Complex microbial inoculant and application thereof in starch degradation and biological fuel cell

By constructing a composite microbial agent and utilizing the precise functional division of genetically engineered Escherichia coli, Shewanella, and Geobacterium, the problem of low starch decomposition efficiency in microbial fuel cells was solved, achieving efficient starch degradation and bioelectric energy recovery, with significant environmental and economic benefits.

CN121825840APending Publication Date: 2026-04-10JIANGSU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202512044261.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-31
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

In existing microbial fuel cells, traditional electrogenic bacteria cannot directly decompose starch, resulting in unstable bacterial community structure, unclear metabolic pathways, and low electron transfer efficiency. Furthermore, the modified strains face problems such as excessive metabolic burden and accumulation of intermediate products.

Method used

A composite microbial agent was constructed, composed of genetically engineered Escherichia coli, Shewanella, and Geobacterium. By displaying amylase and glucose dehydrogenase on its surface, it achieves efficient degradation and energy conversion of starch, forming an efficient "metabolic pipeline" to solve the problem of complex "metabolic pipelines" by dividing the complex "metabolic pipelines" into efficient ones. This includes rapidly converting starch into easily usable monosaccharides and achieving efficient electricity generation through precise functional division.

Benefits of technology

It improves overall energy conversion efficiency, significantly enhances power generation performance, achieves a coulombic efficiency of over 90%, and significantly increases current and power density, realizing significant environmental and economic benefits from wastewater purification and bioelectricity recovery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825840A_ABST
    Figure CN121825840A_ABST
Patent Text Reader

Abstract

The invention provides a complex microbial inoculant and application thereof in degradation of starch and biofuel cells, and belongs to the cross technical field of environmental biotechnology and bioelectrochemistry. According to the invention, a complex microbial inoculant composed of three microorganisms is constructed through a synthetic biological strategy; the complex microbial inoculant comprises genetically engineered Escherichia coli capable of rapidly converting starch into monosaccharide easy to use, shewanella for bearing upstream metabolites and geobacter for generating electricity, wherein the genetically engineered Escherichia coli is used for rapidly converting starch into monosaccharide easy to use; according to the invention, through precise function division of three strains, a complex degradation and power generation process is decomposed into a plurality of sub-steps catalyzed by special strains, so that an efficient'metabolic assembly line 'is formed, the inhibition of intermediate products is reduced, and the overall energy conversion efficiency is improved; the complex microbial inoculant can be used for degrading starch and preparing microbial fuel cells, realizes wastewater purification and recovery of bioelectric energy at the same time, and has remarkable environmental and economic benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the interdisciplinary field of environmental biotechnology and bioelectrochemistry, specifically relating to a composite microbial agent and its application in starch degradation and biofuel cells. Background Technology

[0002] Starch is one of the most abundant polysaccharides in nature, widely found in grain crops, agricultural product processing by-products, and agricultural by-product processing wastewater. Traditional wastewater treatment methods for starch-rich wastewater suffer from problems such as long treatment cycles, high energy consumption, and lack of resource recovery. While microbial fuel cell technology can simultaneously treat wastewater and recover electrical energy, its performance is heavily dependent on the microbial catalyst used.

[0003] In existing MFC technologies, commonly used electrogenic bacteria (such as *Geobacterium*) typically lack the ability to directly decompose large polysaccharides (such as starch). If starch is used directly as a substrate, it relies on hydrolytic bacteria in its natural microbial community for prior degradation, a process plagued by unstable microbial community structure, unclear metabolic pathways, and low electron transfer efficiency. While genetically modifying a single strain to impart hydrolytic ability is one approach, the modified strains often face challenges such as excessive metabolic burden, accumulation of intermediate products, and low electron yield. Therefore, there is a need to develop a biofuel cell capable of efficiently degrading starch and efficiently generating electricity from it. Summary of the Invention

