Saccharomyces cerevisiae engineering bacterium capable of synthesizing p-anisaldehyde from beginning and construction method of saccharomyces cerevisiae engineering bacterium

By constructing engineered Saccharomyces cerevisiae and heterologously expressing key enzyme systems, a complete biosynthetic pathway for anisaldehyde was established, solving the problems of low efficiency, serious pollution, and limited raw materials in existing production methods, and realizing efficient and environmentally friendly production of anisaldehyde.

CN121801723APending Publication Date: 2026-04-07GUANGXI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610087228.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-22
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Existing methods for producing anisaldehyde suffer from problems such as complex processes, low yields, high energy consumption, and severe pollution. Chemical synthesis methods require harsh conditions and involve numerous side reactions, while microbial methods result in low product concentrations and limited raw material sources.

Method used

We constructed an engineered strain of Saccharomyces cerevisiae, knocked out genes related to aldehyde accumulation, and heterologously expressed 4-hydroxymandelic acid synthase HmaS, heme oxygenase HMO, benzoylformate decarboxylase BFD, and methyltransferase 4VPMT1 to establish a complete biosynthetic pathway from 4-hydroxyphenylpyruvate to anisaldehyde, using glucose as the sole carbon source for synthesis.

Benefits of technology

It achieves efficient and environmentally friendly biosynthesis of anisaldehyde, simplifies the production process, reduces costs, conforms to the concept of green manufacturing, and the product meets the 'natural' product standards recognized by European and American regulations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801723A_ABST
    Figure CN121801723A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of bioengineering bacteria. The invention provides a saccharomyces cerevisiae engineering bacterium capable of synthesizing p-anisaldehyde from the beginning and a construction method of the engineering bacterium. A saccharomyces cerevisiae recombinant strain JS1-15 is used as an original strain; the saccharomyces cerevisiae engineering bacteria are obtained by heterologous expression of 4-hydroxymandelic acid synthetase HmaS, heme oxygenase HMO, benzoyl formate decarboxylase BFD and methyltransferase 4VPMT1. The saccharomyces cerevisiae engineering bacteria are used for preparing the saccharomyces cerevisiae engineering bacteria. The saccharomyces cerevisiae engineering bacterium disclosed by the invention can realize a complete de novo biosynthesis path from 4-hydroxyphenylpyruvic acid to p-anisaldehyde by taking glucose as a unique carbon source, and has good industrial application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, and in particular to a brewer's yeast strain capable of de novo synthesis of anisaldehyde and its construction method. Background Technology

[0002] anisaldehyde ( p Anisaldehyde (A. anisaldehyde) is an aromatic aldehyde compound with characteristic aromas of anise and hawthorn. Due to its long-lasting aroma and significant bioactivity, it is widely used in daily fragrances, food additives, cosmetics, and the pharmaceutical industry. This compound not only possesses antioxidant properties, serving as a natural preservative and free radical scavenger, but also exhibits certain antibacterial activity and can participate as a pharmaceutical intermediate in the synthesis of antihistamines and antibacterial drugs. Traditional production methods for anisaldehyde currently mainly include chemical synthesis and plant extraction. Plant extraction relies on star anise (A. anisaldehyde). Illicium verum Plant resources such as [list of plants] are used to obtain volatile oils through distillation, followed by oxidation of their main component, trans-anisole, to obtain p-anisaldehyde. However, this method is complex, has low yield, high energy consumption, and is prone to pollution. Chemical synthesis utilizes strong oxidizing agents such as potassium permanganate to oxidize trans-anisole to produce p-anisaldehyde, but the reaction conditions are harsh and numerous side reactions occur. In recent years, studies have discovered that certain microorganisms, such as *Pseudomonas putida* ([list of microorganisms]), [are involved in this process]. Pseudomonas putida It is possible to produce p-anisaldehyde through enzyme catalysis of trans-anistin, a process that is green and environmentally friendly, but still faces problems such as low product concentration and limited raw material sources.

[0003] With the rapid development of synthetic biology, biosynthesis based on model organisms (such as Saccharomyces cerevisiae) has shown significant advantages. This method can use renewable carbon sources such as glucose as raw materials to achieve green, efficient, and sustainable production of a variety of natural products, which is in line with the concept of green manufacturing. Its products are recognized as "natural" products in European and American regulations and have broad application prospects.

[0004] Therefore, current technology urgently needs to construct a brewer's yeast cell capable of synthesizing p-anisaldehyde de novo through synthetic biology strategies, breaking through existing production bottlenecks, and efficiently producing p-anisaldehyde using inexpensive glucose as a raw material to meet the market's growing demand for "natural" p-anisaldehyde. Summary of the Invention

[0005] The purpose of this invention is to provide a brewer's yeast strain capable of de novo synthesis of p-anisaldehyde and its construction method. This brewer's yeast strain can achieve a complete de novo biosynthesis pathway from 4-hydroxyphenylpyruvic acid to p-anisaldehyde using glucose as the sole carbon source, and has broad prospects for industrial application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides an engineered Saccharomyces cerevisiae strain capable of de novo synthesis of anisaldehyde, using recombinant Saccharomyces cerevisiae strain JS1-15 as the original strain and heterologously expressing 4-hydroxymandelic acid synthase. HmaS Heme oxygenase HMO Benzoylcarboxylate decarboxylase BFD and methyltransferase 4VPMT1 The obtained engineered brewer's yeast strain.

[0007] Preferably, the recombinant Saccharomyces cerevisiae strain JS1-15 is constructed by the following steps: (1) using Saccharomyces cerevisiae BY4741 as the original strain, knocking out the Saccharomyces cerevisiae BY4741. GAL80 Genes and genes related to aldehyde accumulation AAD3 , ARI1 , YPR1 , YDR541C , GCY1 , SFA1 , YDL124W , GRE3 , GRE2 , ADH6 , ADH7 as well as HFD1 (2) Obtaining the recombinant strain JS1-13 of Saccharomyces cerevisiae; (3) Integrating shikimate kinase AROL and shikimate dehydrogenase ARO1 into the recombinant strain JS1-13 of Saccharomyces cerevisiae. PDC5 (2) Gene locus, to obtain recombinant Saccharomyces cerevisiae strain JS1-14; (3) Integrate 3-deoxy-D-arabinotype heptanulose-7-phosphate synthase ARO4 and branching acid mutase ARO7 into recombinant Saccharomyces cerevisiae strain JS1-14. PHA2 Gene loci yielded the recombinant Saccharomyces cerevisiae strain JS1-15.

