Genetically engineered Max Kluyveromyces yeast and its applications

Abstract

This invention discloses a genetically engineered strain of *Kluyveromyces martensii* and its applications, belonging to the field of bioengineering technology. The invention discloses a genetically engineered *Kluyveromyces martensii* strain, firstly obtained through screening a strain that produces high levels of ergosterol; based on this, it induces and isolates... Eye A haploid strain was constructed and then metabolically optimized through the introduction of heterologous DHCR24 and DWF5 genes, weakening of the competitive pathway gene ERG6, increasing the metabolic flux of the post-squalene pathway during sterol synthesis, peroxisome compartmentalization engineering of the mevalonate pathway, knockout of the hypoxia-inhibiting transcription factor ROX1, improved cofactor supply, and optimization of the yeast lipid pathway, resulting in a high-cholesterol-producing engineered strain. Through fed-batch fermentation, efficient and stable cholesterol synthesis was achieved, with a yield of 7.64 g / L, laying the foundation for cholesterol biomanufacturing.

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and more specifically to the genetically engineered strain of Kluyveromyces martensii and its applications. Background Technology

[0002] Sterols are a class of lipid molecules widely distributed in nature and possessing important biological activities. They play irreplaceable and crucial roles in life activities such as cell structure maintenance, signal transduction, metabolic regulation, and biosynthesis. As core components of eukaryotic cell membranes, sterols not only maintain cell structural stability by regulating membrane fluidity and permeability, but also serve as precursors for various bioactive molecules, participating in physiological processes such as hormone synthesis, vitamin D metabolism, and bile acid production. Among the many sterols, ergosterol and cholesterol stand out. As characteristic sterols of fungal and animal cell membranes, respectively, they are not only structurally highly conserved but also play a central role in the regulation of biological membrane function, cell signal transduction, and disease development.

[0003] Ergosterol, a major sterol in the cell membranes of eukaryotic microorganisms such as fungi, has important industrial applications. It is a precursor to vitamin D2, which can be converted into vitamin D2 upon ultraviolet irradiation. This vitamin D2 can be used to prevent rickets and osteoporosis and has been used as a feed additive to improve livestock and poultry production performance. Furthermore, ergosterol is a key raw material for the production of steroid hormones such as cortisone and progesterone, which play important roles in anti-inflammatory, anti-allergic, and reproductive health applications. In terms of production, ergosterol is mainly obtained through yeast or filamentous fungal fermentation. However, due to the low content of ergosterol in eukaryotic microbial cells, it is primarily extracted from the waste cells after industrial fermentation of other products by eukaryotic microorganisms. This process is highly polluting and costly, necessitating further optimization of ergosterol production methods to reduce costs and pollutant emissions.

[0004] Cholesterol is an essential component of animal cell membranes, playing a crucial role in maintaining cell membrane integrity, regulating cell signal transduction, and synthesizing steroid hormones. Cholesterol has a wide range of industrial applications, with core uses including: as a precursor to vitamin D3 in the production of feed additives and pharmaceutical raw materials; as a key synthetic raw material in the production of steroid hormones (such as cortisone and progesterone); and as a liposome component, used as an emulsifier in cosmetics and as a liposome excipient in the pharmaceutical field. Currently, there are two main methods for cholesterol production: the first is extraction from lanolin. Lanolin, a byproduct of the wool industry, is rich in cholesterol (10%–15%), and is abundant, inexpensive, and has high stability and safety; therefore, this method is used for most cholesterol products both domestically and internationally. However, cholesterol in lanolin is mostly bound to lanolin acid to form esters, requiring saponification to release it. The resulting mixture still contains a large amount of structural analogs such as dehydrocholesterol and dihydrocholesterol. These analogs have similar molecular structures and properties to cholesterol, making separation and purification extremely difficult and becoming a key challenge in the process. Furthermore, the application of animal-derived cholesterol is limited by safety regulations and cultural constraints. The second method is chemical synthesis, such as using bacitracol (BA), an intermediate from the microbial transformation of phytosterols, as a raw material to synthesize cholesterol through chemical reactions; this is commonly known as "plant-based cholesterol." This method avoids the potential risks of animal-derived raw materials, but the chemical synthesis process is complex, involving multiple reaction and purification steps, resulting in higher costs and the potential introduction of byproducts that affect product purity. In addition, both methods face challenges related to fluctuating raw material supply, safety, and environmental pollution, necessitating the search for new, greener, and safer production methods.

[0005] Yeast is a class of single-celled microorganisms widely used in the food, pharmaceutical, brewing, and feed industries. It naturally contains ergosterol and is an excellent substrate for producing ergosterol or, after metabolic engineering, for producing cholesterol and other sterols. Saccharomyces cerevisiae (brewer's yeast) is a conventional yeast with a clear genetic background and mature gene-editing technology. Although there are reports of extracting ergosterol from Saccharomyces cerevisiae, the Saccharomyces cerevisiae used industrially are mostly waste yeast generated from other industrial processes. Reports of using genetically engineered Saccharomyces cerevisiae for large-scale ergosterol production are rare, and reports of using genetically engineered Saccharomyces cerevisiae for large-scale industrial cholesterol production are even rarer. Furthermore, there are no reports of using genetically engineered unconventional yeasts, such as Kluyveromyces martensii, for large-scale production of ergosterol and cholesterol.

[0006] Compared to Saccharomyces cerevisiae, unconventional yeasts offer significant advantages in industrial applications. They exhibit greater environmental tolerance, adapting to extreme conditions such as high osmotic pressure, high salinity, low temperatures, or strong acids and alkalis, as exemplified by species like *Yersinia lipolytica*, *Kluyveromyces martensii*, and *Issa mesasura*. They also possess a broader substrate utilization range, capable of metabolizing various carbon sources, including pentoses, facilitating the production of useful target molecules from waste materials such as lignocellulose. Furthermore, they demonstrate higher metabolic efficiency and product yield, allowing for the efficient production of specific products through modification. Their application potential is also broader, encompassing fields such as food, chemical, and pharmaceutical industries. For instance, FDA-approved *Yersinia lipolytica* is used in the food industry, while *Kluyveromyces martensii* is heat-resistant and suitable for cellulose fermentation. Additionally, their stronger stress resistance makes them promising candidates for high-concentration substrate fermentation. These advantages make unconventional yeasts ideal chassis cells for next-generation industrial biotechnology.

[0007] Max Kluyveromycin ( Kluyveromyces marxianus As a highly promising unconventional yeast, this strain has become a promising application in the field of biomanufacturing due to its excellent metabolic characteristics and robustness in industrial fermentation. This strain is not only certified as a Generally Recognized As Safe (GRAS) strain by the US Food and Drug Administration (FDA), but also holds QPS certification from the European Food Safety Authority (EFSA). In my country, it is listed as a strain suitable for direct consumption, thus possessing the highest level of biosafety. In terms of physiological characteristics, this yeast exhibits significant advantages: its heat resistance is outstanding, growing in a wide temperature range of 25-47℃, with an optimal growth temperature of 30-45℃; some extreme strains can even survive at temperatures as high as 50℃. This characteristic gives it unique value in high-temperature fermentation processes, significantly reducing cooling energy consumption and effectively inhibiting contamination by other microorganisms, thus improving the stability of the fermentation process. Furthermore, with a growth rate of 0.86-0.99 g / h, this strain is currently the fastest-growing eukaryote known, with a proliferation rate approximately twice that of Saccharomyces cerevisiae, which can significantly shorten the fermentation cycle and significantly improve production efficiency. In terms of metabolism, this yeast exhibits an extremely broad carbon source utilization spectrum, efficiently metabolizing hexoses such as glucose, lactose, and galactose; pentoses such as xylose and arabinose; and complex carbohydrates such as cellobiose, inulin, and trehalose. As a Crabtree-negative strain, its preferential respiration metabolism avoids excessive ethanol accumulation under high-sugar environments, thereby improving carbon source utilization efficiency and reducing byproduct formation. At the genetic manipulation level, this strain has been used to develop various highly efficient gene-editing tools, such as CRISPR-Cas9, providing a convenient platform for metabolic engineering.

[0008] Most importantly, Kluyveromyces martensii possesses the complete mevalonate (MVA) pathway, containing all the key enzyme systems from acetyl-CoA to sterol synthesis, providing an ideal metabolic basis for the heterologous synthesis of sterol compounds.

[0009] Therefore, providing genetically engineered strains of Kluyveromyces martensii and their applications is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0010] The purpose of this invention is to use a non-conventional yeast strain with high ergosterol production potential as a cholesterol production chassis by screening a natural strain with high ergosterol production potential for industrial application, and then construct a genetically engineered strain capable of high cholesterol production by isolating and modifying haploid strains and screening and modifying endogenous promoters.

[0011] During the modification and utilization of unconventional yeasts, it was unexpectedly discovered that some unconventional yeasts have a significantly higher ability to synthesize ergosterol in their natural state than Saccharomyces cerevisiae. Based on this discovery, this invention systematically screened various unconventional yeast strains and ultimately selected a high-ergosterol-producing strain, Kluyveromyces martensii, as the research object. Through genetic engineering, a high-cholesterol-producing engineered strain was successfully obtained. Verified in a ton-scale fermenter, these strains achieved a cholesterol production level of 7.64 g / L, setting a new record for the highest cholesterol production by known microorganisms.

[0012] This invention confirms that *Kluyveromyces martensii* possesses a stronger ability to synthesize sterol products compared to common eukaryotic microorganisms such as *Saccharomyces cerevisiae*. This invention is the first to develop *Kluyveromyces martensii* into a genetic engineering platform capable of high-level cholesterol synthesis, laying a key technological foundation for the large-scale production of sterol compounds through industrial fermentation.

[0013] To achieve the above objectives, the present invention adopts the following technical solution:

[0014] A strain of Kluyveromyces macrocarpa genetically engineered strain Chol03,

[0015] Starting with the haploid strain Kliveckia marcescens KM01, knockout URA3 (orotidine-5'-phosphate decarboxylase) gene and HIS3 (imidazole glycerol-phosphate dehydratase) gene;

[0016] The haploid strain *Kluyveromyces martensii* KM01, with accession number CGMCC No. 39148, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, on February 10, 2026. It is classified as *Kluyveromyces martensii*. Kluyveromyces marxianus ;

[0017] The DWF5 (7-dehydrocholesterol reductase) gene and the DHCR24 (Δ(24)-sterol reductase) gene were overexpressed at the KmADH3 site via the pGOM45 promoter;

[0018] Overexpression of DWF5 and DHCR24 genes via the pGOM45 promoter at the Ku70 site;

[0019] The KmADH3 site sequence is shown in SEQ ID NO.53;

[0020] The pGOM45 promoter sequence is shown in SEQ ID NO.37;

[0021] The DWF5 gene sequence is shown in SEQ ID NO.39;

[0022] The DHCR24 gene sequence is shown in SEQ ID NO.40;

[0023] The Ku70 site sequence is shown in SEQ ID NO.64.

[0024] The high-cholesterol-producing Kluyveromyces macrocarpa genetically engineered strain Chol03, while also exhibiting similarities in the genome of Kluyveromyces macrocarpa LK02. KmADH3 and Ku70 Site integration of key cholesterol synthesis enzymes, incorporated into the complete gene expression frame of the genome. Left-pGOM45-DWF5-tCYC1-pGOM45-DHCR24-tINU1-Right, The strain Chol03 was obtained, with a cholesterol yield of 285.68 mg / L.

[0025] Furthermore, a strain of Kluyveromyces macrocarpa genetically engineered strain Chol07,

[0026] Using the genetically engineered bacterium Chol03 as the starting strain, pERG7 Promoter replacement pERG6 promoter;

[0027] The pERG7 The promoter sequence is shown in SEQ ID NO.73;

[0028] The pERG6 The promoter sequence is shown in SEQ ID NO.74.

[0029] Furthermore, a strain of Kluyveromyces macrocarpa genetically engineered strain Chol16,

[0030] The genetically engineered bacterium Chol07 was used as the starting strain.

