Sulfonylalanine decarboxylase mutant with enhanced enzyme activity and its application in taurine production
By randomly mutagenizing and high-throughput screening the sulfoalanine decarboxylase of *Erythroplasma oryzae*, a mutant sulfoalanine decarboxylase, D344A/Y456C, with enhanced catalytic activity, was obtained. This solved the problems of limited existing enzyme resources and low catalytic efficiency, and enabled a more efficient sulfoalanine decarboxylation reaction.
Patent Information
- Application Number
- CN202610254860.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2046-03-04
AI Technical Summary
Existing technologies have limited enzyme resources for catalyzing the decarboxylation reaction of sulfoalanine, and their catalytic efficiency is low, which limits in-depth research on the kinetic characteristics and catalytic mechanism of the sulfoalanine decarboxylation reaction.
By randomly mutating the sulfoalanine decarboxylase derived from *Berberis thunbergii* and combining it with high-throughput screening, the mutant D344A/Y456C was obtained, which significantly improved the decarboxylation catalytic activity of sulfoalanine while maintaining the original catalytic function.
The mutant exhibits approximately 3.25-fold increased catalytic activity, significantly improving the enzyme's catalytic efficiency and providing a more efficient sulfoalanine decarboxylase variant for taurine biosynthesis.
Smart Images

Figure CN121780497B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of enzyme engineering and biocatalysis technology, and relates to a sulfoalanine decarboxylase mutant, specifically used for the biocatalysis of sulfoalanine decarboxylation to taurine. Background Technology
[0002] Taurine is a conditionally essential micronutrient and an abundant sulfonic acid found in mammalian tissues and many foods, playing a variety of important physiological functions. Studies have shown that taurine participates in cell osmotic pressure regulation, calcium ion homeostasis maintenance, and nervous system activity regulation, while also playing roles in antioxidation, prevention of cell damage, and immune function regulation. Changes in taurine levels are closely related to various physiological states, therefore its biosynthetic mechanism has been a subject of considerable interest.
[0003] In living organisms, taurine is primarily produced from sulfur-containing amino acids through a series of enzymatic reactions. Cysteic acid (Cya) is considered a direct precursor molecule in taurine synthesis, and its decarboxylation is a crucial step in this pathway. Enzymes that can directly catalyze the decarboxylation of sulfoalanine to taurine are generally called cysteic acid decarboxylases (CADs), but there are currently few reports on the systematic identification and functional studies of these enzymes, and their origins and catalytic properties remain unclear. Naturally derived CADs generally suffer from low catalytic efficiency and limited substrate conversion rates, which to some extent limits in-depth research into the kinetics and catalytic mechanisms of sulfoalanine decarboxylation. Furthermore, CADs from different sources exhibit differences in substrate binding capacity and adaptability to reaction conditions, and the relationship between their structure and function is not fully elucidated. Random mutagenesis combined with high-throughput screening can obtain performance-improved mutants without relying on well-defined structures, and has proven to be an effective approach for enzyme performance optimization. However, systematic mutant screening studies targeting sulfoalanine substrates remain limited, and few mutants that significantly enhance their decarboxylation activity have been reported. Therefore, constructing a CAD mutant library targeting sulfoalanine substrates and screening for mutants with significantly enhanced catalytic activity is of great significance for deepening our understanding of the sulfoalanine decarboxylation process and revealing the structure-function relationship of CAD. Summary of the Invention
[0004] In view of the limited enzyme resources available in the prior art for catalyzing the decarboxylation reaction of sulfoalanine, and the reported low catalytic efficiency of cysteine sulfinate decarboxylase for sulfoalanine, this invention aims to provide a cysteine sulfinate decarboxylase mutant with higher catalytic activity for sulfoalanine.
[0005] The purpose of this invention is to provide a mutant of sulfoalanine decarboxylase with enhanced enzyme activity. This mutant uses a wild-type sulfoalanine decarboxylase derived from *Tribolium castaneum* as the wild-type enzyme, obtained through random mutation and screening of its encoding gene. The wild-type enzyme catalyzes the decarboxylation of sulfoalanine to produce taurine.