[0008] The present invention also provides a method for constructing the engineered brewer's yeast, comprising the following steps: (1) Genes were obtained by PCR amplification. HmaS , 4VPMT1 , BFD and HMO The expression fragment was then ligated with the enzyme-digested vector plasmid to obtain recombinant plasmids pRS424-HmaS / 4VPMT1 and pRS425-BFD / HMO. (2) The recombinant plasmid described in step (1) is transferred into competent cells of recombinant Saccharomyces cerevisiae strain JS1-15. After positive clone verification, the engineered Saccharomyces cerevisiae strain is obtained.

[0009] Preferably, the gene HmaSThe PCR amplification primers are HmaS_P1_fwd as shown in SEQ ID NO:77 and HmaS_P1_rev as shown in SEQ ID NO:78.

[0010] Preferably, the gene 4VPMT1 The PCR amplification primers are 4VPMT1_P2_fwd as shown in SEQ ID NO:79 and 4VPMT1_P2_rev as shown in SEQ ID NO:80.

[0011] Preferably, the gene BFD The PCR amplification primers are BFD_P1_fwd as shown in SEQ ID NO:81 and BFD_P1_rev as shown in SEQ ID NO:82.

[0012] Preferably, the gene HMO The PCR amplification primers are HMO_P2_fwd as shown in SEQ ID NO:83 and HMO_P2_rev as shown in SEQ ID NO:84.

[0013] Preferably, the PCR amplification conditions in step (1) are as follows: 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; 72℃ for 2 min.

[0014] The present invention also provides the application of the engineered Saccharomyces cerevisiae in the synthesis of p-anisaldehyde.

[0015] The present invention also provides a method for synthesizing p-anisaldehyde, wherein the engineered strain of Saccharomyces cerevisiae is inoculated into a culture medium at an inoculation amount of 0.8-1.2% and cultured and fermented to obtain p-anisaldehyde.

[0016] Preferably, the fermentation temperature is 28-32℃ and the fermentation time is 24-72h.

[0017] Preferably, the fermentation process is accompanied by oscillation treatment, and the oscillation frequency is 100-300 rpm.

[0018] Preferably, the carbon source in the culture medium is glucose.

[0019] By adopting the above technical solution, the present invention has the following beneficial effects: The technical solution of this invention establishes a stable intracellular accumulation environment for target aldehyde products synthesized via exogenous pathways by knocking out 12 aldehyde accumulation-related genes in Saccharomyces cerevisiae BY4741, and further knocks out... GAL80Genes were obtained from the recombinant Saccharomyces cerevisiae strain JS1-13 to relieve inhibition of the galactose metabolic pathway, thereby optimizing the synthesis efficiency of the target product and reducing production costs. The genes encoding shikimate kinase AROL and shikimate dehydrogenase ARO1 were integrated into the recombinant Saccharomyces cerevisiae strain JS1-13. PDC5 The gene locus, which integrates the coding genes for point mutations in 3-deoxy-D-arabinoylheptanulose-7-phosphate synthase ARO4 and clade acid mutase ARO7 into the recombinant Saccharomyces cerevisiae strain JS1-14. PHA2 The gene locus promotes the central carbon metabolism flow to the 4-hydroxyphenylpyruvate synthesis pathway, providing sufficient precursor compounds for the synthesis of anisaldehyde. Finally, 4-hydroxymandelic acid synthase was heterologously expressed in the recombinant Saccharomyces cerevisiae strain JS1-15. HmaS Heme oxygenase HMO Benzoylcarboxylate decarboxylase BFD and methyltransferase 4VPMT1 Construct a complete synthetic pathway from 4-hydroxyphenylpyruvic acid to p-anisaldehyde (e.g. Figure 1 ).

[0020] The engineered bacterial strain of this invention can synthesize p-hydroxyphenylpyruvic acid using glucose as the sole carbon source via the endogenous shikimic acid pathway of Saccharomyces cerevisiae, and then via 4-hydroxymandelic acid synthase. HmaS Under the action of heme oxygenase, p-hydroxymandelic acid and heme oxygenase are generated. HMO Catalytic synthesis of p-hydroxyphenylglyoxylic acid, and formic acid decarboxylase BFD p-hydroxybenzaldehyde is generated under the action of methyltransferase, and finally it is converted into p-hydroxybenzaldehyde. 4VPMT1 p-Anisaldehyde was synthesized under the catalysis of [a specific catalytic agent]. This engineered strain achieved the de novo biosynthesis of p-anisaldehyde, and the process is simple and environmentally friendly, which has broad prospects for industrial application. Attached Figure Description

[0021] Figure 1 for HmaS , HMO , BFD and 4VPMT1 The pathway for the synthesis of p-anisaldehyde catalyzed by four key enzymes; Figure 2 Typical liquid chromatography results of the JS1-P0 and JS1-P1 recombinant strains for the synthesis of anisaldehyde; Figure 3 The growth curves and fermentation yields of the recombinant strains JS1-P0 and JS1-P1 are shown in the figure. Figure 3 In the diagram, A represents the growth curve of the recombinant strain, and B represents the fermentation yield of the recombinant strain. Detailed Implementation

[0022] This invention provides an engineered Saccharomyces cerevisiae strain capable of de novo synthesis of anisaldehyde, using recombinant Saccharomyces cerevisiae strain JS1-15 as the original strain and heterologously expressing 4-hydroxymandelic acid synthase. HmaS Heme oxygenase HMO Benzoylcarboxylate decarboxylase BFD and methyltransferase 4VPMT1 The obtained engineered brewer's yeast strain.