[0031] WillERG1 (Squalene monooxygenase) gene and ERG11 (Stanol 14-α-demethylase) gene integrated into NS1 site;

[0032] Will ERG26 (C-4 sterol methyl oxidase, Sterol-4-alpha-carboxylate 3-dehydrogenase) gene and ERG27 (3-keto-steroid reductase) gene integration into NS2 site;

[0033] Will ERG2 (C-8 sterol isomerase) gene and ERG3 (C-5 sterol desaturase) gene integrated into NS3 site;

[0034] The ERG1 The gene sequence is shown in SEQ ID NO. 85; ERG11 The gene sequence is shown in SEQ ID NO. 86; NS1 The site sequence is shown in SEQ ID NO. 91;

[0035] The ERG26 The gene sequence is shown in SEQ ID NO. 87; ERG27 The gene sequence is shown in SEQ ID NO. 88; NS2 The site sequence is shown in SEQ ID NO. 92;

[0036] The ERG2 The gene sequence is shown in SEQ ID NO. 89; ERG3 The gene sequence is shown in SEQ ID NO. 90; NS3 The site sequence is shown in SEQ ID NO.93.

[0037] The genetically engineered *Kluyveromyces martensii* strain Chol16, based on Chol07, was used in the NS1 region of the genome. NS2 , NS3 Key rate-limiting genes in the squalene pathway after sequential pairwise integration of sites ERG1 , ERG11 , ERG26 , ERG27 ,ERG2 , ERG3 A total of 6 genes were obtained from strain Chol16, and the complete gene expression frames integrated into the genome are as follows: Left-pGOM45-ERG1- tCYC1-pGOM45-ERG11-tADH3-Right;Left-pGOM45-ERG26-tCYC1-pGOM45-ERG27-tADH3- Right;Left-pGOM45-ERG2-tCYC1-pGOM45-ERG3-tADH3-Right, The cholesterol production was 503.47 mg / L.

[0038] Furthermore, a strain of Kluyveromyces macrocarpa genetically engineered strain Chol41,

[0039] Using the genetically engineered bacterium Chol16 as the starting strain,

[0040] Will ERG20 (Farnesyl pyrophosphate synthase) gene and HMG1 The (3-hydroxy-3-methylglutaryl-CoA reductase) gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. GRE3 site;

[0041] Will IDI1 (isopentenyl-diphosphate delta-isomerase) gene and ERG8 The phosphomevalonate kinase gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. DPP1 site;

[0042] Will ERG10 Genes (acetyl-CoA C-acetyltransferase) and ERG12 The mevalonate kinase gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. OPI1 site;

[0043] The ERG20 The gene sequence is shown in SEQ ID NO. 133; HMG1 The gene sequence is shown in SEQ ID NO. 134; GRE3 The site sequence is shown in SEQ ID NO.140;

[0044] The IDI1 The gene sequence is shown in SEQ ID NO. 135; ERG8 The gene sequence is shown in SEQ ID NO.136;DPP1 The site sequence is shown in SEQ ID NO.141;

[0045] The ERG10 The gene sequence is shown in SEQ ID NO. 137; ERG12 The gene sequence is shown in SEQ ID NO. 138; OPI1 The site sequence is shown in SEQ ID NO.142;

[0046] The sequence of the peroxisome localization signal peptide ePTS1 is shown in SEQ ID NO.139.

[0047] The Kluyveromyces macrocarpa genetically engineered strain Chol41, starting with Chol16, sequentially introduced key rate-limiting genes from the pre-squalene pathway. ERG20 , HMG1 , IDI1 , ERG8 , ERG10 , ERG12 A total of 6 genes plus targeting peroxisome localization ePTS1 Tags are then combined in pairs to construct expression frames, which are then inserted into the genome. GRE3 , DPP1 , OPI1 The site was used to obtain strain Chol41, and the complete gene expression frames integrated into the genome were as follows: Left-pGOM45-ERG20-ePTS1-tCYC1-pGOM45- HMG1-ePTS1-tINU1-Right;Left-pGOM45-IDI1-ePTS1-tCYC1-pGOM45-ERG8-ePTS1-tINU1- Right;Left-pGOM45-ERG10-ePTS1-tCYC1-pGOM45-ERG12-ePTS1-tINU1-Right, The cholesterol production was 745.59 mg / L.

[0048] Furthermore, a genetically engineered strain of Kluyveromyces martensii, Chol55, was used as the starting strain of genetically engineered strain Chol41, and the ROX1 (hypoxia-induced repressor protein 1) gene was knocked out.

[0049] Furthermore, a strain of Kluyveromyces macrocarpa genetically engineered strain Chol82,

[0050] Using the genetically engineered bacterium Chol55 as the starting strain,

[0051] Will UGA2 (Succinate-semialdehyde dehydrogenase) gene and NOX (NADH oxidase gene from Streptococcus pneumoniae) integrated into NS8 site;

[0052] The UGA2 The gene sequence is shown in SEQ ID NO.190;

[0053] The NOX The gene sequence is shown in SEQ ID NO.191;

[0054] The NS8 The site sequence is shown in SEQ ID NO.192.

[0055] The genetically engineered *Kluyveromyces martensii* strain Chol82, based on Chol55, was developed in the genome... NS8 Site integration of the NADPH supply gene UGA2 and the gene encoding the aqueous NADH oxidase of Streptococcus pneumoniae. NOX The complete gene expression cassette of strain Chol82, which was integrated into the genome, is as follows: Left-pGOM45-UGA2-tCYC1-pGOM45-NOX-tADH3-Right, The cholesterol production was 1064.11 mg / L.

[0056] Furthermore, a strain of Kluyveromyces macrocarpa genetically engineered strain Chol99,

[0057] Using the genetically engineered bacterium Chol82 as the starting strain, knockout TGL3 (Triglyceride lipase 3, bifunctional triglyceride lipase / lysophosphatidylethanolamine acyltransferase) gene and NEM1 (Nuclear envelope morphology protein 1) gene.

[0058] Furthermore, the application of the described Kluyveromyces macrocephala genetically engineered strain in cholesterol production.

[0059] Furthermore, the application of the described Kluyveromyces macrocephala genetically engineered strain in increasing cholesterol production.

[0060] Furthermore, a method for producing cholesterol involves fermentation using the aforementioned Kluyveromyces macrocephala genetically engineered strain.

[0061] The substrate used for fed-batch fermentation consisted of: 20 g / L glucose, 20 g / L yeast extract, 15 g / L corn steep liquor, 3.5 g / L magnesium sulfate, 5 g / L potassium dihydrogen phosphate, and 5 ml of trace elements (4 g / L calcium chloride, 5 g / L ferrous sulfate, 0.5 g / L sodium molybdate, 0.6 g / L cobalt chloride, 0.5 g / L manganese chloride, 0.5 g / L copper sulfate, 10 g / L zinc sulfate, and 15 g / L sodium dodecyl sulfate). The carbon source in the feed was 500 g / L glucose, and the nitrogen source for the sulfur-added feed was 50 g / L yeast extract and 50 g / L corn steep liquor. The carbon source replenishment scheme was initiated after the base sugar was depleted and dissolved oxygen (DO) rebounded. The initial flow rate was 1-2 g / L / h of glucose, and during the logarithmic phase, the flow rate was controlled at approximately 5-6 g / L. Nitrogen and carbon sources were added simultaneously, with the nitrogen flow rate precisely calculated based on the carbon flow rate, and added at a C / N molar ratio of 6-10. The pH was maintained at a constant 5.5±0.5 by adding ammonia, and the growth temperature was 42±2℃. DO was controlled to >20% in the early and mid-stages by adjusting agitation and aeration. If this could not be controlled, the aeration rate was maintained at 1.5 VVM and the agitation speed at 180 rpm until fermentation ended.

[0062] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a genetically engineered strain of *Kluyveromyces martensii* and its application. Firstly, a strain of *Kluyveromyces martensii* with high cholesterol production was obtained through screening; based on this, it was induced and isolated... MATa A haploid strain was constructed and then metabolically optimized through the introduction of heterologous DHCR24 and DWF5 genes, weakening of the competitive pathway gene ERG6, increasing the metabolic flux of the post-squalene pathway during sterol synthesis, peroxisome compartmentalization engineering of the mevalonate pathway, knockout of the hypoxia-inhibiting transcription factor ROX1, improved cofactor supply, and optimization of the yeast lipid pathway, resulting in a high-cholesterol-producing engineered strain. The Chol99 strain achieved efficient and stable cholesterol synthesis in a bioreactor via fed-batch fermentation, yielding 7.64 g / L, laying the foundation for cholesterol biomanufacturing. Attached Figure Description

[0063] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0064] Figure 1 This is a diagram for identifying haploid strains; the genotype is... MATα or MATaAt that time, there were only one band, diploid ( MATα and MATa When the sample was observed to have two bands, colony PCR was performed on single colonies on the plate using primer pairs MATα-F / MATα-R and MATa-F / MATa-R to identify their genotype. The left lane of each colony contained the MATa PCR product, and the right lane contained the MATα PCR product. A diploid strain (CICC 33373) was used as a control. The product size was approximately 1500 bp. After PCR identification, the genotype of the obtained haploid strain was determined to be... MATa .

[0065] Figure 2 for URA3 Verification of auxotrophic strains after gene knockout; the plate in the left image is YPD solid medium, and the plate in the right image is Pangeno URA auxotrophic (URA-) medium.

[0066] Figure 3 The expression intensity of four endogenous promoters.

[0067] Figure 4 for pOM45 Expression intensity after deletion of the negative regulatory region; TSS is the transcription start site.

[0068] Figure 5 To add upstream activation sequences pGOM45 Intensity of expression.

[0069] Figure 6 This is a schematic diagram illustrating the sterol synthesis pathway in the genetically engineered strain of *Kluyveromyces martensii*.

[0070] Figure 7 The results of testing for cholesterol production by the genetically engineered strain Chloro99 of Kluyveromyces martensii in a 2-ton fermenter. Detailed Implementation

[0071] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0072] The strains and plasmids used in this invention are shown in Tables 1 and 2.

[0073] Table 1. Strains used

[0074]

[0075] Table 2 shows the plasmids used.

[0076]

[0077] For the NS1, NS2, NS3, and NS8 sites, please refer to Gu Z., Ding D., Shan Z., Tang Y., Chen 10.18331 / BRJ2025.12.3.5.

[0078] Example 1: Obtaining yeast carcasses that produce high levels of ergosterol

[0079] Using *Saccharomyces cerevisiae* CEN.PK2-1D as a reference, fermentation tests were conducted on various unconventional yeasts, including *Pichia pastoris*, *Issaccharomyces orientalis*, *Kluyveromyces marsupialis*, *Kluyveromyces lactis*, and *Kluyveromyces kudrica*, to screen for yeast chassis with high natural sterol production. The test medium was YPD medium (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract). Based on data measured after 5 days of fermentation, the yields of ergosterol were as follows: Saccharomyces cerevisiae CEN.PK2-1D, 54-58 mg / L; Pichia pastoris X33, 92-96 mg / L; Kluyveromyces lactis CICC 32472, 134-140 mg / L; Kluyveromyces lactis CICC 32406, 142-154 mg / L; Isaac's orientalis, 92-104 mg / L; Azviz kudrica CICC33331, 89-94 mg / L; Kluyveromyces martensii CICC 32017, 111-118 mg / L; Kluyveromyces martensii CICC33373, 177-186 mg / L; and Kluyveromyces martensii CICC 1911, 147-155 mg / L. The results showed that, under the same culture conditions, Kluyveromyces macrocarpa produced significantly more ergosterol than Saccharomyces cerevisiae and other unconventional yeasts tested, with Kluyveromyces macrocarpa CICC 33373 producing the highest amount. Therefore, Kluyveromyces macrocarpa CICC 33373 was selected as a high-cholesterol-producing yeast platform for modification.

[0080] Example 2: Screening and acquisition of Kluyveromyces martensii haploid strain KM01

[0081] Kluyveromyces macrocarpa CICC 33373 was plated on 1% potassium acetate medium (containing 0.1% yeast extract, 1% potassium acetate, and 0.05% glucose) and incubated at 30°C for 7 days. Afterward, the cells were collected, aseptically washed with water, and treated with 2% snailase. The treated cells were then plated on antibiotic-free YPD plates for subsequent spore isolation and incubated at 30°C.

[0082] Furthermore, for single colonies isolated from spores, genotyping was performed using primer pairs MATα-F / R and MATa-F / R, resulting in a strain with the genotype [missing information]. MATa haploid strains ( Figure 1 ), named KM01 (Table 1).

[0083] KM01, with accession number CGMCC No. 39148, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The deposit date is February 10, 2026, and its classification name is *Kluyveromyces martensii*. Kluyveromyces marxianus .