[0006] In this invention, the random mutation introduced at the mutation site affects the catalytic performance of the enzyme molecule without altering the original catalytic function of the wild-type enzyme, thereby improving the decarboxylation catalytic efficiency of the resulting mutant on sulfoalanine. Compared to the wild-type enzyme, this mutant exhibits significantly enhanced decarboxylation catalytic activity on the substrate sulfoalanine, with an activity increase of approximately 3.25 times under the same reaction conditions, enabling it to more effectively catalyze the decarboxylation of sulfoalanine to taurine. The mutant replaces aspartic acid (Asp, A) with alanine (Ala, A) at position 344 of the wild-type enzyme's amino acid sequence and replaces tyrosine (Tyr, Y) with cysteine (Cys, C) at position 456.
[0007] The present invention provides both the nucleotide and amino acid sequences of the wild-type enzyme and the mutant, wherein the encoding nucleotide sequence of the wild-type enzyme is shown in SEQ ID NO:1 and its amino acid sequence is shown in SEQ ID NO:2; the encoding nucleotide sequence of the mutant is shown in SEQ ID NO:3 and its amino acid sequence is shown in SEQ ID NO:4.
[0008] The sulfoalanine decarboxylase mutant obtained by this invention can be used in in vitro reaction systems or microbial systems to catalyze the decarboxylation reaction of sulfoalanine and its derivatives to produce taurine, and can serve as an effective enzyme resource in research related to the decarboxylation reaction of sulfoalanine.
[0009] The sulfoalanine decarboxylase mutant described in this invention is not limited to a specific expression vector or host system (i.e., genetically engineered bacteria). Synonymous substitutions of its encoded nucleotide sequence without altering the amino acid sequence should also fall within the protection scope of this invention.
[0010] Therefore, the present invention also provides a method for catalytic decarboxylation of sulfoalanine to synthesize taurine, wherein the enzyme solution of the sulfoalanine decarboxylase mutant with enhanced enzyme activity, or the fermentation broth or whole cell of the genetically engineered bacteria is used as a catalyst, and sulfoalanine decarboxylation is used as a substrate to catalyze the generation of taurine.
[0011] Specifically, the reaction system includes 10-50 mM sulfoalanine, 0.1-0.7 mM PLP, and 10-30 mM HEPES buffer at pH 7.2;
[0012] More specifically, the mixture before reaction was incubated at 30°C for 10 min before the enzyme solution was added to initiate the reaction;
[0013] The reaction was incubated at 30°C for 15 min. After the reaction was complete, the sample was heated at 95°C for 5 min and then cooled.
[0014] The present invention also provides a mutant of sulfoalanine decarboxylase with enhanced enzyme activity, which encodes a gene, and the application of the genetically engineered bacteria in catalyzing the decarboxylation of sulfoalanine to produce taurine.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] (1) In view of the limited types of enzymes for the decarboxylation reaction of sulfoalanine and the lack of research reports on related enzymes, this invention takes sulfoalanine decarboxylase with sulfoalanine decarboxylation activity as the research object. Through random mutation and high-throughput screening strategy, an enzyme mutant with higher decarboxylation catalytic activity for sulfoalanine was obtained, thus providing a new sulfoalanine decarboxylase variant.
[0017] (2) Compared with wild-type sulfoalanine decarboxylase, the mutant obtained in this invention has significantly improved the decarboxylation catalytic activity of sulfoalanine while maintaining the original catalytic function. Under the same reaction conditions, the enzyme activity is increased by about 3.25 times, which effectively improves the problem of low catalytic efficiency of wild-type enzyme for sulfoalanine.
[0018] (3) The mutants described in this invention can be obtained by randomly mutating and screening wild-type enzyme-encoding genes. The method used is based on conventional molecular biology techniques, with clear operating conditions, stable technical implementation path, and good reproducibility.