[0023] In this invention, the recombinant Saccharomyces cerevisiae strain JS1-15 is constructed by the following steps: (1) using Saccharomyces cerevisiae BY4741 as the original strain, knocking out the Saccharomyces cerevisiae BY4741. GAL80 Genes and genes related to aldehyde accumulation AAD3 , ARI1 , YPR1 , YDR541C , GCY1 , SFA1 , YDL124W , GRE3 , GRE2 , ADH6 , ADH7 as well as HFD1 (2) Obtaining the recombinant strain JS1-13 of Saccharomyces cerevisiae; (3) Integrating shikimate kinase AROL and shikimate dehydrogenase ARO1 into the recombinant strain JS1-13 of Saccharomyces cerevisiae. PDC5 (2) Gene locus, to obtain recombinant Saccharomyces cerevisiae strain JS1-14; (3) Integrate 3-deoxy-D-arabinotype heptanulose-7-phosphate synthase ARO4 and branching acid mutase ARO7 into recombinant Saccharomyces cerevisiae strain JS1-14. PHA2 Gene loci yielded the recombinant Saccharomyces cerevisiae strain JS1-15.

[0024] The present invention also provides a method for constructing the engineered brewer's yeast, comprising the following steps: (1) Genes were obtained by PCR amplification. HmaS , 4VPMT1 , BFD and HMO The expression fragment was then ligated with the enzyme-digested vector plasmid to obtain recombinant plasmids pRS424-HmaS / 4VPMT1 and pRS425-BFD / HMO. (2) The recombinant plasmid described in step (1) is transferred into competent cells of recombinant Saccharomyces cerevisiae strain JS1-15. After positive clone verification, the engineered Saccharomyces cerevisiae strain is obtained.

[0025] In this invention, the gene HmaSThe PCR amplification primers are HmaS_P1_fwd and HmaS_P1_rev. The sequence of HmaS_P1_fwd is shown in SEQ ID NO:77, specifically TTGGTCTCATGAAAACAATGCAGAATTTCGAAATCG; the sequence of HmaS_P1_rev is shown in SEQ ID NO:78, specifically TTGGTCTCAATCTAACGCCTCGCGGCTCCAAAC.

[0026] In this invention, the gene 4VPMT1 The PCR amplification primers are 4VPMT1_P2_fwd and 4VPMT1_P2_rev. The sequence of 4VPMT1_P2_fwd is shown in SEQ ID NO:79, specifically TTGGTCTCAAACCAATGGATAAGCAAAACGGTCA; the sequence of 4VPMT1_P2_rev is shown in SEQ ID NO:80, specifically TTGGTCTCATCTTACAACTTTCTAGCTAAAG.

[0027] In this invention, the gene BFD The PCR amplification primers are BFD_P1_fwd and BFD_P1_rev. The sequence of BFD_P1_fwd is shown in SEQ ID NO:81, specifically TTGGTCTCATGAAAACAATGGCTTCGGTACACGGC; the sequence of BFD_P1_rev is shown in SEQ ID NO:82, specifically TTGGTCTCAATCTACTTCACCGGGCTTACGG.

[0028] In this invention, the gene HMO The PCR amplification primers are HMO_P2_fwd and HMO_P2_rev. The sequence of HMO_P2_fwd is shown in SEQ ID NO:83, specifically TTGGTCTCAAACCAATGCGTGAACCGCTGACGC; the sequence of HMO_P2_rev is shown in SEQ ID NO:84, specifically TTGGTCTCATCTTAGCCGTGAGAACGATCGC.

[0029] In this invention, the PCR amplification conditions in step (1) are independently: 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, 30 cycles; 72℃ for 2 min.

[0030] The present invention also provides the application of the engineered Saccharomyces cerevisiae in the synthesis of p-anisaldehyde.

[0031] The present invention also provides a method for synthesizing p-anisaldehyde, wherein the engineered strain of Saccharomyces cerevisiae is inoculated into a culture medium and cultured and fermented to obtain p-anisaldehyde.

[0032] In this invention, the inoculation amount of the engineered brewer's yeast is preferably 0.8-1.2%, more preferably 0.9-1.1%, and even more preferably 1%.

[0033] In this invention, the fermentation temperature is preferably 28-32℃, more preferably 29-31℃, and even more preferably 30℃; the fermentation time is preferably 24-72h, more preferably 36-60h, and even more preferably 48h.

[0034] In this invention, the fermentation process is accompanied by oscillation treatment, and the frequency of the oscillation is preferably 100-300 rpm, more preferably 150-250 rpm, and even more preferably 200 rpm.

[0035] In this invention, the carbon source in the culture medium is glucose. The culture medium of this invention is preferably SC-TRP-LEU medium.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] The *Saccharomyces cerevisiae* BY4741 strain used in this invention was purchased from Shanghai Weidi Biotechnology Co., Ltd.; *Escherichia coli* competent cells DH5α were purchased from Shanghai Bioengineering Co., Ltd.; *Saccharomyces cerevisiae* expression vectors pRS424-GGA and pRS425-GGA were purchased from Beijing Zhongyuan Heju Biotechnology Co., Ltd.; T4 ligase and restriction endonuclease were purchased from New England Biolabs (NEB); 2×Phanta® UniFi Master Mix (Dye Plus) was purchased from Nanjing Novizan Biotechnology Co., Ltd.; Taq HiFi PCR mix was purchased from Polymer Biotechnology Co., Ltd.; plasmid extraction kit, DNA purification kit, gel extraction kit, and yeast genomic DNA extraction kit were purchased from Shanghai Bioengineering Co., Ltd.

[0038] The LB medium consisted of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L NaCl, with double-distilled water added to bring the total volume to 1 L. The medium was then sterilized at 115°C under 0.1 MPa pressure for 30 min.

[0039] YPD culture medium consists of 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, and double-distilled water to a final volume of 1 L. The medium is then sterilized at 115°C under 0.1 MPa pressure for 30 min.

[0040] The SC-LEU medium consists of: 6.7 g / L yeast nitrogen basal, 1.4 g / L yeast auxotrophic medium supplement (without leucine), 20 g / L glucose, double-distilled water to a final volume of 1 L, and sterilized at 115℃ under 0.1 MPa pressure for 20 min.

[0041] The SC-LEU-URA medium consists of: 6.7 g / L yeast nitrogen basal, 1.4 g / L yeast auxotrophic medium supplement (excluding leucine and uracil), 20 g / L glucose, double-distilled water to a final volume of 1 L, and sterilized at 115°C under 0.1 MPa pressure for 20 min.