[0084] The specific primer sequences are as follows:

[0085] MATα-F: AGAACACAAACAAAGCCAAGTTGACAGAAAAATAC; SEQ ID NO. 1.

[0086] MATα-R: CCACCAATTATATATTGATGTAAAAACAGAAGGTAGTATGCC; SEQ ID NO. 2.

[0087] MATa-F: GTATTGAGGGTATTCTATTTAATAGGACCAGCTATTGG; SEQ ID NO.3.

[0088] MATa-R: CACCAACTCTTCGGGTGAATTTATTCACC; SEQ ID NO.4.

[0089] Example 3 Preparation of auxotrophic strain LK02

[0090] KmURA3 gene and upstream and downstream sequences:

[0091] tatacctcaatcaaaactgaaattaggcgcctgtcacggctctttttactgtacctgtgacttcctttcttatttccaaggatgctcatcacaatacgcttctagatctattatgcattataattaatatagttgtagctacaaaaggtaaaagaaagtccggggcaggcaacaatagaaatcggaaaaactacagaaatactaagagcttcttccccattcagtcatcgcatttcgaaacaagagggaatggctctggctaggaactaaccaccatcgcctgactatgcactaaccacgtgactacatatatgtgatcgtttttaacatttcaaaggctgtgtgtgtctggctgtttccattaatttcactgattaagcagtcatattgaagctcatcaccaacaagaaatactaccgtaaaagtgtaaaagttcgtttaaatcattgtaaactggaacagcaagagaagtatcatcagctagctagcccataaactaatcaaaggagg at gtcgactaagagttactcggaaagagcagctgctcatagaagtccagttgctgccaagcttttaaacttgatggaa gagaagaagtcaaacttatgtgcttctcttgatgttcgtaaaacagcagagttgttaagattagttgaggttttgg gtccatatatctgtctattgaagacacatgtagatatcttggaggatttcagctttgagaataccattgtgccgtt gaagcaattagcagagaaacacaagtttttgatatttgaagacaggaagtttgccgacattgggaacactgttaaa ttacaatacacgtctggtgtataccgtatcgccgaatggtctgatatcaccaatgcacacggtgtgactggtgcgg gcattgttgctggtttgaagcaaggtgccgaggaagttacgaaagaacctagagggttgttaatgcttgccgagtt atcgtccaaggggtctctagcgcacggtgaatacactcgtgggaccgtggaaattgccaagagtgataaggacttt gttattggatttattgctcaaaacgatatgggtggaagagaagagggctacgattggttgatcatgacgccaggtg ttggtcttgatgacaaaggtgatgctttgggacaacaatacagaactgtggatgaagttgttgccggtggatcaga catcattattgttggtagaggtcttttcgcaaagggaagagatcctgtagtggaaggtgagagatacagaaaggcg ggatgggacgcttacttgaagagagtaggcagatccgcttaa gagttctccgagaacaagcagaggttcgagtgtactcggatcagaagttacaagttgatcgtttatatataaactatacagagatgttagagtgtaatggcatt gcgcacattgtatacgctacaagtttagtcacgtgctagaagctgttttttgcaccgaaaatttttttttttttttttttgttttttggtgaagtacattatgt gaaatttcacaaccaaagaaaaagagtttaatacaagtgcgaagaaccaaaccttgcttcttagtccattgaccgttataaaagatacacatttctgctagact ttctgctttactactagtgtgaagaaagatacaagagtcaatttttattgagtcttggaccgtcgattgctagaacaaaaaaatcaaatacacagttaaaa; SEQ ID NO.5.

[0092] In SEQ ID NO.5, 1-522bp is the upstream homologous arm sequence of the KmURA3 gene; 523-1326bp is the KmURA3 gene sequence; 1327-1740bp is the downstream homologous arm sequence of the KmURA3 gene; and 868-887bp is the PAM sequence.

[0093] KmHis3 gene and upstream and downstream sequences:

[0094] gagaatatttcttcttaaaccactcgtccttatccatgccatcttttcccatgctttcgttctctttgtatcgggaagttccttccaaatgttactttcttgtctttgatgaaggattcatttgggattttcaccgctggacgaattctggtggcaaagcctctataaacagctttcatgatatttattgttgacaacttaatattactgttaagaaaaggcggatgagaatacctagctctctagtatctttctaatag atatccaagctcacattatctcaactcatctcatctctatactgcaactttttctttagaaatttttcaagaagtgatattttctttagacattttttttttttttaaaaggctccaagaatgattcataatatgaaatcaagtataaatgcagctgtacaatggtttaacttagtttaagatccgttcggaagtactattattgtaacattttacacaataagaaggtcttcaaataaggactttgataccgagaca atgacatacccagaaaggaaagcttttgtgtctagaataacaaatgagacaaaaattcagatagccatatcctta catggggggcatatctcaatcccaaattctatactggatagaccggagtcggacgttgcaaaacaagctactggtt cacagattattgacattcaaactggtattggatttctagatcatatgattcatgccctagcgaagcactctggttg gtccttaattgtcgaatgtatcggagatttgcatatcgatgaccaccatactacggaggattgtggtattgctcta ggacaggcttttaaagaagcattaggtcatgtccgtggtgtgagaagatttggtactggatttgcaccattggacg aagcattatcaagggccgtcgttgatctatccaacagaccattcgccgtaatagatttgggtttaaaaagagaaaa aatcggtgatctttcatgtgaaatgataccacatttcttggagtcatttgcggaagctgcaagagtaactttacat gttgactgtttaagaggctttaatgatcatcacagaagtgagtcagcctttaaggctcttgctgtggctatcagag aggctatttccagtaacggtacaaatgacgttccatctaccaaaggagttttgatgtaactggctactccatacaaggcggtataaataaaatataataacatgtttgtacaataatgttttcctatttattacttcatatattatatatgttgcacctaaaataaggaagttattctcaaagtt attgtgtacttttatattatttacatgggaatttatatatatatattgtgcgtgtggtgacagcataacgccctttcttaggcattagtctttagtagattcaaaaattcttcactttgatttct tgattcctcagcactgatagatctgatcgtcttcttggggaatgcattgtgtggactagtcctactgaactgggttctacgttgacctaatccaatcttttgagcaaaattgaaatcattctttgg ttcgattagggaagctgcaagggttacagttccgctttcaaccttaggatcttcgattacaaatggcaaaacttgttgtctaacgaaatcacccatgtcaaactgcaatgcacgaggattacg; SEQ ID NO.6.

[0095] In SEQ ID NO.6, 1-525bp is the upstream homologous arm sequence of the KmHis3 gene; 526-1191bp is the KmURA3 gene sequence; 1192-1692bp is the downstream homologous arm sequence of the KmHis3 gene; and 859-878bp is the PAM sequence.

[0096] To facilitate the construction and application of engineered bacteria, a auxotrophic form of the Kluyveromyces martensii haploid KM01 was constructed, and the resulting strain was... URA3 (The gene sequence is shown as 523-1326bp in SEQ ID NO.5) and HIS3 (The gene sequence is shown as 526-1191bp in SEQ ID NO.6) The double gene knockout strain was named LK02 (Table 1).

[0097] URA3 Knockout: in strain KM01 URA3 After identifying gene knockout targets, the plasmid pUDP046-2 was cloned using primer pair URA3-F / URA3-R circular PCR.

[0098] Obtaining plasmid pUDP046-2: Based on plasmid pUDP046 (Addgene: 107062), the G418 expression cassette (gene sequence as shown in SEQ ID NO.7) was inserted at the NotI site.

[0099] The primer pair sequences are as follows:

[0100] URA3-F:

[0101] TCTGATATCACCAATGCACA gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.8.

[0102] URA3-R:

[0103] TGTGCATTGGTGATATCAGA tttgtttgtttatgtgtgtttattcgaaactaagttcttgg; SEQ ID NO.9.

[0104] The PCR reaction system consisted of 25 µL KOD1 enzyme, 20 µL ddH2O, 2 µL primer F, 2 µL primer R, and 1 µL template. The PCR conditions were: 94 °C pre-denaturation for 2 min; 98 °C denaturation for 10 s, Tm-5 °C annealing for 5 s, 68 °C extension at 1 kb / 10 s, for 35 cycles (denaturation-extension); and a final extension at 68 °C for 5 min. The amplified fragments were recovered using a gel extraction kit from Magen Biosciences, and the purified PCR product was rapidly recombined using a one-step rapid cloning kit from Shanghai Yisheng Biotechnology Co., Ltd. (50 °C, 30 min). The product was then transformed into *E. coli* using a conventional chemical transformation method. DH5α The competent cells were then plated on LB plates containing ampicillin and incubated overnight to obtain plasmid 25Y001 (Table 2, the original plasmid was pUDP046).

[0105] Obtaining URA3 Donor: Using strain KM01 as a template, PCR was performed using primer pairs URA3-UP-F / URA3-UP-R and URA3-Down-F / URA3-Down-R to obtain the URA3-UP and URA3-Down fragments, respectively. Then, using the URA3-UP and URA3-Down fragments as templates, PCR was performed using primer pairs URA3-UP-F / URA3-Down-R to obtain URA3 Donor. The primer sequences are as follows:

[0106] URA3-UP-F: tatacctcaatcaaaactgaaattaggcgcctg; SEQ ID NO. 10.

[0107] URA3-UP-R: tgcttgttctcggagaactc cctcctttgattagtttatgggctagctg; SEQ ID NO.11.

[0108] URA3-Down-F: cataaactaatcaaaggagg gagttctccgagaacaagcagaggttc; SEQ ID NO.12.

[0109] URA3-Down-R: ttttaactgtgtatttgatttttttgttctagcaatcgacg; SEQ ID NO. 13.

[0110] Kluyveromyces martensii was knocked out using plasmids 25Y001 and URA3 Donor. KM01 In URA3 Genes were selected, and positive transformants were subjected to colony PCR. Correct strains were then used to remove plasmids using 5-fluoroorotic acid (5-FOA), thus obtaining... URA3 auxotrophic strains ( Figure 2 In this process, the URA3 gene in Kluyveromyces martensii KM01 was knocked out using plasmids 25Y001 and URA3 Donor. The chemical transformation method used is as follows (this is a general transformation method used in this invention and will not be described in detail below):

[0111] 1) Pick a single colony of Kluyveromyces martensii haploid KM01 from the plate and inoculate it into 5 mL of YPD liquid medium. Incubate overnight at 30°C for 12 h.

[0112] 2) Take 1 mL of bacterial solution, centrifuge at 5000 rpm for 1 min, and wash once with sterile water.

[0113] 3) Add 4 μl plasmid 25Y001, 10 μl Donor, 100 μg salmon sperm DNA, and 400 μL transformation mixture. Mix well and incubate at room temperature for 15 min.

[0114] The formulation of the conversion mixture is shown in Table 3.

[0115] Table 3

[0116]

[0117] After preparation, filter through a 0.22 μm filter membrane and store at -20℃ for later use.

[0118] 4) Incubate in a 47℃ water bath for 15 min, then spread the mixture onto YPD solid medium plates containing 100µg / mL G418 and URA auxotrophic medium plates (Beijing Pan-Gino Technology Co., Ltd.), and incubate at 30℃ for 2-3 days. The URA3 auxotrophic strain can only grow on YPD medium and cannot grow on URA auxotrophic medium.

[0119] 5) Further, after step 4), positive strain KmU is screened using specific primers URA3-YZ-F / URA3-YZ-R.

[0120] URA3 gene knockout verification: Randomly selected transformant clones were transferred to 10 µL of sterile water as templates. Colony PCR was performed using primers URA3-YZ-F / URA3-YZ-R to screen for positive strains and verify whether URA3 was successfully knocked out. The PCR band for positive strains was 659 bp; the PCR band for negative strains was 1463 bp.

[0121] The primer sequences are as follows:

[0122] URA3-YZ-F: gaactaaccaccatcgcctgactctatg; SEQ ID NO. 14.

[0123] URA3-YZ-R: gtgtatttgatttttttgttctagcaatcgacggtc; SEQ ID NO. 15.