[0019] (4) The present invention clearly provides the nucleotide and amino acid sequences of the wild-type sulfoalanine decarboxylase and its mutants, so that the technical solution of the present invention has a clear structural basis and feasibility. Attached Figure Description
[0020] Figure 1 Figure: SDS-PAGE electrophoresis purification results of sulfoalanine decarboxylase;
[0021] Figure 2 Figure: Results of sulfoalanine decarboxylase activity assay. Detailed Implementation
[0022] To make the objectives, technical solutions, and advantages of this invention clearer, detailed descriptions are provided below in conjunction with specific embodiments, but these should not be construed as limiting the invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods well-known to those skilled in the art. Unless otherwise specified, the materials, reagents, and instruments used are commercially available.
[0023] Example 1: Construction of a sulfonylalanine decarboxylase mutant library
[0024] The sulfoalanine decarboxylase encoding gene from *Tribolium castaneum* was used as a template, and the gene sequence is shown in SEQ ID NO:1. A mutant library was constructed using error-prone PCR, and the target fragment was amplified using TaKaRa Taq. Error-prone PCR reaction system (50 μL): 5 μL 10×Taq buffer, Mg... 2+ (50 mmol / L) 7 μL, Mg 2+ 1 μL of 10 mmol / L primer, 4 μL of dNTPs (2.5 mmol / L), 2 μL of upstream primer (10 μmol / L), 2 μL of downstream primer (10 μmol / L), 1 μL of template DNA, 1 μL of Taq DNA polymerase, and ddH2O to a final volume of 50 μL. Primer sequences: TcCAD-F (SEQ ID NO:5): GCTGGTGCTGGTGCTATGCCGGCTACCGGTGAAGACCAGG and TcCAD-R (SEQ ID NO:6): GAGTGCGGCCGCAAGCTTTTACAGGTCAGAACCCAGACGTTCG. PCR reaction conditions: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; final extension at 72℃ for 10 min, and storage at 4℃. Using pET32a as a template, the gel-recovered fragment was ligated to the linearized vector backbone pET32a. The ligation product was then transformed into competent E. coli cells to construct a mutant library. After library construction, 10 sequences were selected for sequencing to verify the mutation rate, which was required to be greater than 9 / 10, with 1–3 mutations within the 1 kb range.
[0025] Example 2: High-throughput screening of sulfoalanine decarboxylase mutants
[0026] This invention utilizes a biosensor that responds to changes in taurine concentration. This sensor employs a fluorescent protein as its signal output module, generating a detectable change in fluorescence signal in the presence of taurine. The biosensor plasmid pBIO was co-transformed into host cells with a sulfoalanine decarboxylase mutant library. High-throughput screening of the mutant library was achieved by monitoring differences in fluorescence intensity.
[0027] (1) The above mutant library was transformed into E. coli BL21 strain containing pBIO, and cultured on plates at 37°C. After colonies grew, the colonies were scraped and washed with sterile PBS solution, and then inoculated into 100 mL LB medium. The initial OD 600 0.05, incubated at 37℃ until OD 600 The concentration was 0.4, and IPTG was added to a final concentration of 0.2 mM. The mixture was then incubated overnight at 16°C.
[0028] (2) Collect the overnight culture, wash twice with PBS solution, resuspend in 20 mM HEPES buffer, and perform whole-cell catalytic reaction. Reaction system: 200 mM sulfoalanine, 0.4 mM PLP, bacterial OD 600 The reaction was carried out at 15-30℃ for 12 hours.
[0029] (3) Flow cytometry analysis: Take 1 mL of reaction solution, centrifuge to collect bacterial cells, wash the bacterial cells with PBS, repeat twice, resuspend and dilute OD 600 At a concentration of 0.05, using the wild-type enzyme as a control, flow cytometry was performed for sorting. Cells with higher fluorescence intensity than the control, and those in the top 0.1%–0.4% of fluorescence intensity, were collected on resistant LB agar plates and incubated overnight at 37°C.