[0042] The SC complete culture medium consists of: 6.7 g / L yeast nitrogen source basal, 1.4 g / L yeast auxotrophic medium supplement, 20 g / L glucose, double-distilled water to make up to 1 L, and sterilized at 115℃ under 0.1 MPa pressure for 20 min.

[0043] 100x 5-Fluorotic Acid: 100 mg of 5-fluoroorotic acid was dissolved in 1 mL using DMSO.

[0044] Example 1: Construction of recombinant Saccharomyces cerevisiae strain JS1-15

[0045] (a) Constructing a CRISPR gRNA expression module

[0046] 1. Construct the p426-gRNA(AAD3) plasmid: Using the p426-SNR52-gRNA vector (addgene#43803) as a template, and primers F_gRNA.AAD3 (SEQ ID NO:1) and R_SUP4 (SEQ ID NO:16) as primers (Table 1), the gRNA (AAD3) fragment was amplified by PCR. The target band was recovered using a DNA purification kit to obtain the gel recovery product. PCR amplification conditions: 25 μL Taq HiFi PCR mix, 0.5 μL template, 1 μL each of upper and lower primers, and 22.5 μL double-distilled water; 98℃ for 2 min, 98℃ for 10 s, 56℃ for 30 s, 72℃ for 1 min, 30 cycles; 72℃ for 2 min. After digestion with BsaI for 4 h, the p426-SNR52-GGA plasmid was recovered by gel electrophoresis, and then mixed with the gRNA (AAD3) fragment. Ligation was performed using T4 ligase and BsaI under the following conditions: 37℃ for 10 min; 37℃ for 10 min, 16℃ for 10 min, 4 cycles; 20℃ for 10 min. The ligated product was transformed into *E. coli* DH5α competent cells. Positive clones were obtained by verification with primers containing nucleotide sequences such as SEQ ID NO:1 and SEQ ID NO:16. The gRNA expression plasmid p426-gRNA (AAD3) was extracted, and the sequencing results were completely consistent with the designed plasmid DNA sequence.

[0047] Similar to the above operations, construct the following plasmids respectively: p426-gRNA(ARI1), p426-gRNA(YPR1), p426-gRNA(YDR541C), p426-gRNA(GCY1), p426-gRNA(SFA1), p426-gRNA(YDL124W), p426-gRNA(GRE3), p426-gRNA(GRE2), p426-gRNA(ADH6), p426-gRNA(ADH7), p426-gRNA(HFD1), p426-gRNA(GAL80), p426-gRNA(PDC5), and p426-gRNA(PHA2). When constructing the p426-gRNA (ARI1) plasmid and verifying the acquisition of positive clonal colonies, primers were used as follows: F_gRNA.ARI1 (nucleotide sequence shown in SEQ ID NO:2) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16); when constructing the p426-gRNA (YPR1) plasmid and verifying the acquisition of positive clonal colonies, primers were used as follows: F_gRNA.YPR1 (nucleotide sequence shown in SEQ ID NO:3) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16); when constructing the p426-gRNA (YDR541C) plasmid and verifying the acquisition of positive clonal colonies, primers were used as follows: F_gRNA.YDR541C (nucleotide sequence shown in SEQ ID NO:4) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16); when constructing the p426-gRNA (GCY1) plasmid and verifying the acquisition of positive clonal colonies, primers were used as follows: F_gRNA.GCY1 (nucleotide sequence shown in SEQ ID NO:5) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16). Primer R_SUP4 as shown in NO:16 was used; when constructing the p426-gRNA (SFA1) plasmid and verifying the acquisition of positive clone colonies, primers F_gRNA.SFA1 with nucleotide sequence as shown in SEQ ID NO:6 and R_SUP4 with nucleotide sequence as shown in SEQ ID NO:16 were used; when constructing the p426-gRNA (YDL124W) plasmid and verifying the acquisition of positive clone colonies, primers F_gRNA.YDL124W with nucleotide sequence as shown in SEQ ID NO:7 and R_SUP4 with nucleotide sequence as shown in SEQ ID NO:16 were used; when constructing the p426-gRNA (GRE3) plasmid and verifying the acquisition of positive clone colonies, primer F_gRNA with nucleotide sequence as shown in SEQ ID NO:8 was used.GRE3 and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16) were used as primers; when constructing the p426-gRNA (GRE2) plasmid and verifying the acquisition of positive clones, F_gRNA.GRE2 (nucleotide sequence shown in SEQ ID NO:9) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16) were used as primers; when constructing the p426-gRNA (ADH6) plasmid and verifying the acquisition of positive clones, F_gRNA.ADH6 (nucleotide sequence shown in SEQ ID NO:10) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16) were used as primers; when constructing the p426-gRNA (ADH7) plasmid and verifying the acquisition of positive clones, F_gRNA.ADH7 (nucleotide sequence shown in SEQ ID NO:11) and R_SUP4 (nucleotide sequence shown in SEQ ID NO:16) were used as primers; when constructing the p426-gRNA (HFD1) plasmid and verifying the acquisition of positive clones, the primers were used as primers. Primers F_gRNA.HFD1 (SEQ ID NO:12) and R_SUP4 (SEQ ID NO:16) were used for constructing the p426-gRNA (GAL80) plasmid and verifying the acquisition of positive clones. Primers F_gRNA.GAL80 (SEQ ID NO:13) and R_SUP4 (SEQ ID NO:16) were used for constructing the p426-gRNA (PDC5) plasmid and verifying the acquisition of positive clones. Primers F_gRNA.PDC5 (SEQ ID NO:14) and R_SUP4 (SEQ ID NO:16) were used for constructing the p426-gRNA (PHA2) plasmid and verifying the acquisition of positive clones were used for constructing the p426-gRNA (PHA2) plasmid. Specific primer sequence information is shown in Table 1.