[0004] To address some shortcomings in existing technologies, this invention provides a composite microbial agent and its application in starch degradation and biofuel cells. This invention constructs a composite microbial agent composed of three microorganisms using a synthetic biology strategy. The composite microbial agent includes genetically engineered *Escherichia coli* that rapidly converts starch into readily usable monosaccharides, *Shewanella* that receives upstream metabolites, and *Geobacterium* for electricity generation. Through precise functional division of labor among the three strains, this invention breaks down the complex degradation and electricity generation process into multiple sub-steps catalyzed by specialized strains, forming a highly efficient "metabolic pipeline," reducing intermediate product inhibition, and improving overall energy conversion efficiency. This composite microbial agent can be used to degrade starch and prepare biofuel cells, simultaneously purifying wastewater and recovering bioenergy, resulting in significant environmental and economic benefits.

[0005] To achieve the above-mentioned technical objectives, the present invention employs the following technical means:

[0006] The present invention first provides a compound microbial agent, which includes genetically engineered Escherichia coli, Shewanella, and Geobacterium, whose surfaces co-exhibit amylase and glucose dehydrogenase.

[0007] Preferably, the method for constructing the genetically engineered Escherichia coli includes:

[0008] (1) The gene encoding glucose amylase and the gene encoding glucose dehydrogenase were cloned into the plasmid pET28a-INP, which displays anchored proteins, to obtain a recombinant expression vector.

[0009] (2) The obtained recombinant expression vector was transformed into the host bacterium Escherichia coli and induced to express, resulting in genetically engineered Escherichia coli with amylase and glucose dehydrogenase co-displaying on the cell surface.

[0010] Preferably, in step (1), the nucleotide sequence of the gene encoding amylase is shown in SEQ ID No:1;

[0011] The nucleotide sequence of the gene encoding glucose dehydrogenase is shown in SEQ ID No:2.

[0012] Preferably, in step (1), the method for constructing the plasmid pET28a-INP, which displays the anchored protein on its surface, includes:

[0013] A fragment of the anchoring protein INP gene was cloned into the pET28a plasmid to obtain the plasmid pET28a-INP that displays the anchoring protein on the surface.

[0014] The nucleotide sequence of the fragment of the anchoring protein INP gene is shown in SEQ ID No:3.

[0015] Preferably, in step (2), the host bacterium Escherichia coli includes Escherichia coli BL-21.

[0016] Preferably, the Shewanella includes Shewanella MR-1;

[0017] The Geobacter species include Geobacter sulfurreducens PCA.

[0018] Preferably, in the compound bacterial agent, the ratio of the number of live Escherichia coli, Shewanella, and Geobacterium is 1:2:1.

[0019] Preferably, the method for preparing the compound microbial agent includes: expanding the culture of genetically engineered Escherichia coli, Shewanella and Geobacterium, and mixing them in a certain proportion to obtain the compound microbial agent.

[0020] This invention also provides the application of the above-mentioned composite microbial agent in the degradation of starch or in the construction of biofuel cells.

[0021] The present invention also provides a biofuel cell, wherein the anode chamber of the biofuel cell is filled with an anolyte containing starch and a composite bacterial agent; and the cathode chamber is filled with a potassium ferricyanide solution.

[0022] Preferably, the anolyte comprises wastewater, waste containing starch, or a culture medium prepared with starch as the main carbon source;

[0023] Add OD to every 30 mL of anolyte 600 =24 compound bacterial agent, wherein the starch content in the anolyte is 0.3 g / L;

[0024] The volume ratio of the anolyte to the potassium ferricyanide solution is 30 mL: 30 mL.

[0025] The present invention also provides a method for degrading starch and generating electricity using the above-mentioned biofuel cell, the method comprising: operating the above-mentioned biofuel cell under anaerobic conditions, wherein a composite microbial agent degrades starch and generates current through synergistic metabolism, and collecting the generated current.