[0124] The PCR reaction system consisted of 10 µL KOD one polymerase, 8 µL ddH2O, 0.5 µL primer-F, 0.5 µL primer-R, and 1 µL template. The PCR conditions were: 94 ℃ pre-denaturation for 2 min; 98 ℃ denaturation for 10 s, Tm-5 ℃ annealing for 30 s, 68 ℃ extension at 1 kb / 100 s, for 35 cycles (denaturation-extension); and a final extension at 68 ℃ for 5 min. After the reaction, 10 μL of the PCR product was analyzed by 1.5% gel electrophoresis.

[0125] The method for removing plasmids using 5-fluoroorotic acid is as follows:

[0126] (1) Pick a single colony and inoculate it into 5 mL of YPD liquid medium, and incubate at 30℃ and 220 rpm for 12 h.

[0127] (2) Take 10µl of bacterial culture and streak it on a YPD plate containing 5-FOA (0.1g 5-FOA powder + 1mL DMSO dissolved in 100mL YPD solid medium). Incubate at 30℃ until colonies grow, which means the plasmid has been successfully removed.

[0128] His3 knockout: After identifying the gene knockout target on the His3 gene of the KmU strain, the His3-F / His3-R loop PCR clone plasmid pUDP046 (Addgene ID: 107062) was used.

[0129] The primer pair sequences are as follows:

[0130] His3-F:

[0131] gtccgtggtgtgagaagatt GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAG; SEQ ID NO. 16.

[0132] His3-R:

[0133] aatcttctcacaccacggac TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTTCTTGG; SEQ ID NO. 17.

[0134] The construction method is the same as 25Y001, and plasmid 25Y002 is obtained (the original plasmid is pUDP046).

[0135] Obtaining His3 Donor: Using strain KM01 as a template, PCR was performed using primer pairs His3-UP-F / His3-UP-R and His3-Down-F / His3-Down-R to obtain the His3-UP and His3-Down fragments, respectively. Then, using the His3-UP and His3-Down fragments as templates, PCR was performed using primer pairs His3-UP-F / His3-Down-R to obtain His3 Donor. The primer sequences are as follows:

[0136] His3-UP-F: gagaatatttcttcttaaaccactcgtccttatccatg; SEQ ID NO. 18.

[0137] His3-UP-R: gccttgtatggagtagccag tgtctcggtatcaaagtccttatttgaagaccttc; SEQ ID NO.19.

[0138] His3-Down-F: aggactttgataccgagaca ctggctactccatacaaggcg; SEQ ID NO. 20.

[0139] His3-Down-R: cgtaatcctcgtgcattgcagtttgac; SEQ ID NO. 21.

[0140] The His3 gene in *Kluyveromyces martensii* KmU was knocked out using plasmids 25Y002 and His3 Donor, and the transformation method was the same as that for the URA3 gene knockout. Verification was performed using primer pairs His3-YZ-F / His3-YZ-R. The positive strain showed a PCR band of 692 bp; the negative strain showed a PCR band of 1358 bp.

[0141] The primer sequences are as follows:

[0142] His3-YZ-F: attctcaactcatctcatctcatctctatactgcaac; SEQ ID NO. 22.

[0143] His3-YZ-R: catttgtaatcgaagatcctaaggttgaaagcgg; SEQ ID NO. 23.

[0144] Finally, the auxotrophic strain LK02 with the double gene knockout defects of URA3 and HIS3 was obtained (Table 1).

[0145] Example 4: Development of a Strong Promoter

[0146] The pOM45 promoter gene sequence is shown in SEQ ID NO.24.

[0147]

[0148] The gene sequence of the pOM45-13 (pGOM45) promoter is shown in SEQ ID NO.37.

[0149] ctagctctcctccttatatatatatatgtatatgtatgcatgtatgtatggaagtgaatctgactctaagaa tacagtatacgaaaca ; SEQ ID NO.37.

[0150] In SEQ ID NO.37, 201-400bp is the first UAS; 401-600bp is the second UAS.

[0151] In a novel genetic pathway, a strong promoter element is crucial for gene expression. To construct an efficient sterol biosynthesis pathway using LK02 as the chassis, enhanced expression of a series of genes is necessary. Therefore, strong promoters for LK02 were screened and developed. Specifically, based on the principle of strong expression of key genes in the central metabolic pathway, this invention selected the promoter pOM45 (gene sequence shown in SEQ ID NO. 24) encoding the mitochondrial outer membrane protein OM45 gene, the promoter pPGK (gene sequence shown in SEQ ID NO. 25) encoding the phosphoglycerate kinase PGK gene, the promoter pAFT1 (gene sequence shown in SEQ ID NO. 26) encoding the activator of the iron transporter AFT1 gene, and the promoter pINU1 (gene sequence shown in SEQ ID NO. 27) encoding the inulinase INU1 gene. These promoters were used to drive... sfGFP Protein expression was assessed, and the expression intensity of these promoters was determined based on the fluorescence enhancement of sfGFP. The results are as follows: Figure 3 As shown, the expression intensities of these promoters are as follows: pOM45 > pPGK > pAFT1 > pINU1 Therefore, pOM45 was selected for this invention and further modifications were made.

[0152] First, the negative regulation region is verified and determined by segmentally truncating its 3' end, such as... Figure 4 As shown, after deleting the negative control region, the promoter... pOM45-1 , pOM45-2 , pOM45-3 , pOM45-4 , pOM45-5 , pOM45-6 , pOM45-7 The sequences are shown in SEQ ID NO.28-34, respectively. The results show that... pOM45-7 The expression intensity of the promoter was increased by 1.55 times compared to before the modification.

[0153] Then, the negative control region was deleted. pOM45-7 The promoter undergoes 5' end modification. The upstream activation sequence of the promoter ( Upstream Activating Sequence, UASThe promoter pOM45-9 is a key regulatory region in eukaryotic promoters, containing various cis-acting elements (such as transcription factor binding sites and enhancer elements) that affect gene transcription efficiency and specificity. The promoter pOM45-9 was obtained by first truncating the 5' end (400 bp) (gene sequence shown in SEQ ID NO. 35), and then attempts were made to tandem multiple... UAS Elements were used to further enhance the promoter strength. Based on the promoter pOM45-9, it was segmented in 200bp increments and deleted sequentially until the UAS region was identified. This region was identified as the UAS region because deleting this segment caused the promoter to fail (gene sequence shown in SEQ ID NO.36). Using 36 h data as a reference, the modified sequence contained two... UAS The promoter variant (pOM45-13) (gene sequence shown in SEQ ID NO.37) showed a 96.1% increase in intensity compared to pOM45-9; while the variant containing three... UAS The promoter strength (pOM45-14) (gene sequence shown in SEQ ID NO.38) was 13% lower than that of pOM45-13. Figure 5 This indicates a continued increase. UAS It is no longer effective and will have negative effects. Therefore, this invention obtains a modified strong promoter pOM45-13 (named...). pGOM45 ), with the original promoter pOM45 In comparison, the 5' end is first truncated by 200bp, and the 5' end contains two [unclear characters]. UAS (Originally contained 1) UAS On top of that, another one was inserted. ， At the same time, the negative control region at the 3' end was deleted.

[0154] Example 5 Construction of engineered strain Chol03

[0155] Based on chassis LK02, a cholesterol-producing bacterial strain was constructed by modifying the ergosterol synthesis pathway. The overall construction approach is detailed below. Figure 6 .

[0156] First, the gene encoding Δ7-sterol-C5(6)-desaturase, DWF5, and the gene editing DHCR24 for 24-dehydrocholesterol reductase, were expressed in LK02. The specific procedures are as follows:

[0157] 1) First, based on the DWF5 gene (NCBI ID: 101256596) and DHCR24 gene (NCBI ID: 424661) from the NCBI database, primers were synthesized according to the codon preference of Kluyveromyces. The nucleotide sequence of DWF5 after codon optimization is shown in SEQ ID NO. 39; the nucleotide sequence of DHCR24 after codon optimization is shown in SEQ ID NO. 40. Then, primers pGOM45-DWF5-F / tCYC1-DWF5-R for amplifying the target gene DWF5 and pGOM45-DHCR24-F / tINU1-DHCR24-R for amplifying the target gene DHCR24 were designed. The primer sequences are as follows:

[0158] pGOM45-DWF5-F:

[0159] gaatctgactctaagaatacagtatacgaaacaATGGCGGAGTCTCAATTAGTCCACC; SEQ ID NO.41.

[0160] tCYC1-DWF5-R:

[0161] gtaagcgtgacataactaattacatgaTCAGTAAATACCAGGGATTACCCTATACGG; SEQ ID NO.42.

[0162] pGOM45-DHCR24-F:

[0163] gaatctgactctaagaatacagtatacgaaacaATGTCTGCCGTATGGTCATTAGGTG; SEQ ID NO.43.

[0164] tINU1-DHCR24-R:

[0165] gtcgttagtaaagtaagcagatcagaTCAATGTCTAGCCGCCTTGCAAATC; SEQ ID NO. 44.

[0166] Using SEQ ID NO.39 as a template and pGOM45-DWF5-F / tCYC1-DWF5-R as primers, PCR amplification was performed, and the DWF5 gene fragment was recovered by gel electrophoresis. Using SEQ ID NO.40 as a template and pGOM45-DHCR24-F / tINU1-DHCR24-R as primers, PCR amplification was performed, and the DHCR24 gene fragment was recovered by gel electrophoresis.

[0167] 2) Design primers cas-pGOM45-KF / cas-pGOM45-KR for amplifying the promoter pGOM45 (gene sequence shown in SEQ ID NO.37), cas-tCYC1-KF / cas-tCYC1-KR for amplifying the terminator tCYC1 (gene sequence shown in SEQ ID NO.45), and cas-tINU1-KF / cas-tINU1-KR for amplifying the terminator tINU1 (gene sequence shown in SEQ ID NO.46). The primer sequences are as follows:

[0168] cas-pOM45-KF: ctagctctcctccttatatatatatgtatatgtatgcatgtatgtatg; SEQ ID NO. 47.

[0169] cas-pOM45-KR:tgtttcgtatactgtattcttagagtcagattcacttc; SEQ ID NO. 48.

[0170] cas-tCYC1-KF: tcatgtaattagttatgtcacgcttacattcacg; SEQ ID NO. 49.

[0171] cas-tCYC1-KR:gcaaattaaagccttcgagcgtcc; SEQ ID NO. 50.

[0172] cas-tINU1-KF: tctgatctgcttactttactaacgacaaaaaaaaatc; SEQ ID NO. 51.

[0173] cas-tINU1-KR:ggcatatgatggtgttgccgtg; SEQ ID NO. 52.

[0174] Using the previously constructed promoter pGOM45 (SEQ ID NO.37) as a template, PCR amplification was performed using cas-pGOM45-KF / cas-pGOM45-KR primers, and the pGOM45 gene fragment was recovered by gel electrophoresis. Using the *Kluyveromyces martensii* LK02 genome as a template, PCR amplification was performed using cas-tCYC1-KF / cas-tCYC1-KR primers, and the tCYC1 gene fragment was recovered by gel electrophoresis. Using the *Kluyveromyces martensii* LK02 genome as a template, PCR amplification was performed using cas-tINU1-KF / cas-tINU1-KR primers, and the tINU1 gene fragment was recovered by gel electrophoresis.

[0175] 3) Design primers KmADH3-UF / R for amplifying the homologous arm KmADH3-U (sequence shown as 1-793bp in SEQ ID NO. 53); design primers KmADH3-DF / R for amplifying the homologous arm KmADH3-D (sequence shown as 1203-1926bp in SEQ ID NO. 53). Primer sequences are as follows:

[0176] KmADH3-UF: ctttatttttctgGTTTCTCCCCGCC; SEQ ID NO. 54.

[0177] KmADH3-UR:

[0178] acatatatatatataaggaggagagctagGAGCTTCGGACTTGACTGAGCTAAGTTC; SEQ ID NO. 55.

[0179] KmADH3-DF: cacggcaacaccatcatatgccCGAAGGTGCCGGTGTCGTTGTC; SEQ ID NO. 56.

[0180] KmADH3-DR: GAACTCAATGGCTTCTCTGGTG; SEQ ID NO. 57.

[0181] Using the LK02 genome as a template, PCR amplification was performed using KmADH3-UF / R primers, and the KmADH3-U gene fragment was recovered by gel electrophoresis. Using the LK02 genome as a template, PCR amplification was performed using KmADH3-DF / R primers, and the KmADH3-D gene fragment was recovered by gel electrophoresis.