[0048] (II) Construction of target gene expression module

[0049] 1. Constructing the pRS424-HmaS / 4VPMT1 plasmid

[0050] Oriental pseudoacacia Amycolatopsis orientalis Using the genome (GCA_000943515.2) as a template, and with nucleotide sequences as shown in SEQ ID NO:77 and SEQ ID NO:78 as upstream and downstream primers (Table 1), PCR amplification was performed to obtain... HmaSGene fragments were extracted, and the target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ® The UniFi Master Mix (Dye Plus) was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL; the incubation was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; then 72℃ for 2 min. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) Locusta migratoria Using the genome (GCA_026315105.1) as a template, and with nucleotide sequences as shown in SEQ ID NO:79 and SEQ ID NO:80 as primers (Table 1), PCR amplification was performed to obtain... 4VPMT1 Gene fragments were extracted, and the target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ® The UniFi MasterMix (Dye Plus) solution was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL. The incubation process was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, and 72℃ for 4 min, repeated 30 times. The pRS424-GGA plasmid was digested with BsaI for 4 h, and the large and small fragments were recovered by gel electrophoresis, followed by... HmaS Gene fragments and 4VPMT1 Gene fragments were mixed and ligated using T4 ligase and BsaI ligase under the following conditions: 37℃ for 10 min; 37℃ for 10 min, 16℃ for 10 min, 8 cycles; 20℃ for 10 min. The ligated product was transformed into *E. coli* DH5α competent cells. Positive clones were obtained by verification using primers with nucleotide sequences such as SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100 (Table 1). The recombinant plasmid pRS424-HmaS / 4VPMT1 was extracted, and the sequencing results were completely consistent with the designed plasmid DNA sequence.

[0051] 2. Construction of pRS425-BFD / HMO plasmid

[0052] With *Pseudomonas putida* Pseudomonas putida Using the genome (GCA_000412675.1) as a template, and with nucleotide sequences as shown in SEQ ID NO:81 and SEQ ID NO:82 as upstream and downstream primers (Table 1), PCR amplification was performed to obtain... BFD Gene fragments were extracted, and the target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ®The UniFi Master Mix (Dye Plus) was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL; the incubation was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; then 72℃ for 2 min. The sample was prepared using *Streptomyces cerevisiae*. Streptomyces coelicolor Using the genome (GCA_008931305.1) as a template, and with nucleotide sequences as shown in SEQ ID NO:83 and SEQ ID NO:84 as upstream and downstream primers (Table 1), PCR amplification was performed to obtain... HMO Gene fragments were extracted, and the target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ® The UniFi MasterMix (Dye Plus) solution was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL. The incubation process was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, and 72℃ for 4 min, repeated 30 times. The pRS425-GGA plasmid was digested with BsaI for 4 h, and the large and small fragments were recovered by gel electrophoresis, followed by... BFD Gene fragments and HMO Gene fragments were mixed and ligated using T4 ligase and BsaI ligase under the following conditions: 37℃ for 10 min; 37℃ for 10 min, 16℃ for 10 min, 8 cycles; 20℃ for 10 min. The ligated product was transformed into *E. coli* DH5α competent cells, and positive clones were obtained by verification using nucleotide sequences such as SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100 (Table 1). The recombinant plasmid pRS425-BFD / HMO was extracted, and the sequencing results were completely consistent with the designed plasmid DNA sequence.

[0053] 3. Constructing the pRS426-AROL / ARO1 plasmid

[0054] With Escherichia coli Escherichia coli Using the genome (GCA_000005845.2) as a template, and with nucleotide sequences as shown in SEQ ID NO:85 and SEQ ID NO:86 as upstream and downstream primers (Table 1), PCR amplification was performed to obtain... AROL Gene fragments were extracted, and the target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ®The UniFi Master Mix (Dye Plus) was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL. The induction temperature was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, and 72℃ for 4 min, repeated 30 times; then 72℃ for 2 min. Using the Saccharomyces cerevisiae genome (GCA_000146045.2) as a template, and with the nucleotide sequences shown in SEQ ID NO:87 and SEQ ID NO:88 as the upstream and downstream primers (Table 1), the ARO1 gene fragment was amplified by PCR. The target band was recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ® The UniFi MasterMix (Dye Plus) solution was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL. The incubation process was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, and 72℃ for 4 min, repeated 30 times. The pRS425-GGA plasmid was digested with BsaI for 4 h, and the large and small fragments were recovered by gel electrophoresis, followed by... AROL Gene fragments and ARO1 Gene fragments were mixed and ligated using T4 ligase and BsaI ligase under the following conditions: 37℃ for 10 min; 37℃ for 10 min, 16℃ for 10 min, 8 cycles; 20℃ for 10 min. The ligated product was transformed into *E. coli* DH5α competent cells, and positive clones were obtained by verification using nucleotide sequences such as SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100 (Table 1). The recombinant plasmid pRS425-AROL / ARO1 was extracted, and the sequencing results were completely consistent with the designed plasmid DNA sequence.

[0055] 4. Construct pRS426-ARO4 K229L / ARO7 G141S plasmid

[0056] With brewer's yeast Saccharomyces cerevisiae Using the genome (GCA_000146045.2) as a template, and with nucleotide sequences as shown in SEQ ID NO:89 / SEQ ID NO:91 and SEQ ID NO:90 / SEQ ID NO:92 as primers (Table 1), gene fragment 1 and gene fragment 2 were obtained by PCR amplification. The target bands were then recovered using a DNA purification kit to obtain the gel recovery product. PCR amplification conditions: 2×Phanta ®The UniFi Master Mix (Dye Plus) was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL. The incubation process was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, and 72℃ for 4 min, repeated 30 times; then 72℃ for 2 min. Using gene fragment 1 and gene fragment 2 as templates, and with the nucleotide sequences shown in SEQ ID NO:89 and SEQ ID NO:92 as upstream and downstream primers (Table 1), the point mutation gene fragment was amplified by fusion PCR. ARO4 K229L The target band was recovered using a DNA purification kit to obtain the gel-recovered product. PCR amplification conditions: 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, 30 cycles; 72℃ for 2 min. Using *Saccharomyces cerevisiae*... Saccharomyces cerevisiae Using the genome (GCA_000146045.2) as a template, and with nucleotide sequences as shown in SEQ ID NO:93 / SEQ ID NO:95 and SEQ ID NO:94 / SEQ ID NO:96 as primers (Table 1), gene fragments 3 and 4 were obtained by PCR amplification. The target bands were then recovered using a DNA purification kit to obtain the gel extraction product. PCR amplification conditions: 2×Phanta ® The UniFi Master Mix (Dye Plus) was 25 μL, the template was 1 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22 μL; the incubation was 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; then 72℃ for 2 min. Using gene fragments 3 and 4 as templates, and with the nucleotide sequences shown in SEQ ID NO:93 and SEQ ID NO:96 as upstream and downstream primers (Table 1), the point mutation gene fragment was amplified by fusion PCR. ARO7 G141S The target band was recovered using a DNA purification kit to obtain the gel-recovered product. PCR amplification conditions: 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, 30 cycles; 72℃ for 2 min. After digestion of the pRS425-GGA plasmid with BsaI for 4 h, the large and small fragments were recovered by gel extraction, followed by... ARO4 K229L Gene fragments and ARO7 G141SGene fragments were mixed and ligated using T4 ligase and BsaI ligase under the following conditions: 37℃ for 10 min; 37℃ for 10 min, 16℃ for 10 min, 8 cycles; 20℃ for 10 min. The ligated product was transformed into *E. coli* DH5α competent cells, and positive clones were obtained by verification using nucleotide sequences such as SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100 (Table 1). The recombinant plasmid pRS426-ARO4 was extracted. K229L / ARO7 G141S The sequencing results were completely consistent with the designed plasmid DNA sequence.