[0026] Preferably, when operating the biofuel cell, the anode chamber temperature is controlled at 25-37°C and the pH value is 6.5-7.5.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] (1) The composite microbial agent of this invention comprises a "human hydrolysis module" of genetically engineered *Escherichia coli*, a "fermentation module" of *Shewanella*, and a "power generation module" of *Geotrichum*. First, this invention uses surface display technology to co-display amylase and glucose dehydrogenase on the surface of *E. coli* to obtain genetically engineered *E. coli*. This genetically engineered *E. coli* can act as a "pioneer degrading bacterium," rapidly converting starch into readily available monosaccharides and further into products such as gluconic acid, and producing lactic acid. Next, the "fermentation module" of *Shewanella* receives upstream metabolites, utilizing the metabolic byproduct lactic acid from the genetically engineered *E. coli* and generating acetic acid. Finally, the "power generation module" of *Geotrichum* completes the "last mile" of electron transfer. As a highly efficient power-generating bacterium, it oxidizes the product acetic acid from *Shewanella* into carbon dioxide and transfers the electrons generated during metabolism to the anode, thereby generating an electric current. The composite microbial agent of this invention, through the precise functional division of the three strains, decomposes the complex degradation and power generation process into multiple sub-steps catalyzed by specialized strains, forming a highly efficient "metabolic pipeline," reducing intermediate product inhibition and improving overall energy conversion efficiency. The coulombic efficiency of the microbial fuel cell prepared by the composite microbial agent described in this invention can reach over 90%, which is higher than most existing microbial fuel cells (whose coulombic efficiency is only between 20% and 60%).

[0029] (2) This invention modifies *Escherichia coli* using surface display technology, enabling the obtained genetically engineered *E. coli* to efficiently degrade starch extracellularly. This overcomes the bottleneck of traditional electrogenic bacteria's inability to directly utilize macromolecules, achieving direct and efficient utilization of macromolecular substrates. The composite bacterial agent described in this invention can be used to prepare microbial fuel cells. The composite bacterial agent constructs a complete and low-loss electron transport chain, enabling it to output higher and more stable current and power density in MFCs than single strains or natural bacterial populations, significantly improving power generation performance. Compared to the *E. coli* and *Shewanella* system, the current density is 750 mA / m². 2 It reaches its maximum power density at approximately 300 mW / m 2 The MFC current density of this invention is 2000 mA / m 2 It reaches its highest power density at approximately 800 mW / m 2 The current and power density are significantly improved.

[0030] (3) The composite microbial agent described in this invention and the microbial fuel cell prepared using the composite microbial agent have strong application targeting. They can be used to treat high-concentration starch wastewater generated by industries such as grain processing, brewing, and starch production. While purifying the wastewater, they can also recover bioelectric energy, which has significant environmental and economic benefits. Attached Figure Description

[0031] Figure 1 This is a schematic diagram illustrating the metabolic pathway and division of labor in which the compound microbial agent described in this invention degrades starch and generates electricity.

[0032] Figure 2 This is a schematic diagram of the surface display plasmid constructed in Example 1.

[0033] Figure 3 The figures show the voltage output curves of the MFC after inoculation with the compound bacterial agent and the control group over time. In the figure, a is the voltage-time curve of the MFC under different mixed bacterial systems, and b is the time-voltage curve of the MFC after inoculation with the compound bacterial agent.

[0034] Figure 4 The figure shows the electron release curve of MFC inoculated with the compound microbial agent of the present invention over time; in the figure, a is the electron release number-time curve of MFC under different mixed microbial systems, and b is the electron release number-time curve obtained after MFC is completely discharged after inoculation with the compound microbial agent. Detailed Implementation

[0035] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the scope of protection of the present invention is not limited thereto. In the embodiments of the present invention, unless otherwise described, conventional experimental methods are used. The processes involved in the embodiments, unless otherwise described, are those that can be understood and easily implemented by those skilled in the art based on the product manual or basic knowledge in the field, and therefore will not be described in detail.

[0036] Figure 1 This is a schematic diagram illustrating the metabolic pathway and division of labor in the degradation of starch and generation of electricity by the compound microbial agent described in this invention. Figure 1 It can be seen that, firstly, under the action of engineered Escherichia coli, starch is gradually degraded into glucose → gluconic acid → lactic acid, then Shewanella degrades lactic acid into acetic acid, and finally Geobacter further degrades acetic acid into carbon dioxide, thus achieving complete degradation of starch.