[0182] 4) Using primers KmADH3-UF / pGOM45-tCYC1-R, the following four fragments (KmADH3-U, pGOM45, DWF5, and tCYC1) were fused sequentially using fusion PCR to obtain target fragment 1: KmADH3U-pGOM45-DWF5-tCYC1. Similarly, using primers tCYC1-pGOM45-F / KmADH3-DR, fragments pGOM45, DHCR24, tINU1, and KmADH3-D were fused sequentially to obtain target fragment 2: pGOM45-DHCR24-tINU1-KmADH3D. It was ensured that the overlap region between the two fragments was greater than 40 bp to achieve intracellular self-ligation after fragments 1 and 2 were introduced into yeast cells. The primer sequences are as follows:

[0183] pGOM45-tCYC1-R:

[0184] catatacatatatatatataaggaggagagctaggcaaattaaagccttcgagcgtcc; SEQ ID NO. 58.

[0185] tCYC1-pGOM45-F:

[0186] gggacgctcgaaggctttaatttgcctagctctcctccttatatatatatatatg; SEQ ID NO. 59.

[0187] 5) Construction of gRNA-Cas9 plasmid (Table 2, 25Y003): Designed to target LK02 KmADH3 The gRNA plasmid primer gRNA-KmADH3-F / R was used to amplify the linearized gRNA DNA fragment using pUDP046 as a template, and then transformed into E. coli DH5α competent cells to obtain plasmid 25Y003.

[0188] KmADH3 gene and upstream and downstream homologous arms ( KmADH3 The sequence of the site is shown in SEQ ID NO.53. In SEQ ID NO.53, 1-793bp is the upstream homologous arm sequence of the KmADH3 gene (KmADH3-U), 794-1202bp is the KmADH3 gene sequence, and 1203-1926bp is the downstream homologous arm sequence of the KmADH3 gene (KmADH3-D).

[0189] The primer sequences are as follows:

[0190] gRNA-KmADH3-F: tggtggtaaactagaataca gttttagagctagaaatagcaagttaaaataag; SEQ ID NO. 60. The underlined part is the gRNA target.

[0191] gRNA-KmADH3-R: tgtattctagtttaccacca tttgtttgtttatgtgtgtttattcgaaac; SEQ ID NO. 61. The underlined part is the gRNA target.

[0192] 6) Target fragment 1, target fragment 2, and the targeting gRNA-Cas9 plasmid (Table 2, 25Y003) were transformed into LK02 competent cells using the lithium acetate transformation method. Positive transformants were screened using Ura-auxotrophic plates, and the transformants were confirmed by colony PCR. Verification primers were designed on both sides of the homologous arms, and nucleic acid sequencing was used to confirm whether the gene modification was completed. The successfully modified strain was named Chol01. The verification primer sequences are as follows:

[0193] KmADH3-IDF: CCGGCTGATTGTTTATGGATCCAg; SEQ ID NO. 62.

[0194] KmADH3-IDR: cCCTTATTTTTCAGTGTCGACGACG; SEQ ID NO. 63.

[0195] 7) DWF5 and DHCR24 were knocked into the Ku70 site of strain Chol01 again using the same procedure (the Ku70 site sequence is shown in SEQ ID NO.64; the gRNA-Cas9 plasmid used was 25Y004, Table 2). After verification, the correct clone was named Chol03 (Table 1).

[0196] The Ku70 gene and its upstream and downstream homologous arms (Ku70 site) sequences are shown in SEQ ID NO. 64. In SEQ ID NO. 64, 1-779bp is the upstream homologous arm sequence of the Ku70 gene (Ku70-U), 780-1179bp is the Ku70 gene sequence, and 1180-1848bp is the downstream homologous arm sequence of the Ku70 gene (Ku70-D).

[0197] The primer sequences used are as follows:

[0198] Ku70-UF:CGATCACCCAAAATAGGAACCTTAC; SEQ ID NO. 65.

[0199] Ku70-UR:

[0200] atatatatataaggaggagagctagCAAACTAATTTACGATGAAGTTCCTAGAGCG; SEQ ID NO. 66.

[0201] Ku70-DF:

[0202] cacggcaacaccatcatatgccGGCTGAAAACAATGTCTATGAGTGATACC; SEQ ID NO. 67.

[0203] Ku70-DR: CGGGAGTACGCTTCTTGTTTTG; SEQ ID NO. 68.

[0204] gRNA-Ku70-F: tttaaagagccagttgtcaa gttttagagctagaaatagcaagttaaaataag; SEQ ID NO. 69. The underlined part is the gRNA target.

[0205] gRNA-Ku70-R: ttgacaactggctctttaaa tttgtttgtttatgtgtgtttattcgaaac; SEQ ID NO.70. The underlined part is the gRNA target.

[0206] Ku70-IDF: GCATCCATTGGGGTAGTTATACAGAGAG; SEQ ID NO. 71.

[0207] Ku70-IDR: GGTACCACTTCTCCAGTTTCCGC; SEQ ID NO. 72.

[0208] 8) A single colony of strain Chol03 was picked and transferred to 5 mL of YPD medium. After incubation at 30℃ for 12-18 h, it was transferred to 30 mL of YPD medium at a 1% inoculum size and incubated at 30℃ until the OD600 reached 12.8. After fermentation for 168 h at a 1% inoculum size in 50 mL of YPD medium, the cholesterol yield was 285.68 mg / L, OD600... 600 It is 29.8.

[0209] Example 6 Construction of engineered strain Chol07

[0210] In CholO3, both cholesterol and ergosterol biosynthetic pathways coexist. To enhance cholesterol synthesis, the ergosterol biosynthetic pathway needs to be weakened. This invention employs a strategy of using weak promoters to target key genes in the ergosterol biosynthesis process. ERG6 The promoter is replaced to weaken its expression intensity. Specifically, this is done by using a gene in Chol03. ERG7 promoter ( pERG7 (Gene sequence as shown in SEQ ID NO.73) Replacement ERG6 promoter ( pERG6 The gene sequence is shown in SEQ ID NO.74, resulting in the engineered strain Chol07. The specific procedures are the same as for engineered strain Chol03, the difference being the target organism and the primers used, as detailed below:

[0211] Using Chol03 engineered bacteria as the chassis strain, targeting ERG6 The promoter region was amplified using primers pERG6-UF and pERG6-UR for the upstream homologous arm and pERG6-DF and pERG6-DR for the downstream homologous arm. Both the upstream and downstream homologous arms were obtained from the LK02 genome via PCR amplification. ERG7Promoter amplification was performed using pERG7-F and pERG7-R primers; the gRNACas plasmid used was CYH01 (Table 2). After transformation into Chol03, primers pERG6-IDF and pERG7-IDR were used.

[0212] Clones with correct promoter replacements were selected and named Chol07 (Table 1).

[0213] pERG6-UF: GAAGGTCGGGCGGTGTCTGGT; SEQ ID NO. 75.

[0214] pERG6-UR: CTAactatttctttttttttttggtttaattttcttgtttaatTTTCCG; SEQ ID NO. 76.

[0215] pERG6-DF:

[0216] caattgaaaagaagaaatactCATAATCAATGTCCGAAGACCAAGAATTGAGAAAG; SEQ ID NO.77.

[0217] pERG6-DR: AACGGCAAATGTTCCACCTGGTTT; SEQ ID NO. 78.

[0218] pERG7-F:

[0219] caaaaaaaaaagaaatagtTAG TGGAACGAGAGAGTATGTTATGAAATTTTCTCTCTAC ; SEQ ID NO.79.

[0220] pERG7-R: TGATTATGagtatttcttcttttcaattgaGCTGCAG; SEQ ID NO. 80.

[0221] gRNA-pERG6-F:

[0222] TACTACACTAGACTAGAGGT gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO. 81. The underlined part is the gRNA target.

[0223] gRNA-pERG6-R:

[0224] ACCTCTAGTCTAGTGTAGTA tttgtttgtttatgtgtgtgtttattcgaaactaagttc;SEQ ID NO.82. The underlined part is the gRNA target.

[0225] pERG6-IDF:GAGCTGGCTCGCTTGCTACTGCTA; SEQ ID NO. 83.

[0226] pERG7-IDR:CTTGTTTTGGGGAAATCACTACCTTGTCTGT; SEQ ID NO.84.

[0227] A single colony of strain Chol07 was picked and transferred to 5 mL of YPD medium. After incubation at 30°C for 12–18 h, it was inoculated into 30 mL of YPD medium at a 1% inoculum size and incubated at 30°C until the OD600 reached 13.4. When fermented for 168 h at a 1% inoculum size in 50 mL of YPD medium, the cholesterol yield was 378.31 mg / L, and the OD600 was [not specified in the original text]. 600 It is 31.2.

[0228] Example 7 Construction of engineered strain Chol16

[0229] To further increase cholesterol synthesis, using the engineered strain Chol07 as the starting strain, key genes in the post-squalene sterol synthesis pathway of the sterol synthesis pathway were extracted. ERG1 (The sequence is shown in SEQ ID NO.85) ERG11 (The sequence is shown in SEQ ID NO.86) ERG26 (The sequence is shown in SEQ ID NO.87) ERG27 (The sequence is shown in SEQ ID NO.88) ERG2 (The sequence is shown in SEQ ID NO.89) and ERG3 (The sequence is shown in SEQ ID NO. 90), and the sequences are iteratively knocked into Kluyveromyces martensii in pairs. NS1 , NS2 , NS3 The sites (sequences are shown in SEQ ID NO.91-93) were used to obtain the engineered strain Chol16.

[0230] The NS1 site sequence is shown in SEQ ID NO.91. In SEQ ID NO.91, 1-812bp is the upstream homologous arm sequence of NS1 (NS1-U), 813-1098bp is the NS1 site knockout sequence, and 1099-1905bp is the downstream homologous arm sequence of NS1 (NS1-D).

[0231] The NS2 site sequence is shown in SEQ ID NO.92. In SEQ ID NO.92, 1-895bp is the upstream homologous arm sequence of NS2 (NS2-U), 896-1370bp is the NS2 site knockout sequence, and 1371-2244bp is the downstream homologous arm sequence of NS2 (NS2-D).

[0232] The NS3 site sequence is shown in SEQ ID NO.93. In SEQ ID NO.93, 1-916bp is the upstream homologous arm sequence of NS3 (NS3-U), 917-1539bp is the NS3 site knockout sequence, and 1540-2389bp is the downstream homologous arm sequence of NS3 (NS3-D).

[0233] The specific operation is the same as that of engineered bacteria Chol03, the difference being the object being modified and the primers and terminators used, as detailed below:

[0234] Using Chol07 engineered bacteria as the chassis strain and its genome as a template, the strain was amplified by PCR using primers NS1-UF / NS1-UR and NS1-DF / NS1-DR to obtain... NS1 The upstream and downstream homologous arms NS1-U / NS1-D of the site were obtained; the terminator tADH3 (gene sequence shown in SEQ ID NO. 94) was amplified by PCR using primers cas-tADH3-F / R; the genes ERG1 and ERG11 were amplified by PCR using primers pGOM45-ERG1-F / tCYC1-ERG1-R and pGOM45-ERG11-F / tADH3-ERG11-R, and the integration frames NS1U-pGOM45-ERG1-tCYC1 and pGOM45-ERG11-tADH3-NS1D were constructed, and then knocked into the NS1 site (the gRNA-Cas9 plasmid used was CYH02, Table 2) to obtain strain Chol13. The primer sequences used are as follows:

[0235] NS1-UF: CCATATCAAGGCATAGCAACAACAGTC ;SEQ ID NO.95.

[0236] NS1-UR: catatatatatataaggaggagagctag CTAGAGGCCAGAGCCATATTTTCCCTACG ;SEQ ID NO.96.

[0237] NS1-DF:

[0238] gaTTATTACATGCGAATGCCTATTCTTTGTT GCGCGAACTGTTTCCGTACACTGAAT ;SEQ ID NO.97.

[0239] NS1-DR: cacCAACTTATTCCCTTCGAAAGCC SEQ ID NO.98.

[0240] cas-tADH3-F: ACGAAGCTCAGTCCAACTAAGCTATG SEQ ID NO.99.

[0241] cas-tADH3-R: AACAAGAATAGGCATTCGCATGTAATAAtcataac SEQ ID NO.