[0057] (III) Preparation of targeted knockout fragments

[0058] Using F-AAD3-Del (nucleotide sequence as shown in SEQ ID NO:17) and R-AAD3-Del (nucleotide sequence as shown in SEQ ID NO:18) as primers (Table 1), PCR amplification was performed to obtain... AAD3 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0059] Using F-ARI1-Del (nucleotide sequence as shown in SEQ ID NO:19) and R-ARI1-Del (nucleotide sequence as shown in SEQ ID NO:20) as primers (Table 1), PCR amplification was performed to obtain... ARI1 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0060] Using F-YPR1-Del (nucleotide sequence as shown in SEQ ID NO:21) and R-YPR1-Del (nucleotide sequence as shown in SEQ ID NO:22) as primers (Table 1), PCR amplification was performed to obtain... YPR1After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0061] Using F-YDR541C-Del (nucleotide sequence as shown in SEQ ID NO:23) and R-YDR541C-Del (nucleotide sequence as shown in SEQ ID NO:24) as primers (Table 1), PCR amplification was performed to obtain... YDR541C After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of Taq HiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0062] Using F-GCY1-Del (nucleotide sequence as shown in SEQ ID NO:25) and R-GCY1-Del (nucleotide sequence as shown in SEQ ID NO:26) as primers (Table 1), PCR amplification was performed to obtain... GCY1 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0063] Using F-SFA1-Del (nucleotide sequence as shown in SEQ ID NO:27) and R-SFA1-Del (nucleotide sequence as shown in SEQ ID NO:28) as primers (Table 1), PCR amplification was performed to obtain... SFA1 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0064] Using F-YDL124W-Del (nucleotide sequence as shown in SEQ ID NO:29) and R-YDL124W-Del (nucleotide sequence as shown in SEQ ID NO:30) as primers (Table 1), PCR amplification was performed to obtain... YDL124WAfter knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of Taq HiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0065] Using F-GRE3-Del (nucleotide sequence as shown in SEQ ID NO:31) and R-GRE3-Del (nucleotide sequence as shown in SEQ ID NO:32) as primers (Table 1), PCR amplification was performed to obtain... GRE3 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0066] Using F-GRE2-Del (nucleotide sequence as shown in SEQ ID NO:33) and R-GRE2-Del (nucleotide sequence as shown in SEQ ID NO:34) as primers (Table 1), PCR amplification was performed to obtain... GRE2 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0067] Using F-ADH6-Del (nucleotide sequence as shown in SEQ ID NO:35) and R-ADH6-Del (nucleotide sequence as shown in SEQ ID NO:36) as primers (Table 1), PCR amplification was performed to obtain... ADH6 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0068] Using F-ADH7-Del (nucleotide sequence as shown in SEQ ID NO:37) and R-ADH7-Del (nucleotide sequence as shown in SEQ ID NO:38) as primers (Table 1), PCR amplification was performed to obtain... ADH7After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0069] Using F-HFD1-Del (nucleotide sequence as shown in SEQ ID NO:39) and R-HFD1-Del (nucleotide sequence as shown in SEQ ID NO:40) as primers (Table 1), PCR amplification was performed to obtain... HFD1 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0070] Using F-GAL80-Del (nucleotide sequence as shown in SEQ ID NO:41) and R-GAL80-Del (nucleotide sequence as shown in SEQ ID NO:42) as primers (Table 1), PCR amplification was performed to obtain... GAL80 After knocking out the integrated fragment, the PCR amplification conditions were as follows: 25 μL of TaqHiFi PCR mix, 0.5 μL of template, 1 μL each of the upper and lower primers, and 22.5 μL of double-distilled water; 30 cycles of 94℃ for 2 min, 94℃ for 15 s, 50℃ for 15 s, and 72℃ for 15 s; and 72℃ for 1 min.

[0071] (iv) Preparation of targeted integrated expression fragments

[0072] Using plasmid pRS426-AROL / ARO1 as a template, and primers F-PDC5-Int (nucleotide sequence shown in SEQ ID NO:43) and R-PDC5-Int (nucleotide sequence shown in SEQ ID NO:44) as primers, the knockout integration fragment was obtained by PCR amplification. ΔPDC5::P GAL10 -AROL-T ADH1 ; P GAL1 -ARO1-T CYC1 The PCR amplification conditions were: 2×Phanta ®The UniFi MasterMix (Dye Plus) was 25 μL, the template was 0.5 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22.5 μL; the incubation was 94℃ for 2 min, 94℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; and then 72℃ for 2 min.

[0073] With plasmid pRS426-ARO4 K229L / ARO7 G141S Using F-PHA2-Int (nucleotide sequence as shown in SEQ ID NO:41) and R-PHA2-Int (nucleotide sequence as shown in SEQ ID NO:41) as primers, the knockout integration fragment was obtained by PCR amplification. ΔPHA2::P GAL10 -ARO4 K229L -T ADH1 ; P GAL1 -ARO7 G141S -T CYC1 The PCR amplification conditions were: 2×Phanta ® The UniFi Master Mix (Dye Plus) was 25 μL, the template was 0.5 μL, the upper and lower primers were 1 μL each, and the double-distilled water was 22.5 μL; the incubation was 94℃ for 2 min, 94℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; and then 72℃ for 2 min.