[0037] Example 1: Construction of engineered E. coli with surface display of amylase and glucose dehydrogenase

[0038] A fragment of the anchoring protein INP gene with a nucleotide sequence as shown in SEQ ID NO.3 was chemically synthesized, and then the fragment of the anchoring protein INP gene was cloned into the pET28a plasmid (purchased from Sangon Biotech Shanghai Co., Ltd.) to obtain the plasmid pET28a-INP displaying the anchoring protein on its surface.

[0039] The encoding gene of glucose dehydrogenase (GDH) was chemically synthesized (SEQ ID NO.2), and then the encoding gene of glucose dehydrogenase was cloned into the obtained surface-displaying anchor protein plasmid pET28a-INP to obtain the GDH surface-displaying plasmid pET28a-INP-GDH.

[0040] The gene encoding glucoamylase (GA) was chemically synthesized (SEQ ID NO.1), and then cloned into the GDH surface-displaying plasmid pET28a-INP-GDH to obtain the GA and GDH co-displaying vector pET28a-INP-GDH-GA, denoted as the recombinant expression vector (plasmid map shown). Figure 2 (As shown).

[0041] The obtained recombinant expression vector was transformed into *E. coli* BL21(DE3) competent cells (purchased from Sangon Biotech Shanghai Co., Ltd.) to obtain genetically engineered *E. coli* cells displaying glucosylamylase and glucose dehydrogenase on their surface. The genetically engineered *E. coli* cells were plated on LB agar plates containing kanamycin (50 μg / mL), and positive clones were screened. The strains exhibited kanamycin resistance, indicating that the co-display system used the lac promoter. IPTG was added as an inducer. In the presence of the inducer, it can bind to the lac repressor protein, initiating transcription and achieving induced expression. IPTG was used to induce protein expression.

[0042] Genetically engineered *E. coli* were picked from resistance plates and cultured overnight at 37°C and 180 rpm. The next morning, 1 mL of the bacterial culture was transferred to 100 mL of fresh LB medium (containing 50 μg / mL kanamycin) and incubated at 37°C and 180 rpm for approximately 2.5 hours, until the bacterial concentration reached OD500. 600 If the OD is greater than 0.8, add 0.5 mM IPTG solution and induce culture at 20°C. After 20 hours of culture, the engineered Escherichia coli culture with the target OD is obtained.

[0043] SEQ ID NO.1:

[0044]

[0045] SEQ ID NO.2:

[0046] Tatccggatttaaaaggaaaagtcgtcgctatcacaggagctgcttcaggattaggaaaggcaatggccattcgcttcggcaaggagcaggcgaaagtggtcatcaactattacagtaataaacaggatccaaacgaggtaaaagaagaggtcatcaaggcgggcggtgaagccattgtcgtccaaggagacgtaacgaaagaggaagatgtgaaaaatatcgttcaaacagcgattaaagagttcggcacactcgatattatgattaataatgccggtcttgaaaatcccgtgccgtctcatgaaatgccgctcaaggattgggaaaaagtcatcagcacgaacttaacgggcgcctttttaggaagccgtgaagcgattaaatattttgttgaaaacgatataaaaggaaatgtcattaatatgtcgagcgtacatgaagtgattccgtggccattatttgttcactatgcggcaagtaaaggcggaatcaagctgatgacggaaacattggcattggaatatgcgccgaaaggcattcgtgtcaacaatatcgggccaggcgcgatcaacacgccaatcaatgctgaaaaatttgctgatcctaagcagagagcagatgtagaaagcatgattccgatgggatatatcggtgaaccggaggaaattgcggcagtggcagcctggcttgcttcgaaggaagccagctacgtcacaggcattacgttattcgcggacggcggtatgacacaatacccttcattccaggcaggccgcggt;

[0047] SEQ ID NO.3:

[0048] Gcatgaacgatgacaaagttttggtcttgcgcacctgtgccaataacatggccgatcactgcggccagatatggcctgtttccggtgttgtcgaatgtaaatattgggaacccacccgaaagct cgagaatgggctggccgggctgctatggggcaaaggggcgagcacgcatttgaatatgcaggctgacgcccggtgggttatttgtgaagttgcggtgagcgatatcatctttctggatgcgcagg gcggggtcaagtttccgcgtgctgaagttgttcacgtcggcacaagaaacagcgcggcgggctatatttcggcgaatattgccagttatgcgtcttccacagttgcgttgaatgaaacatttgt ttttcctgaagttcgcacagaaacgaaggtggatttccccgcttcgcccgcgaccgctgatagcacttttgatattgatcgacacgcaactattcaaggcccacaaacgctggagacagcggtg.

[0049] Example 2: Construction and power generation performance testing of MFC based on compound microbial agent

[0050] In this embodiment, a compound microbial agent was first prepared, and then the compound microbial agent was inoculated into wastewater or waste containing starch, or into a culture medium prepared with starch as the main carbon source, and used as the anolyte for the assembly of a microbial fuel cell. The specific steps are as follows:

[0051] (1) Preparation of compound microbial agents:

[0052] The genetically engineered Escherichia coli obtained in Example 1 was cultured on a larger scale, and the bacterial cells were collected by centrifugation and resuspended in sterile PBS to obtain the genetically engineered Escherichia coli bacterial solution.

[0053] Shewanella MR-1 (purchased from the National Culture Collection Center, international number: ATCC 700550) and Geobacter sulfurreducens PCA (purchased from the National Culture Collection Center, international number: ATCC 51573) were cultured and expanded. The bacterial cells were collected by centrifugation and resuspended in sterile PBS to obtain MR-1 bacterial suspension and Geobacter sulfurreducens PCA bacterial suspension.

[0054] Genetically engineered Escherichia coli culture, MR-1 culture, and Geobacter sulfurreducens PCA culture were mixed at a live bacteria ratio of 1:2:1 to obtain a compound bacterial agent.

[0055] (2) Assembly and operation of microbial fuel cells (MFC):

[0056] Using M9 buffer solution containing 0.3 g / L soluble starch as simulated wastewater, 30 mL of simulated wastewater was added as anolyte to the anode chamber of the microbial fuel cell. The anolyte can also be wastewater containing starch, waste, or a culture medium prepared with starch as the main carbon source.

[0057] The compound bacterial agent obtained in step (1) was inoculated into the anolyte, and OD was added to every 30 mL of anolyte. 600 A compound bacterial agent of 24 was used. 30 mL of potassium ferricyanide solution (K3[Fe(CN)6]: 32.94 g / L; KCl: 3.73 g / L; Na2HPO4·12H2O: 17.8 g / L; KH2PO4·3H2O: 3 g / L) was added to the cathode chamber. The cathode chamber and anode chamber were isolated by a proton exchange membrane. A 2 kΩ fixed resistor was connected to the external circuit to obtain a microbial fuel cell.

[0058] The microbial fuel cell was operated under a constant temperature condition of 30°C, and its output voltage and power density were monitored. The results are as follows: Figure 3 and Figure 4 As shown. From Figure 3 As can be seen, the MFC constructed by inoculating with the compound bacterial agent exhibits the best electrogenic performance, with a maximum voltage exceeding 0.6V and a discharge time exceeding 160 hours. Figure 4 As can be seen, the MFC constructed by inoculating the compound bacterial agent released the most electrons, reaching 117 electrons. The blank control group produced 10 electrons. Under the experimental conditions, the theoretical number of electrons that can be produced is 115.58. Through calculation, the coulombic efficiency reached 92%.

[0059] As can be seen, the MFC assembled with the composite microbial agent of this invention has a maximum output voltage of 0.65V and a maximum power density of 800mW / m³. 2 The efficiency was significantly higher than that of the control group, which was inoculated with only Shewanella or Geobacter or a mixture of Shewanella and Geobacter. Furthermore, calculations showed that the coulombic efficiency of the MFC assembled from the composite microbial agent described in this invention reached over 90%, achieving complete utilization of the intermediate products.