[0242] pGOM45-ERG1-F:

[0243] ctgactctaagaacagtatacgaaaca ATGAGCAGCGCTACTGATAAAAAAGTTG SEQ IDNO.101.

[0244] tCYC1-ERG1-R:

[0245] gtaagcgtgacataactatacatga TCAACCAGTCAATTCCCTGAATAGATAAGGTG SEQ IDNO.102.

[0246] pGOM45-ERG11-F:

[0247] ctgactctaagaacagtatacgaaaca ATGTCTACGTCTGAATCGTTTGTTGGTAAG SEQ IDNO.103.

[0248] tADH3-ERG11-R:

[0249] CATAGCTTAGTTGGACTGAGCTTCGT TTACTTCCTCAAAGTCCACTCAATTTCACC SEQ IDNO.104.

[0250] gRNA-NS1-F:

[0251] TCTCGGCTTAGAGATCTGTG gttttagagctagaaatagcaagttaaaataaggctag: SEQ IDNO.105.

[0252] gRNA-NS1-R:

[0253] CACAGATCTCTAAGCCGAGA tttgtttgtttatgtgtgtttattcgaaactaagttc:SEQ IDNO.106.

[0254] NS1-IDF:GGGCTTTGATTTTGACCTTCAAAACTC:SEQ ID NO.

[0255] NS1-IDR: CAGGCTCTTTATAGCGACCATAGCC; SEQ ID NO. 108.

[0256] Following the same procedure, ERG26 and ERG27 were knocked into the NS2 site of strain Chol13 (the gRNA-Cas9 plasmid used was CYH03, Table 2) to obtain strain Chol14. The primer sequences used are as follows:

[0257] NS2-UF: GGAGATGATGCAAAAGCCGGATCTATATG ; SEQ ID NO.109.

[0258] NS2-UR:

[0259] catatatatatataaggaggagagctag GTTTCAGTTCCTTTCGGACAGAGATTCCT ;SEQ ID NO.110.

[0260] NS2-DF:

[0261] gaTTATTACATGCGAATGCCTATTCTTTGTT GATTCAAAAAGCCCAGGCAGGATAACTG ;SEQ ID NO.111.

[0262] NS2-DR: CCATCCCTCGTTCACTCCTTTAttack ; SEQ ID NO.112.

[0263] pGOM45-ERG26-F:

[0264] ctgactctaagaatacagtatacgaaaca ATGAGTACCCCGGAAATTAAATCTGTGC ; SEQ ID NO.113.

[0265] tCYC1-ERG26-R:

[0266] cgtgacataactaattacatga TTATAATCTTCATCCATCCACGCTAATGTTCTTTTG ;SEQ ID NO.114.

[0267] pGOM45-ERG27-F:

[0268] gactctaagaatacagtatacgaaaca ATGCCATCTTCTAAAATTGCTGTTATTACCG ;SEQ ID NO.115.

[0269] tADH3-ERG27-R:

[0270] CATAGCTTAGTTGGACTGAGCTTCGT CTATAGTGCCGCTCTAGTTGGCTTG; SEQ ID NO.116.

[0271] gRNA-NS2-F:

[0272] AGGATGTTCGATATAGACGA gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO. 117. The underlined part is the gRNA target.

[0273] gRNA-NS2-R:

[0274] TCGTCTATATCGAACATCCT tttgtttgtttatgtgtgtgtttattcgaaactaagttc;SEQ ID NO.118. The underlined part is the gRNA target.

[0275] NS2-IDF: GGCAATTTCCTGTCCCGGGC; SEQ ID NO. 119.

[0276] NS2-IDR: CCTCTCTACTTGCTCTCAAGCC; SEQ ID NO. 120.

[0277] Following the same procedure, ERG2 and ERG3 were knocked into the NS3 site of strain Chol14 (the gRNA-Cas9 plasmid used was CYH04, Table 2). After verification, the correct clone was named Chol16. The primer sequences used are as follows:

[0278] NS3-UF: GTTGCTCAATTTAAGGTCACTCATTTCATG ; SEQ ID NO.121.

[0279] NS3-UR: catatacatatatatatatataaggaggagagctag GTGGCAGCCCAAGGATGAGTGG ;SEQ ID NO.122.

[0280] NS3-DF:gaTTATTACATGCGAATGCCTATTCTTTGTT AaccttctctttggcGGTGGTGA ;SEQ ID NO.123.

[0281] NS3-DR: GATAGGAATCTTAGAGATTCGATTTCTTTACCTTGTC ; SEQ ID NO.124.

[0282] pGOM45-ERG2-F:gactctaagaatacagtatacgaaaca ATGAAATTGCTGAAGTTAGGCTTGTTC TTTG ; SEQ ID NO.125.

[0283] tCYC1-ERG2-R:gtaagcgtgacataactaattacatga TCAGAACTTAGCGTTTTGAACTAGGTTT TTG ; SEQ ID NO.126.

[0284] pGOM45-ERG3-F: ctaagaatacagtatacgaaaca ATGGATTTATTGCTAGAATACTGTGATACAT TTGG ; SEQ ID NO.127.

[0285] tADH3-ERG3-R:CATAGCTTAGTTGGACTGAGCTTCGT TTAACAAGACTTGGTACTGACGTACACTC ; SEQ ID NO.128.

[0286] gRNA-NS3-F: ACGTTTGCAGAGGATCTGCG gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.129. The underlined part is the gRNA target.

[0287] gRNA-NS3-R: CGCAGATCCTCTGCAAACGT tttgtttgtttatgtgtgtgtttattcgaaactaagttc;SEQ ID NO.130. The underlined part is the gRNA target.

[0288] NS3-IDF: CGTCAGAGTTGGCAAATGTCTTTTC; SEQ ID NO. 131.

[0289] NS3-IDR: GTTTGATCCGGTAGCACACGG; SEQ ID NO. 132.

[0290] Single colonies of strain Chol16 were picked and transferred to 5 mL of YPD medium and incubated at 30°C for 12–18 h. Then, a 1% inoculum was transferred to 30 mL of YPD medium and incubated at 30°C until the OD600 reached 10.8. When the 1% inoculum was transferred to 50 mL of YPD medium and fermented for 168 h, the cholesterol yield was 503.47 mg / L, and the OD600 was 26.9.

[0291] Example 8 Construction of engineered strain Chol41

[0292] After enhancing the sterol synthesis pathway, to further enhance cholesterol synthesis, it is necessary to strengthen its upstream mevalonate pathway (prosqualene pathway) to increase the supply of precursors required for cholesterol synthesis. Using the engineered strain Chol16 as the starting strain, key genes of the upstream mevalonate pathway of the sterol synthesis pathway were... ERG20 (The sequence is shown in SEQ ID NO.133) HMG1 (The sequence is shown in SEQ ID NO.134) IDI1 (The sequence is shown in SEQ ID NO.135) ERG8 (The sequence is shown in SEQ ID NO. 136) ERG10 (The sequence is shown in SEQ ID NO.137) and ERG12 (Sequence shown in SEQ ID NO. 138), the peroxisome localization signal peptide ePTS1 sequence (as shown in SEQ ID NO. 139) was sequentially added through primers and then combined in pairs, and then knocked into *Kluyveromyces martensii*. GRE3 , DPP1 and OPI1 Integration site (sequence shown in SEQ ID NO.140-142) yielded the peroxisome engineered strain Chol41.

[0293] The GRE3 sequence is shown in SEQ ID NO.140. In SEQ ID NO.140, 1-716bp is the upstream homologous arm sequence of GRE3 (GRE3-U), 717-1070bp is the GRE3 gene knockout sequence, and 1071-2003bp is the downstream homologous arm sequence of GRE3 (GRE3-D).

[0294] The DPP1 sequence is shown in SEQ ID NO.141. In SEQ ID NO.93, 1-799bp is the upstream homologous arm sequence of DPP1 (DPP1-U), 800-1200bp is the DPP1 gene knockout sequence, and 1201-2002bp is the downstream homologous arm sequence of DPP1 (DPP1-D).

[0295] The OPI1 sequence is shown in SEQ ID NO.142. In SEQ ID NO.93, 1-686bp is the upstream homologous arm sequence of OPI1 (OPI1-U), 687-1064bp is the OPI1 gene knockout sequence, and 1065-1845bp is the downstream homologous arm sequence of OPI1 (OPI1-D).

[0296] The specific procedures are the same as those for engineered bacteria Chol03, the difference being the object being modified and the primers used (Table 5), as detailed below:

[0297] Using Chol16 engineered bacteria as the chassis strain and its genome as a template, the strain was amplified by PCR using primers GRE3-UF / GRE3-UR and GRE3-DF / GRE3-DR to obtain... GRE3The upstream and downstream homologous arms of the site, GRE3-U / GRE3-D, were obtained. Genes ERG20 and HMG1 were amplified by PCR using primers pGOM45-ERG20-F / ePTS1-ERG20-R and pGOM45-HMG1-F / ePTS1-HMG1-R. The integration frames GRE3U-pGOM45-ERG20-ePTS1-tCYC1 and pGOM45-HMG1-ePTS1-tINU1-GRE3D were then constructed and knocked into the site. GRE3 Sites (the gRNA-Cas9 plasmid used was CYH05, Table 2). Specifically, the genome of *Kluyveromyces martensii* was amplified using primers ePTS1-tCYC1-F / cas-tCYC1-KR and ePTS1-tINU1-F / cas-tINU1-KR to obtain terminators tCYC1 and tINU1 carrying peroxisome-targeting signal peptides. The resulting engineered strain was named Chol21.

[0298] GRE3-UF: CCCATATCAAACCCATATCAACCG ; SEQ ID NO.143.

[0299] GRE3-UR:acatatatatataagggaggagagctag CCCAAAGATTTGATCAAACCTTCGTCG ;SEQ ID NO.144.

[0300] GRE3-DF:gaatttcacggcaacaccatcatatgcc GAAGATCGAAGAGACCTTTACCTTGTCC ;SEQ ID NO.145.

[0301] GRE3-DR: GGCTTGCTGGACAAGTCCAC ; SEQ ID NO.146.

[0302] pGOM45-ERG20-F:actctaagaatacagtatacgaaaca ATGAGTGACAACAGAACGAAGTTTTTG ; SEQ ID NO.147.

[0303] ePTS1-ERG20-R: atgaCTAcaatttggatcttctacctcttcccaa CTTCTTTCTGTGGTAgatct tgttc ; SEQ ID NO.148.

[0304] pGOM45-HMG1-F:tctgactctaagaatacagtatacgaaaca atgcctgtactttcaaacagttt Aug ; SEQ ID NO.149.

[0305] ePTS1-HMG1-R: cagattacaatttggatcttctacctcttcccaa cgatttgatgcaaatcactga accc ; SEQ ID NO.150.

[0306] ePTS1-tCYC1-F:ttgggaagaggtagaagatccaaattgTAG tcatgtaattagttatgtcacgct tac ; SEQ ID NO.151.

[0307] ePTS1-tINU1-F:ttgggaagaggtagaagatccaaattgtaa tctgatctgcttactttactaacg acaa ; SEQ ID NO.152.

[0308] gRNA-GRE3-F: TAGTGGGCCGAAACTGGAGT gttttagagctagaaatagcaagttaaaataag; SEQ ID NO.153. The underlined part is the gRNA target.

[0309] gRNA-GRE3-R: ACTCCAGTTTCGGCCCACTA tttgtttgtttatgtgtgtttattcgaaac; SEQ ID NO. 154. The underlined portion indicates the gRNA target.

[0310] GRE3-IDF: GACTTTGTCTCCAAGGGCGTGC; SEQ ID NO. 155.

[0311] GRE3-IDR: GGCACCGGTAGCCAAGATAATGG; SEQ ID NO. 156.

[0312] Repeat the same operation to... IDI1 and ERG8 knock-in strain Chol21 DPP1 The site (the gRNA-Cas9 plasmid used was CYH06, Table 2) was used to obtain strain Chol30.

[0313] DPP1-UF: GGCTTAATTCGATGGCTTGGTG ; SEQ ID NO.157.

[0314] DPP1-UR:acatatatatatataaggaggagagctag CCGGCTGTCAAAGTTGTGAG ; SEQ ID NO.158.

[0315] DPP1-DF:gaatttcacggcaacaccatcatatgcc TAGCTTCTGTGATCAGCCCTTTCTAC ; SEQ ID NO.159.