[0074] (v) Construction of recombinant Saccharomyces cerevisiae strain JS1-15

[0075] Competent cells of *Saccharomyces cerevisiae* BY4741 were prepared, transformed into the p415-TEF2-Cas9 plasmid, and cultured on SC-LEU plates at 30°C for 2-4 days to obtain the recombinant *Saccharomyces cerevisiae* strain JS1. The plasmid p426-gRNA (AAD3) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were then used... AAD3 The knockout integration fragment was transformed into JS1 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:47 and SEQ ID NO:48. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (AAD3) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-1.

[0076] The plasmid p426-gRNA (ARI1) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) ARI1 The knockout and integration fragment was transformed into the above JS1-1 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:49 and SEQ ID NO:50. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (ARI1) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-2.

[0077] The plasmid p426-gRNA (YPR1) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used together. YPR1 The knockout and integration fragment was transformed into the above-mentioned JS1-2 competent cells and cultured on SC-LEU-URA plates at 30℃ for 2-4 days. The resulting single colonies were streaked onto SC-LEU-URA solid plates, and the single colonies were verified by PCR using primers SEQ ID NO:51 and SEQ ID NO:52. Subsequently, the colonies were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (YPR1) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-3.

[0078] The plasmid p426-gRNA (YDR541C) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) YDR541C The knockout and integration fragment was transformed into the above JS1-3 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:53 and SEQ ID NO:54. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (YDR541C) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-4.

[0079] The plasmid p426-gRNA (GCY1) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used together. GCY1 The knockout and integration fragment was transformed into the above JS1-4 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:55 and SEQ ID NO:56. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (GCY1) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-5.

[0080] The plasmid p426-gRNA (SFA1) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. SFA1 The knockout and integration fragment was transformed into the above JS1-5 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:57 and SEQ ID NO:58. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (SFA1) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-6.

[0081] The plasmid p426-gRNA (YDL124W) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. YDL124W The knockout and integration fragment was transformed into the above JS1-6 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:59 and SEQ ID NO:60. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (YDL124W) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-7.

[0082] The plasmid p426-gRNA (GRE3) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) GRE3 The knockout and integration fragment was transformed into the above-mentioned JS1-7 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. The resulting single colonies were streaked onto SC-LEU-URA solid plates, and the single colonies were verified by PCR using primers SEQ ID NO:61 and SEQ ID NO:62. Subsequently, the colonies were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (GRE3) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-8.

[0083] The plasmid p426-gRNA (GRE2) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) GRE2 The knockout and integration fragment was transformed into the above JS1-8 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:63 and SEQ ID NO:64. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (GRE2) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-9.

[0084] The plasmid p426-gRNA (ADH6) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. ADH6 The knockout and integration fragment was transformed into the above JS1-9 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:65 and SEQ ID NO:66. Subsequently, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (ADH6) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-10.

[0085] The plasmid p426-gRNA (ADH7) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. ADH 7. The knockout and integration fragment was transformed into the above JS1-10 competent cells and cultured on SC-LEU-URA plates at 30℃ for 2-4 days. The single colonies that grew were verified by PCR using primers SEQ ID NO:67 and SEQ ID NO:68. Then, the colonies were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (ADH7) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-11.

[0086] The plasmid p426-gRNA (HFD1) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. HFD1 The knockout and integration fragment was transformed into the above-mentioned JS1-11 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. The single colonies that grew were verified by PCR using primers SEQ ID NO:69 and SEQ ID NO:70. Then, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (HFD1) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-12.

[0087] The plasmid p426-gRNA (GAL80) obtained in Example 1 (I) and the plasmid obtained in Example 1 (III) were used. GAL80 The knockout and integration fragment was transformed into the above-mentioned JS1-11 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. The single colonies that grew were verified by PCR using primers SEQ ID NO:71 and SEQ ID NO:72. Then, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (GAL80) plasmid, thus obtaining the recombinant Saccharomyces cerevisiae strain JS1-13.

[0088] The plasmid p426-gRNA (PDC5) obtained in Example 1 (I) and the knockout integration fragment obtained in Example 1 (IV) were used. ΔPDC5::P GAL10 -AROL-T ADH1 ; P GAL1 -ARO1-T CYC1 The cells were transformed into the above-mentioned JS1-13 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. The single colonies that grew were verified by PCR using primers SEQ ID NO:73 and SEQ ID NO:74. Then, the colonies were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (PDC5) plasmid, thus obtaining the recombinant strain JS1-14.

[0089] The plasmid p426-gRNA (PHA2) obtained in Example 1 (I) and the knockout integration fragment obtained in Example 1 (IV) were used. ΔPHA2::P GAL10 -ARO4 K229L -T ADH1 ; P GAL1 -ARO7 G141S -T CYC1 The cells were transformed into the above-mentioned JS1-14 competent cells and cultured on SC-LEU-URA plates at 30°C for 2-4 days. Single colonies were verified by PCR using primers SEQ ID NO:75 and SEQ ID NO:76. Then, the cells were streaked onto SC-LEU plates containing 1 mg / mL of 5-fluoroorotic acid to remove the intracellular p426-gRNA (PHA2) plasmid. The cells were then passaged in SC complete medium to remove the p415-TEF2-Cas9 plasmid, resulting in the recombinant strain JS1-15.

[0090] Table 1 Primers used for PCR amplification and their corresponding sequence information.

[0091] Example 2: Construction of engineered brewer's yeast

[0092] The plasmids pRS424-HmaS / 4VPMT1 and pRS425-BFD / HMO constructed in Example 1 (II) were transformed into JS1-15 competent cells in Example 1 (V) and cultured on SC-TRP-LEU plates at 30°C for 2-4 days to obtain the engineered Saccharomyces cerevisiae strain JS1-P1.

[0093] Example 3

[0094] Empty vector plasmids pRS424-HmaS / 4VPMT1 and pRS425-BFD / HMO were transformed into the above-mentioned JS1-15 competent cells and cultured on SC-TRP-LEU plates at 30℃ for 2-4 days to obtain the recombinant Saccharomyces cerevisiae strain JS1-P0.