[0030] (4) Two-step verification: Colonies from overnight culture plates were picked up with a sterile toothpick and inoculated into 96-well shallow plates containing 200 μL LLB resistance liquid medium. The plates were incubated at 37°C and 800 rpm for 6 h. Then, 100 μL of the inoculum was transferred to 96-well deep plates containing 800 μL LLB resistance medium (0.4 mmol / L IPTG) and incubated overnight at 25°C and 800 rpm. Simultaneously, 150 μL of the bacterial culture was added to a 50 μL reaction solution and reacted at 37°C and 800 rpm for 8 h. The fluorescence intensity was measured using a microplate reader. Using the wild-type enzyme as a control, bacteria with higher fluorescence intensity than the control were selected for verification. On the other hand, the overnight induced 96-well plate was removed, balanced with a balance, and centrifuged at 4000 rpm for 10 min at 4°C to collect the bacterial cells. The supernatant was discarded, and then 200 μL of lysis buffer containing 3 mg / mL lysozyme was added to each well. The plate was incubated at 37°C for approximately 4 h. After centrifugation at 4000 rpm for 10 min at 4°C, the supernatant was obtained as the crude enzyme solution. The conversion rate of sulfoalanine was determined using the crude enzyme solution. The reaction system consisted of 30 mM sulfoalanine, 0.4 mM MPLP, and 20 mM HEPES buffer (pH 7.2). The amount of taurine produced was detected using HPLC.
[0031] (5) After the above screening, a mutant strain with significantly increased taurine production was obtained. Sequencing results showed that the decarboxylase in this strain was mutated to D344A / Y456C. Subsequently, the recombinant strain was scaled up and cultured, and protein purification and enzyme activity were measured.
[0032] Example 3: Protein Expression, Purification and Analysis
[0033] Wild-type (WT) sulfoalanine decarboxylase and its mutants (D344A, Y456C, D344A / Y456C) were transformed into recombinant plasmids. E. coli In BL21(DE3), the culture was carried out overnight at 37°C. Single clones were picked and inoculated into 3 mL of LB liquid medium containing ampicillin, and cultured with shaking at 37°C and 220 rpm. The pre-cultured medium was then inoculated at a 1% inoculum into 100 mL of LB liquid medium containing ampicillin, and cultured at 37°C until OD (occurrence limit) was reached. 600When the concentration was approximately 0.4, IPTG was added to a final concentration of 0.1 mM, and protein expression was induced at 16℃ with continuous shaking for 20 h. After culture, the bacterial cells were collected by centrifugation at 12000 rpm for 10 min, washed with 5 mL Lysis buffer, resuspended, and centrifuged again to remove impurities. The cells were then resuspended in 10 mL Lysis buffer, and the cells were disrupted by sonication. The lysis buffer was centrifuged at 12000 rpm for 10 min at 4℃, and the supernatant was collected as the crude enzyme solution. Purification was performed by nickel affinity chromatography: the nickel column was first equilibrated with Lysis buffer, the crude enzyme solution was loaded into the nickel column, and then washed with washing buffer for 10 column volumes to remove non-specifically binding proteins. The target protein was eluted with Elution buffer containing 500 mM imidazole, and the elution fraction was collected. The purified enzyme solution was concentrated using ultrafiltration to remove imidazole and dissolved in 20 mM HEPES buffer for later use. Protein expression and purification efficiency were assessed using SDS-PAGE (Sodium dodecyl sulfate polyacrylamide gel electrophoresis). The electrophoresis results are shown below. Figure 1 As shown, the target protein exhibits a clear band at the expected molecular weight position, and the amount of contaminating proteins is significantly reduced after purification, indicating that the sulfoalanine decarboxylase and its mutant can be effectively expressed in the host bacteria and achieve high purity. Protein concentration was determined using the Quick Start Bradford Protein Assay Kit.