[0316] DPP1-DR: CCTTTACTAAAGGTTTGCAACAAC ; SEQ ID NO.160.

[0317] pOM45-IDI1-F:tctgactctaagaatacagtatacgaaaca atgtctacggagacgtcaacttac ; SEQ ID NO.161.

[0318] ePTS1-IDI1-R: CTacaatttggatcttctacctcttcccaa caacattcttatggatttcagtatca tttt ; SEQ ID NO.162.

[0319] pOM45-ERG8-F:tctgactctaagaatacagtatacgaaaca ATGTTGCAGGAACATATAAGGGCCT ; SEQ ID NO.163.

[0320] ePTS1-ERG8-R: CTAcaatttggatcttctacctcttcccaa TCTTAAGTTCAAAATATTGGC TT ; SEQ ID NO.164.

[0321] gRNA-DPP1-F: GGTTTTAGAAGTTTCCCAAG gttttagagctagaaatagcaagttaaaataag; SEQ ID NO.165. The underlined part is the gRNA target.

[0322] gRNA-DPP1-R: CTTGGGAAACTTCTAAAACC tttgtttgtttatgtgtgtttattcgaaac; SEQ ID NO. 166. The underlined portion indicates the gRNA target.

[0323] DPP1-IDF: GGCAGAAAACCGTTCTAGAAAGTCTG; SEQ ID NO. 167.

[0324] DPP1-IDR: GGGGGGGAAATACCAAGGATTTGG; SEQ ID NO. 168.

[0325] Repeat the same operation to... ERG10 and ERG12 Knock-in strain Chol30 OPI1The site (the gRNA-Cas9 plasmid used was CYH07, Table 2) was used to construct and obtain a clone that was verified to have correct recombination, which was named strain Chol41 (Table 1).

[0326] OPI1-UF: CTCGTCCCAATGTCCGAATCTC; SEQ ID NO. 169.

[0327] OPI1-UR: atatatataaggaggagagctag CCCGGCTCATAAGTTTAGGATGACT ;SEQ ID NO.170.

[0328] OPI1-DF:gaatttcacggcaacaccatcatatgcc GGCATAAACCGTTGCCCGCATCTGG ;SEQ ID NO.171.

[0329] OPI1-DR: GTCAGCACAGTACTTCTAATAAGTCTTC ; SEQ ID NO.172.

[0330] pOM45-ERG10-F:tctgactctaagaatacagtatacgaaaca atgagtgacaacgtatacattgtt gc ; SEQ ID NO.173.

[0331] ePTS1-ERG10-R:ttacaatttggatcttctacctcttcccaa aactctttcaataacaatagaaga cat ;SEQ ID NO.174.

[0332] pOM45-ERG12-F:tctgactctaagaatacagtatacgaaaca ATGACTGTATTGTCTGCTGTTCCC AC ; SEQ ID NO.175.

[0333] ePTS1-ERG12-R: TCAcaatttggatcttctacctcttcccaa ACTGATCCACTTTAATTCCGAGT CG ; SEQ ID NO.176.

[0334] gRNA-OPI1-F: CTGATATTGAGGAATCACAT gttttagagctagaaatagcaagttaaaataag; SEQ ID NO.177. The underlined part is the gRNA target.

[0335] gRNA-OPI1-R: ATGTGATTCCTCAATATCAGtttgtttgtttatgtgtgtttattcgaaac; SEQ ID NO. 178. The underlined part is the gRNA target.

[0336] OPI1-IDF: CCAACAACAGCACATCAAGCATCCTG; SEQ ID NO. 179.

[0337] OPI1-IDR: GGTTGAAGATGCTCCAAATGTTGTCC; SEQ ID NO. 180.

[0338] A single colony of strain Chol41 was picked and transferred to 5 mL of YPD medium. After incubation at 30°C for 12-18 h, it was transferred to 30 mL of YPD medium at a 1% inoculum and incubated at 30°C until the OD600 reached 11.3. When the OD600 was 27.4 after fermentation in 50 mL of YPD medium at a 1% inoculum for 168 h, the cholesterol yield was 745.59 mg / L.

[0339] Example 9 Construction of engineered strain Chol55

[0340] Since oxygen supply levels regulate sterol synthesis, to counteract this regulation and enhance the negative regulation of sterol synthesis by engineered bacteria under constantly changing oxygen supply levels during high-density industrial fermentation, this study further targeted the gene encoding the hypoxia gene repressor Rox1, building upon the Chol41 model. ROX1 Knockout was performed to obtain the engineered strain Chol55. The specific operation was the same as that for engineered strain Chol03, the difference being the target gene and the primers used. The sequence of ROX1 is shown in SEQ ID NO.181. In SEQ ID NO.181, 1-777bp is the upstream homologous arm sequence of ROX1 (ROX1-U), 778-1113bp is the ROX1 gene knockout sequence, and 1114-1964bp is the downstream homologous arm sequence of ROX1 (ROX1-D).

[0341] Specifically as follows:

[0342] Using Chol41 as the base and its genome as a template, the genome was amplified by PCR using primers ROX1-UF / ROX1-UR and ROX1-DF / ROX1-DR to obtain... ROX1 The upstream and downstream homologous arms of the gene, ROX1-U / ROX1-D, were fused into a single fragment by fusion PCR to obtain the target fragment ROX1-UD for transformation. This fragment was then introduced into Chol41 for recombination (the gRNA-Cas9 plasmid used was CYH08, Table 2). After screening and verification, the correct clone was obtained and named strain Chol55 (Table 1).

[0343] ROX1-UF: CCCCCTCCCCATTTAGtcc ; SEQ ID NO.182.

[0344] ROX1-UR: ACAGCAGCATATTCCCAGACCT ; SEQ ID NO.183.

[0345] ROX1-DF:AGGTCTGGGAATATGCTGCTGT CCAGGCATAATACCCAGGTTGTA ; SEQ ID NO.184.

[0346] ROX1-DR: GTTTGGCCGTTTTCTACTGAGTTAC ; SEQ ID NO.185.

[0347] gRNA-ROX1-F: TATTATGTTCCTACACAAGG gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.186. The underlined part is the gRNA target.

[0348] gRNA-ROX1-R: CCTTGTGTTAGAACATAATA tttgtttgtttatgtgtgtgtttattcgaaactaagttc;SEQ ID NO.187. The underlined part is the gRNA target.

[0349] ROX1-IDF: GGGGGAGACGATGCTGGAACTG; SEQ ID NO. 188.

[0350] ROX1-IDR: CATACGCACCGCAGAAAATGTAAGGTAAAG; SEQ ID NO. 189.

[0351] A single colony of strain Chol55 was picked and transferred to 5 mL of YPD medium. After incubation at 30°C for 12–18 h, it was transferred to 30 mL of YPD medium at a 1% inoculum and incubated at 30°C until the OD600 reached 11.9. When fermented for 168 h at a 1% inoculum in 50 mL of YPD medium, the cholesterol yield was 833.97 mg / L and the OD600 was 27.6.

[0352] Example 10 Construction of engineered strain Chol82

[0353] Using Chol55 as the starting strain, the NADPH supply gene was... UGA2 (Sequence shown in SEQ ID NO.190) and NADH oxidase NOX(Sequence shown in SEQ ID NO.191) Knock-in strain Chol55 NS8 The site (sequence shown in SEQ ID NO.192) was used to balance the NADPH supply requirement during cholesterol synthesis, resulting in the engineered bacterium Chol82.

[0354] The NS8 site sequence is shown in SEQ ID NO.192. In SEQ ID NO.192, 1-700bp is the upstream homologous arm sequence of the NS8 site (NS8-U), 701-1201bp is the NS8 site knockout sequence, and 1202-1936bp is the downstream homologous arm sequence of the NS8 site (NS8-D).

[0355] The specific procedures are the same as those for engineered bacteria Chol03, the difference being the object being modified and the primers used, as detailed below:

[0356] Using Chol55 as the chassis strain and its genome as a template, the strain was amplified by PCR using primers NS8-UF / NS8-UR; NS8-DF / NS8-DR; pGOM45-UGA2-F / tCYC1-UGA2-R. NS8 Upstream and downstream homologous arms of the site NS8-U / NS8-D and the gene UGA2 Using the synthesized NOX (SEQ ID NO. 191) as a template, the NOX gene was amplified by PCR using primers pGOM45-NOX-F / tADH3-NOX-R. NS8U-pGOM45-UGA2-tCYC1 and pGOM45-NOX-tADH3-NS8D were constructed, with the gRNA-Cas9 plasmid CYH09 used (Table 2). The plasmids were introduced into Chol55, and the correct recombinant clones were screened and verified, and named strain Chol82.

[0357] NS8-UF: GATTTAGGACGGGTGCACTCCGAAAAA ; SEQ ID NO.193.

[0358] NS8-UR: catatacatatatatatatataaggaggagagctag GCGGGATTATGTAGGCAAGGAACG ;SEQ ID NO.194.

[0359] NS8-DF:gaTTATTACATGCGAATGCCTATTCTTTGTT CAGATTTCCAATAGTGAGGGGCGTAA ;SEQ ID NO.195.

[0360] NS8-DR: TGCAAGCGCAACAATTGTCACATTC ; SEQ ID NO.196.

[0361] pGOM45-UGA2-F:ctgactctaagaatacagtatacgaaaca ATGGTAGGTAGTGTAAAGGAAGTTA CTCCG ; SEQ ID NO.197.

[0362] tCYC1-UGA2-R:gcgtgacataactaattacatga TTATAATGGAGATGGTAGGTTTCCAATAGTGA TCG ; SEQ ID NO.198.

[0363] pGOM45-NOX-F:gaatctgactctaagaatacagtatacgaaaca ATGTCTAAGATCGTTGTCGTTG GTG ; SEQ ID NO.199.

[0364] tADH3-NOX-R:CATAGCTTAGTTGGACTGAGCTTCGT TCATTTCTCAGCAGTCAATGCAGC ;SEQ ID NO.200.

[0365] gRNA-NS8-F: GAGCGCCAATGTATGAACGG gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.201. The underlined part is the gRNA target.

[0366] gRNA-NS8-R: CCGTTCATACATTGGCGCTCtttgtttgtttatgtgtgtgtttattcgaaactaagttc; SEQ ID NO.202. The underlined part is the gRNA target site.

[0367] NS8-IDF: GCATGCCACATATTCACGGTGTG; SEQ ID NO. 203.

[0368] NS8-IDR: GGTAAGTAGTCAGGTACGATGATCCC; SEQ ID NO. 204.

[0369] Single colonies of strain Chol82 were picked and transferred to 5 mL of YPD medium and incubated at 30°C for 12–18 h. Then, a 1% inoculum was transferred to 30 mL of YPD medium and incubated at 30°C until the OD600 reached 10.7. When fermented for 168 h at a 1% inoculum in 50 mL of YPD medium, the cholesterol yield was 1064.11 mg / L, and the OD600 was 26.9.

[0370] Example 11 Construction of engineered strain Chol99

[0371] In microbial cells such as yeast, sterols often exist in both esterified and free forms. To achieve excessive cholesterol synthesis, it is necessary to regulate esterification-related genes to optimize both esterified and free cholesterol forms. Therefore, this invention uses Chol82 as the starting strain and sequentially knocks out its triglyceride hydrolase encoding genes. TGL3 and the regulatory subunit of phosphatidylphosphatase NEM1 The engineered strain Chol99 was obtained. The specific procedures are the same as for engineered strain Chol03, the difference being the target organism and the primers used, as detailed below:

[0372] Using Chol82 as the chassis strain and its genome as a template, the strain was amplified by PCR using primers TGL3-UF / TGL3-UR and TGL3-DF / TGL3-DR to obtain... TGL3 The upstream and downstream homologous arms of the site, TGL3-U / TGL3-D, were fused into a single fragment using fusion PCR to obtain the transformed target fragment TGL3-UD, which was then targeted using the gRNA-Cas9 plasmid (CYH10, Table 2). TGL3 Knockout gene at the site (sequence shown in SEQ ID NO.205) TGL3 We obtained strain Chol87; and then used the same procedure to target the genome of strain Chol87. NEM1 Site (sequence shown in SEQ ID NO.206) knockout NEM1 Genes (the gRNA-Cas9 plasmid used was CYH11, Table 2); after screening and verification, the correct clone was named strain Chol99 (Table 1).