[0095] The engineered Saccharomyces cerevisiae strain JS1-P1 prepared in Example 2 and the above-mentioned recombinant Saccharomyces cerevisiae strain JS1-P0 were respectively inoculated into 2 mL of SC-TRP-LEU liquid medium for culture. Then, they were inoculated into 20 mL of SC-TRP-LEU liquid medium at a 1:100 ratio for scale-up culture. Fermentation was carried out at 30℃ and 200 rpm for 120 h. Oddi concentrations (OD) were measured at 12, 24, 48, 72, 96, and 120 h. 600 The yield of anisaldehyde was determined by liquid chromatography.

[0096] Qualitative and quantitative analysis of anisaldehyde: 400 μL of the fermentation broth was aspirated and mixed with 400 μL of 100% ethanol. The mixture was centrifuged at 14000 rpm for 5 min and filtered into a liquid chromatography bottle. Analysis was performed using a Shimadzu high-performance liquid chromatograph with a photodiode array detector (275 nm wavelength). The chromatographic conditions were: 0 min, 95% solvent A + 5% solvent B; 8 min, 20% solvent A + 80% solvent B; 10 min, 80% solvent A + 20% solvent B; 11 min, 95% solvent A + 5% solvent B. A Shimadzu C18 column (4.6 × 250 mm, 5 μm) was used at a flow rate of 1 mL / min. The mobile phase consisted of solvent A (0.1% trifluoroacetic acid aqueous solution) and solvent B (0.1% trifluoroacetic acid acetonitrile solution). The column temperature was 35℃, and the injection volume was 10 μL. The anisaldehyde content was determined.

[0097] Liquid chromatography detection results as follows Figure 2 As shown; the growth curve and fermentation yield of the recombinant strain are as follows. Figure 3 As shown, the JS1-P1 strain, using glucose as a carbon source, fermented for about 48 hours and achieved a maximum anisaldehyde yield of 8.12±2.63 mg / L.

[0098] In summary, this invention uses the recombinant Saccharomyces cerevisiae strain JS1-15 as the original strain and heterologously expresses 4-hydroxymandelic acid synthase. HmaS Heme oxygenase HMO Benzoylcarboxylate decarboxylase BFD and methyltransferase 4VPMT1 The engineered Saccharomyces cerevisiae strain was obtained; this engineered Saccharomyces cerevisiae strain can achieve a complete de novo biosynthesis pathway from 4-hydroxyphenylpyruvic acid to p-anisaldehyde using glucose as the sole carbon source, and has good potential for industrial application.

[0099] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A brewer's yeast strain capable of de novo synthesis of p-anisaldehyde, characterized in that, The engineered strain of Saccharomyces cerevisiae was obtained by heterologously expressing 4-hydroxymandelic acid synthase HmaS, heme oxygenase HMO, benzoylformate decarboxylase BFD, and methyltransferase 4VPMT1 using the recombinant strain JS1-15 as the original strain.

2. The engineered brewer's yeast according to claim 1, characterized in that, The recombinant strain JS1-15 of Saccharomyces cerevisiae was constructed by the following steps: (1) using Saccharomyces cerevisiae BY4741 as the original strain, knocking out the GAL80 gene of Saccharomyces cerevisiae BY4741 and the aldehyde accumulation-related genes AAD3, ARI1, YPR1, YDR541C, GCY1, SFA1, YDL124W, GRE3, GRE2, ADH6, ADH7 and HFD1 to obtain the recombinant strain JS1-13 of Saccharomyces cerevisiae; (2) integrating shikimate kinase AROL and shikimate dehydrogenase ARO1 into the PDC5 gene site of the recombinant strain JS1-13 of Saccharomyces cerevisiae to obtain the recombinant strain JS1-14 of Saccharomyces cerevisiae; (3) integrating 3-deoxy-D-arabino-heptanulose-7-phosphate synthase ARO4 and branching acid mutase ARO7 into the PHA2 gene site of the recombinant strain JS1-14 of Saccharomyces cerevisiae to obtain the recombinant strain JS1-15 of Saccharomyces cerevisiae.

3. The method for constructing the engineered Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, Includes the following steps: (1) Expression fragments of genes HmaS, 4VPMT1, BFD and HMO were obtained by PCR amplification, and then ligated with the enzyme-digested vector plasmids to obtain recombinant plasmids pRS424-HmaS / 4VPMT1 and pRS425-BFD / HMO. (2) The recombinant plasmid described in step (1) is transferred into competent cells of recombinant Saccharomyces cerevisiae strain JS1-15. After positive clone verification, the engineered Saccharomyces cerevisiae strain is obtained.

4. The construction method according to claim 3, characterized in that, The PCR amplification primers for the HmaS gene are HmaS_P1_fwd as shown in SEQ ID NO:77 and HmaS_P1_rev as shown in SEQ ID NO:78; The PCR amplification primers for the 4VPMT1 gene are 4VPMT1_P2_fwd as shown in SEQ ID NO:79 and 4VPMT1_P2_rev as shown in SEQ ID NO:80; The PCR amplification primers for the BFD gene are BFD_P1_fwd as shown in SEQ ID NO:81 and BFD_P1_rev as shown in SEQ ID NO:82; The PCR amplification primers for the HMO gene are HMO_P2_fwd as shown in SEQ ID NO:83 and HMO_P2_rev as shown in SEQ ID NO:

84.

5. The construction method according to claim 3, characterized in that, The PCR amplification conditions in step (1) were independently: 98℃ for 2 min, 98℃ for 15 s, 56℃ for 2 min, 72℃ for 4 min, for 30 cycles; 72℃ for 2 min.

6. The use of the engineered Saccharomyces cerevisiae according to claim 1 or 2, or the engineered Saccharomyces cerevisiae obtained by the construction method according to any one of claims 3-5, in the synthesis of p-anisaldehyde.

7. A method for synthesizing p-anisaldehyde, characterized in that, The engineered Saccharomyces cerevisiae of claim 1 or 2 is inoculated into the culture medium at an inoculation rate of 0.8-1.2% and cultured and fermented to obtain anisaldehyde.

8. The method according to claim 7, characterized in that, The fermentation temperature is 28-32℃, and the fermentation time is 24-72h; The fermentation process is accompanied by oscillation, with the oscillation frequency being 100-300 rpm.

9. The method according to claim 7, characterized in that, The carbon source in the culture medium is glucose.