhibiting susceptibility. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is BB, then the cucumber contains the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous resistant, and has high resistance to Cucumber Coccidioides leaf spot, exhibiting highly resistant or resistant to Cucumber Coccidioides leaf spot. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AB, then the cucumber contains a heterozygous sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, and has a high probability of exhibiting susceptibility to Cucumber Coccidioides leaf spot.

7. The application according to claim 5, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 300 seconds; 95℃ denaturation for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 60 seconds, 35 cycles; and a final extension at 72℃ for 350 seconds.

8. The application of a PCR detection kit in detecting the genotype of InDel molecular markers closely linked to resistance to Cucumber Corynebacterium leaf spot or in determining the level of resistance to Cucumber Corynebacterium leaf spot, characterized in that, include: (1) Extract DNA from the cucumber sample to be tested; (2) Using the extracted DNA from the cucumber sample to be tested as the amplification template, a PCR amplification system was established using the PCR primer pair described in the PCR detection kit as the PCR amplification primers and PCR amplification was performed; the PCR primer pair consists of an upstream primer with the nucleotide sequence shown in SEQ ID No. 3 and a downstream primer with the nucleotide sequence shown in SEQ ID No. 4; (3) If the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.1, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AA; if the amplification product has only one band and the nucleotide sequence of the band is as shown in SEQ ID No.2, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is BB; if the amplification product has two bands and the nucleotide sequences of the two bands are as shown in SEQ ID No.1 or SEQ ID No.2 respectively, then the genotype of the InDel molecular marker closely linked to the resistance to Cucumber scab leaf spot of the cucumber sample to be tested is AB.

9. The application according to claim 8, characterized in that, If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AA, then the cucumber does not contain the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous susceptible, and has low resistance to Cucumber Coccidioides leaf spot, exhibiting susceptibility. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is BB, then the cucumber contains the sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, is homozygous resistant, and has high resistance to Cucumber Coccidioides leaf spot, exhibiting highly resistant or resistant to Cucumber Coccidioides leaf spot. If the genotype of the InDel molecular marker closely linked to resistance to Cucumber Coccidioides leaf spot is AB, then the cucumber contains a heterozygous sequence fragment linked to the Cucumber Coccidioides leaf spot resistance gene, and has a high probability of exhibiting susceptibility to Cucumber Coccidioides leaf spot.

10. The application according to claim 8, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 300 seconds; 95℃ denaturation for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 60 seconds, 35 cycles; and a final extension at 72℃ for 350 seconds.