[0373] The TGL3 sequence is shown in SEQ ID NO.205. In SEQ ID NO.205, 1-733bp is the upstream homologous arm sequence of TGL3 (TGL3-U), 734-1198bp is the TGL3 gene knockout sequence, and 1199-2371bp is the downstream homologous arm sequence of TGL3 (TGL3-D).

[0374] The NEM1 sequence is shown in SEQ ID NO.206. In SEQ ID NO.206, 1-720bp is the upstream homologous arm sequence of NEM1 (NEM1-U), 721-1150bp is the NEM1 gene knockout sequence, and 1151-2058bp is the downstream homologous arm sequence of NEM1 (NEM1-D).

[0375] The primer sequences used are as follows:

[0376] TGL3-UF: GGTAAAACAGGCAAGGCAGGTGAAAC ; SEQ ID NO.207.

[0377] TGL3-UR: TCCCGTTGATGATATTGGGCAGGAG ; SEQ ID NO.208.

[0378] TGL3-DF: CTCCTGCCCAATATCATCAACGGGA ACAGAAACGAGCCCTGCTACCAAAACTTA ;SEQ ID NO.209.

[0379] TGL3-DR: TGCCGCTAGCGGAGGATATAGTGAGTAAA ;SEQ ID NO.210.

[0380] gRNA-TGL3-F: GTTACGTAATTCAACAACGT gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.211. The underlined part is the gRNA target.

[0381] gRNA-TGL3-R: ACGTTGTTGAATTACGTAAC tttgtttgtttatgtgtgtgtttattcgaaactaagttc;SEQ ID NO.212. The underlined part is the gRNA target.

[0382] TGL3-IDF: TAATCTATTTTCCGCCccattttcaacatt; SEQ ID NO. 213.

[0383] TGL3-IDR:GGGTCTTTTTGGCCCTGGAGTGG; SEQ ID NO. 214.

[0384] NEM1-UF: AGGACCCATGGGCCTCATAGAAACTC ; SEQ ID NO.215.

[0385] NEM1-UR: GACCGCTCAGACCACAACTGTAAGGT ; SEQ ID NO.216.

[0386] NEM1-DF: CCTTACAGTTGTGGTCTGAGCGGTC GATGAAACCTAAGCCGATATCTGAGACACT ;SEQ ID NO.217.

[0387] NEM1-DR: gaaaagaagcgaagggaagagaagagaata ; SEQ ID NO.218.

[0388] gRNA-NEM1-F: ATTGAAAGGAGATATGAACA gttttagagctagaaatagcaagttaaaataaggctag; SEQ ID NO.219. The underlined part is the gRNA target.

[0389] gRNA-NEM1-R:TGTTCATATCTCCTTTCAAT tttgtttgtttatgtgtgtttattcgaaactaagttc;SEQ ID NO.220. The underlined part is the gRNA target.

[0390] NEM1-IDF: CCCATATTCCTGTACCAGTCTAGTGC; SEQ ID NO. 221.

[0391] NEM1-IDR: CGTCCAAGAGGGGTACTGCC; SEQ ID NO. 222.

[0392] Single colonies of strain Chol99 were picked and transferred to 5 mL of YPD medium and incubated at 30°C for 12–18 h. Then, a 1% inoculum was transferred to 30 mL of YPD medium and incubated at 30°C until the OD600 reached 10.8. When fermented for 168 h in 50 mL of YPD medium with a 1% inoculum, the cholesterol yield was 1227.91 mg / L, and the OD600 was 27.1.

[0393] Example 12 Fed-batch fermentation of engineered strains

[0394] The aforementioned cholesterol-engineered strain was used for industrial production via fed-batch fermentation. The substrate consisted of: 20 g / L glucose, 20 g / L yeast extract, 15 g / L corn steep liquor, 3.5 g / L magnesium sulfate, 5 g / L potassium dihydrogen phosphate, and 5 ml of trace elements (4 g / L calcium chloride, 5 g / L ferrous sulfate, 0.5 g / L sodium molybdate, 0.6 g / L cobalt chloride, 0.5 g / L manganese chloride, 0.5 g / L copper sulfate, 10 g / L zinc sulfate, and 15 g / L sodium dodecyl sulfate). The carbon source in the feed was 500 g / L glucose, and the nitrogen sources were 50 g / L yeast extract and 50 g / L corn steep liquor. The carbon source replenishment scheme was initiated after the initial sugar was depleted and dissolved oxygen (DO) rebounded. The initial flow rate was 1 g / L / h of glucose, which was controlled at approximately 5 g / L during the logarithmic growth phase. Nitrogen and carbon sources were added simultaneously, with the nitrogen flow rate precisely calculated based on the carbon flow rate, and added internally at a C / N molar ratio of 8. The pH was maintained at a constant 5.5 ± 0.5 by adding ammonia, and the growth temperature was 42 ± 2℃. DO was controlled to >20% in the early and mid-stages by adjusting agitation and aeration. If this could not be controlled, the aeration rate was maintained at 1.5 VVM and the agitation speed at 180 rpm until fermentation ended.

[0395] All cholesterol-producing strains constructed in this invention can be fermented under the above-mentioned fed-batch conditions, with strain Chol99 exhibiting the highest yield. Under the aforementioned conditions, in a 2-ton fermenter, Chol99 achieved a cholesterol yield of 7.64 g / L after 156 h, with a production efficiency of approximately 0.05 g / L / h (Table 4 and...). Figure 7 ).

[0396] Table 4

[0397]

[0398] Compared to existing cholesterol production methods and reports on microbial cholesterol synthesis, this invention is significantly innovative: This invention uses Kluyveromyces martensii (… K. marxianus Using this high-ergosterol-producing yeast as a chassis, this strain, derived from wild-type yeast screening, possesses a naturally high sterol production capacity, and its use as an unconventional yeast for cholesterol production is a first-time report. Furthermore, this yeast is an edible strain with high biosafety, exhibiting rapid growth and strong robustness, and can efficiently ferment at high temperatures of 42-45℃. The engineered strain Chol99 achieved the highest cholesterol yield to date. Based on this high-ergosterol-producing chassis, through haploid screening, auxotrophic constructing, endogenous strong promoter modification, and the design of an artificial cholesterol synthesis pathway, efficient cholesterol production was successfully achieved, providing a new pathway for industrialized green manufacturing.

[0399] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A genetically engineered strain of Kluyveromyces martensii, Chol03, characterized in that, A Kluyveromyces marxianus (K. marxianus) Kluyveromyces marxianus KM01 is used as a starting strain, and the URA3 gene and HIS3 gene are knocked out; the accession number of the K. marxianus KM01 is CGMCC No. 39148; Overexpression of the DWF5 and DHCR24 genes via the pGOM45 promoter at the KmADH3 site; Overexpression of DWF5 and DHCR24 genes via the pGOM45 promoter at the Ku70 site; The KmADH3 site sequence is shown in SEQ ID NO.53; The pGOM45 promoter sequence is shown in SEQ ID NO.37; The DWF5 gene sequence is shown in SEQ ID NO.39; The DHCR24 gene sequence is shown in SEQ ID NO.40; The Ku70 site sequence is shown in SEQ ID NO.

64.

2. A genetically engineered strain of Kluyveromyces martensii, Chol07, characterized in that, Using the genetically engineered bacterium Chol03 as described in claim 1 as the starting strain, and using pERG7 Promoter replacement pERG6 promoter; The pERG7 The promoter sequence is shown in SEQ ID NO.73; The pERG6 The promoter sequence is shown in SEQ ID NO.

74.

3. A genetically engineered strain of Kluyveromyces martensii, Chol16, characterized in that, Using the genetically engineered bacterium Chol07 as described in claim 2 as the starting strain, Will ERG1 Genes and ERG11 Gene integration to NS1 site; Will ERG26 Genes and ERG27 Gene integration to NS2 site; Will ERG2 Genes and ERG3 Gene integration to NS3 site; The ERG1 The gene sequence is shown in SEQ ID NO. 85; The ERG11 The gene sequence is shown in SEQ ID NO. 86; The NS1 The site sequence is shown in SEQ ID NO. 91; The ERG26 The gene sequence is shown in SEQ ID NO. 87; ERG27 The gene sequence is shown in SEQ ID NO. 88; NS2 The site sequence is shown in SEQ ID NO. 92; The ERG2 The gene sequence is shown in SEQ ID NO. 89; ERG3 The gene sequence is shown in SEQ ID NO. 90; NS3 The site sequence is shown in SEQ ID NO.

93.

4. A strain of Kluyveromyces macrocarpa genetically engineered strain Chol41, characterized in that, Using the genetically engineered bacterium Chol16 as described in claim 3 as the starting strain, Will ERG20 Genes and HMG1 The gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. GRE3 site; Will IDI1 Genes and ERG8 The gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. DPP1 site; Will ERG10 Genes and ERG12 The gene integrates into the peroxisome via targeting the peroxisome localization signal peptide ePTS1 sequence. OPI1 site; The ERG20 The gene sequence is shown in SEQ ID NO. 133; HMG1 The gene sequence is shown in SEQ ID NO. 134; GRE3 The site sequence is shown in SEQ ID NO.140; The IDI1 The gene sequence is shown in SEQ ID NO. 135; ERG8 The gene sequence is shown in SEQ ID NO. 136; DPP1 The site sequence is shown in SEQ ID NO.141; The ERG10 The gene sequence is shown in SEQ ID NO. 137; ERG12 The gene sequence is shown in SEQ ID NO. 138; OPI1 The site sequence is shown in SEQ ID NO.142; The sequence of the peroxisome localization signal peptide ePTS1 is shown in SEQ ID NO.

139.

5. A genetically engineered strain of Kluyveromyces martensii, Chol55, characterized in that, Using the genetically engineered bacterium Chol41 as the starting strain, the ROX1 gene was knocked out.

6. A strain of Kluyveromyces macrocarpa genetically engineered strain Chol82, characterized in that, Using the genetically engineered bacterium Chol55 as described in claim 5 as the starting strain, Will UGA2 Genes and NOX Gene integration to NS8 site; The UGA2 The gene sequence is shown in SEQ ID NO.190; The NOX The gene sequence is shown in SEQ ID NO.191; The NS8 The site sequence is shown in SEQ ID NO.

192.

7. A strain of Kluyveromyces martensii genetically engineered strain Chol99, characterized in that, Using the genetically engineered bacterium Chol82 as the starting strain according to claim 6, knockout TGL3 Genes and NEM1 Gene.

8. The use of the Kluyveromyces macrocarpa genetically engineered strain Chol03 of claim 1, or the Kluyveromyces macrocarpa genetically engineered strain Chol07 of claim 2, or the Kluyveromyces macrocarpa genetically engineered strain Chol16 of claim 3, or the Kluyveromyces macrocarpa genetically engineered strain Chol41 of claim 4, or the Kluyveromyces macrocarpa genetically engineered strain Chol55 of claim 5, or the Kluyveromyces macrocarpa genetically engineered strain Chol82 of claim 6, or the Kluyveromyces macrocarpa genetically engineered strain Chol99 of claim 7 in the production of cholesterol.

9. The use of the Kluyveromyces macrocarpa genetically engineered strain Chol03 of claim 1, or the Kluyveromyces macrocarpa genetically engineered strain Chol07 of claim 2, or the Kluyveromyces macrocarpa genetically engineered strain Chol16 of claim 3, or the Kluyveromyces macrocarpa genetically engineered strain Chol41 of claim 4, or the Kluyveromyces macrocarpa genetically engineered strain Chol55 of claim 5, or the Kluyveromyces macrocarpa genetically engineered strain Chol82 of claim 6, or the Kluyveromyces macrocarpa genetically engineered strain Chol99 of claim 7 in increasing cholesterol production.

10. A method for producing cholesterol, characterized in that, Fermentation is carried out using the Kluyveromyces martensii genetically engineered strain Chol03 as described in claim 1, or the Kluyveromyces martensii genetically engineered strain Chol07 as described in claim 2, or the Kluyveromyces martensii genetically engineered strain Chol16 as described in claim 3, or the Kluyveromyces martensii genetically engineered strain Chol41 as described in claim 4, or the Kluyveromyces martensii genetically engineered strain Chol55 as described in claim 5, or the Kluyveromyces martensii genetically engineered strain Chol82 as described in claim 6, or the Kluyveromyces martensii genetically engineered strain Chol99 as described in claim 7.

Images