[0034] Example 4: Enzymatic Properties Analysis and Characterization
[0035] The reaction system for the decarboxylase activity assay included 30 mM sulfoalanine, 0.4 mM PLP, and 20 mM HEPES buffer (pH 7.2). Before the reaction, the mixture was incubated at 30°C for 10 min, followed by the addition of 20 μg of purified enzyme solution. The reaction was then incubated at 30°C for 15 min. After the reaction, the sample was heated at 95°C for 5 min, cooled, and centrifuged at 12000 rpm for 10 min. The supernatant was collected for product analysis. The amount of taurine produced was determined using high-performance liquid chromatography (HPLC). One enzyme activity unit (U) was defined as the amount of enzyme required to catalyze the production of 1 μmol of sulfoalanine per minute under the specified reaction conditions.
[0036] Test results are as follows Figure 2As shown, the wild-type sulfoalanine decarboxylase (WT) exhibited an enzyme activity of 7.74 U / mg under the aforementioned conditions. In contrast, the D344A / Y456C double-site mutant showed a significantly increased rate of taurine production under the same reaction conditions, with an enzyme activity reaching 25.16 U / mg. The comparative results indicate that the double-site mutant's decarboxylation catalytic activity for sulfoalanine is approximately 3.25 times that of the wild-type enzyme. Furthermore, to verify the effect of mutation sites on enzyme activity, enzyme activity tests were conducted on mutants containing only a single mutation at position 344 or 456. The results showed that the catalytic activities of both single-site mutants were higher than those of the wild-type enzyme, at 19.08 U / mg and 12.83 U / mg, respectively, but their activities were lower than those of the double-site mutant, further demonstrating that simultaneously introducing two mutation sites is more beneficial for enhancing the decarboxylation catalytic ability of sulfoalanine decarboxylase for sulfoalanine.
Claims
1. A sulfoalanine decarboxylase mutant with enhanced enzyme activity, characterized in that, Its amino acid sequence is shown in SEQ ID NO:
4.
2. The gene encoding the sulfoalanine decarboxylase mutant with enhanced enzyme activity as described in claim 1.
3. The encoding gene as described in claim 2, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:
3.
4. A recombinant vector carrying the encoding gene as described in claim 2 or 3.
5. The recombinant vector according to claim 4, characterized in that, It is pET32a carrying the encoding gene as described in claim 2 or 3.
6. Genetically engineered bacteria expressing the mutant of claim 1.
7. The genetically engineered bacterium according to claim 6, characterized in that, It is an Escherichia coli expressing the mutant of claim 1.
8. A method for catalytic decarboxylation of sulfonylalanine to synthesize taurine, characterized in that, Using the enzyme solution of the sulfoalanine decarboxylase mutant with enhanced enzyme activity as described in claim 1, or the fermentation broth or whole cells of the genetically engineered bacteria as described in claim 6 or 7, as a catalyst, taurine is catalyzed to be produced using sulfoalanine as a substrate.
9. The method as described in claim 8, characterized in that, The reaction system consists of 10-50 mM sulfoalanine, 0.1-0.7 mM PLP, and 10-30 mM HEPES buffer at pH 7.
2.
10. The method as described in claim 8, characterized in that, Before the reaction, the mixture of reaction system (excluding catalyst) was incubated at 30°C for 10 min, and then the enzyme solution was added to form the reaction system to start the reaction. The reaction was incubated at 30°C for 15 min; After the reaction was completed, the sample was heated at 95℃ for 5 min and then cooled.
11. The sulfoalanine decarboxylase mutant with enhanced enzyme activity as described in claim 1, the encoding gene as described in claim 2 or 3, and the application of the genetically engineered bacteria as described in claim 6 or 7 in the catalytic decarboxylation of sulfoalanine to produce taurine.
Citation Information
Patent Citations
Recombinant host cells for the production of 3-hydroxypropionic acid
CN107109347A
Choline kinase mutant and application thereof in production of citicoline
CN116240193A