[0060] In summary, this invention constructs a composite microbial agent composed of three microorganisms using a synthetic biology strategy. The composite microbial agent includes genetically engineered *Escherichia coli* that rapidly converts starch into readily usable monosaccharides, *Shewanella* that receives upstream metabolites, and *Geobacterium* for electricity generation. Through precise functional division of labor among the three strains, this invention breaks down the complex degradation and electricity generation process into multiple sub-steps catalyzed by specialized strains, forming a highly efficient "metabolic pipeline," reducing intermediate product inhibition, and improving overall energy conversion efficiency. This composite microbial agent can be used to degrade starch and prepare microbial fuel cells, simultaneously purifying wastewater and recovering bioenergy, resulting in significant environmental and economic benefits.

[0061] The embodiments described above are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essence of the present invention shall fall within the protection scope of the present invention.

Claims

1. A complex microbial agent, characterized in that, The complex microbial agent comprises genetically engineered Escherichia coli, Shewanella and Geobacter, which co-display amylase and glucose dehydrogenase on the surface.

2. The complex bacterial agent according to claim 1, characterized by, The construction method of the genetically engineered Escherichia coli comprises: (1) cloning a gene encoding glucose amylase and a gene encoding glucose dehydrogenase into a plasmid pET28a-INP displaying an anchor protein on the surface to obtain a recombinant expression vector; (2) transforming the obtained recombinant expression vector into a host bacterium Escherichia coli, inducing expression to obtain genetically engineered Escherichia coli co-displaying amylase and glucose dehydrogenase on the cell surface.

3. The complex microbial agent according to claim 2, characterized in that, In step (1) of the method, the nucleotide sequence of the gene encoding amylase is shown in SEQ ID No: 1; the nucleotide sequence of the gene encoding glucose dehydrogenase is shown in SEQ ID No: 2; The construction method of the plasmid pET28a-INP displaying an anchor protein on the surface comprises: cloning a fragment of the anchor protein INP gene into a pET28a plasmid to obtain the plasmid pET28a-INP displaying an anchor protein on the surface; The nucleotide sequence of the fragment of the anchor protein INP gene is shown in SEQ ID No:

3.

4. The complex microbial agent according to claim 2, characterized in that, In step (2), the host bacterium Escherichia coli comprises Escherichia coli BL-21.

5. The complex microbial agent according to claim 1, characterized in that, The Shewanella comprises Shewanella MR-1; The Geobacter comprises Geobacter sulfurreducens PCA; In the complex microbial agent, the ratio of the number of viable bacteria of the genetically engineered Escherichia coli, Shewanella and Geobacter is 1:2:

1.

6. The complex microbial agent according to claim 1, characterized in that, The preparation method of the complex microbial agent comprises: separately culturing the genetically engineered Escherichia coli, Shewanella and Geobacter, mixing them in proportion to obtain the complex microbial agent.

7. The use of the complex microbial agent of claim 1, or a composition comprising the complex microbial agent of claim 1, in degrading starch or constructing a biofuel cell.

8. A biofuel cell characterized by The anode chamber of the biofuel cell is added with an anode solution containing starch and the complex microbial agent of claim 1; and the cathode chamber is added with a potassium ferricyanide solution.

9. The biofuel cell of claim 8, wherein, The anode solution comprises wastewater, waste or a culture medium configured to contain starch as the main carbon source; OD was added per 30 mL of anolyte 600 = 24, the content of starch in the anolyte being 0.3 g / L; The volume ratio of the anode solution to the potassium ferricyanide solution is 30 mL:30 mL.

10. A method for degrading starch and generating electricity using the biofuel cell according to claim 8, characterized by, The method comprises: operating the biofuel cell of claim 8 under anaerobic conditions, the complex microbial agent degrading starch through synergistic metabolism and generating an electric current, and collecting the generated electric current.