T4RNA ligase 2 mutant as well as preparation method and application thereof

By mutating T4 RNA ligase 2 at specific sites, mutants with improved thermostability and ligation activity were obtained, solving the problem of byproducts caused by base mismatches. This enabled efficient ligation of RNA and DNA hybrid double strands at high temperatures, improving the purity and yield of nucleotide chains, and making it suitable for large-scale RNA drug production.

CN121825907APending Publication Date: 2026-04-10ZHAOWEI BIOTECHNOLOGY PRIVATE INVESTMENT CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610103047.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-23
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The existing T4 RNA ligase 2 is prone to producing byproducts due to base mismatches when ligating oligonucleotide fragments, which leads to a decrease in the purity and yield of the target nucleotide chain, especially in the synthesis of long RNA chains where it is difficult to effectively remove non-target nucleotide chains.

Method used

By mutating specific amino acid sites on T4 RNA ligase 2, mutants with improved thermostability and ligation activity were obtained. These mutants can ligate modified nucleic acid substrates at high temperatures, reducing byproducts caused by base mismatches and improving nucleotide chain synthesis efficiency.

Benefits of technology

This method enables efficient ligation of RNA and DNA hybrid double strands at high temperatures, reducing byproducts and improving the purity and yield of nucleotide chains, making it suitable for large-scale, high-quality RNA drug production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121825907A_ABST
    Figure CN121825907A_ABST
Patent Text Reader

Abstract

The invention discloses a T4RNA ligase 2 mutant and a preparation method and application thereof, and relates to the field of biology and enzyme engineering, the T4RNA ligase 2 mutant provided by the invention has mutation at at least one site of 62th, 103th, 166th, 193th, 260th, 297th, 298th, 303th, 306th, 311th, 313th and 318th sites of a wild type T4Rnl2 sequence, compared with the wild type, the thermal stability of the mutant is obviously improved, and the T4RNA ligase 2 mutant can be used for preparing a T4RNA ligase 2 mutant. High ligase activity can be maintained at high temperatures such as 45 DEG C and 50 DEG C; in addition to being connected with a natural nucleic acid sequence, the mutant can also be connected with a non-natural nucleic acid with modification at high temperature. According to the mutant provided by the invention, ribonucleic acid can be synthesized at high temperature, so that by-products caused by base mismatch are effectively reduced, the RNA synthesis efficiency is improved, and large-scale high-quality RNA production is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application. The original application was filed on January 23, 2025, with application number 202510110925X and titled "T4 RNA ligase 2 mutant and its preparation method and application". Technical Field

[0002] This invention relates to the fields of biology and enzyme engineering, and more specifically, to T4 RNA ligase 2 mutants, their preparation methods, and applications. Background Technology

[0003] RNA drugs are a novel class of drugs that have attracted much attention in recent years, and are widely studied in the treatment of various diseases, including cancer, rare diseases, gastrointestinal diseases, cardiovascular diseases, and metabolic disorders. Compared with the development of traditional small molecule drugs and protein drugs, RNA drugs have many advantages, such as rapid synthesis, high targeting, and high personalization. RNA drugs can be broadly classified into four categories: RNA aptamers, antisense oligonucleotides (ASO), RNA interference drugs (miRNA and siRNA), and messenger RNA (mRNA). Besides being used as RNA drugs, RNA also plays an important role in gene editing technology. In the widely used CRISPR-Cas gene editing technology, single-stranded guide RNA (gRNA) can form a complex with the DNA endonuclease Cas and locate the gene site to be edited through complementary pairing, initiating the Cas-mediated gene editing process. With the rise of RNA products in the pharmaceutical field, the demand for RNA synthesis is increasing year by year.

[0004] Currently, RNA chemical synthesis generally involves tandemly extending ribonucleotide residues one base at a time to prepare the target nucleotide chain. Since the efficiency of ribonucleotide chain chemical synthesis cannot reach 100%, the purity and yield of the synthesized target ribonucleotide chain decrease with increasing target nucleotide chain length, resulting in the presence of a certain amount of non-target nucleotide chains in the synthesized product that do not match the target nucleotide chain length.

[0005] For chemically synthesized nucleotide chains with a length of 20 nt or less, purification processes (e.g., ion exchange column or reverse column) can increase the proportion of the final target nucleotide chain in the synthetic product. However, because some non-target nucleotide chains are very close in length to the target nucleotide chain (e.g., the length of the non-target nucleotide chain differs from the target nucleotide chain by only 1 nt or 2 nt), their properties are extremely similar to the target nucleotide chain, making it impossible to effectively separate and remove these non-target nucleotide chains from the synthetic product. For nucleotide chains longer than 20 nt, especially those longer than 50 nt, or even longer than 100 nt, chemical synthesis results in even more non-target nucleotide chains failing to be effectively separated and removed from the synthetic product.

[0006] The presence of non-target nucleotide chains in the synthetic product often affects the function and activity of the target drug, especially when the target nucleotide chain is an antisense nucleotide drug, siRNA drug, nucleic acid aptamer drug, or sgRNA. The presence of non-target nucleotide chains can seriously affect the efficacy of the target nucleotide chain.

[0007] Currently, oligonucleotide fragments can be ligated using ligases to obtain target nucleotide chains, thereby increasing the yield of target nucleotide chains and reducing impurities. For methods using ligases to obtain target nucleotide chains by ligating oligonucleotide fragments, the ligase catalyzing the double-stranded RNA ligation reaction is crucial. The most commonly used and most thoroughly studied RNA double-stranded ligase is T4 RNA ligase 2.

[0008] T4 RNA ligase 2 (T4 Rnl 2) is an RNA ligase isolated from T4 bacteriophage. T4 Rnl 2 is an ATP-dependent 5′–3′ RNA ligase (EC 6.5.1.3) that efficiently catalyzes the ligation of nicks in double-stranded RNA and RNA nicks fixed in DNA clips. T4 Rnl 2 catalyzes the ligation of nucleic acid substrates through a three-step reaction: First, Lys 35 on T4 Rnl 2 reacts with ATP to form a ligase-AMP intermediate, releasing pyrophosphate. Then, AMP is transferred to the 5′-PO4 (donor) at the nick, forming an RNA–adenylate intermediate (AppRNA). Finally, the ligase drives the 3′-OH (acceptor) at the RNA nick to attack the AppRNA, forming a phosphodiester bond, sealing the nick, and releasing AMP. As the most commonly used RNA ligase in small RNA synthesis, T4 Rnl2 has advantages such as high ligation rate, no sequence bias, and compatibility with various modified nucleosides. However, in actual production processes, especially when multi-fragment ligation is involved, misligation often occurs due to base mismatches in the ligation substrate, resulting in byproducts. The presence of these byproducts reduces the yield of the target product and increases the difficulty of purification.

[0009] In view of this, the present invention is proposed. Summary of the Invention

[0010] The purpose of this invention is to provide a T4 RNA ligase 2 mutant, its preparation method, and its application.

[0011] This invention is implemented as follows: In a first aspect, embodiments of the present invention provide a T4 RNA ligase 2 mutant, which, compared with wild-type T4 RNA ligase 2, has mutations at any one or more of the following positions in the amino acid sequence of wild-type T4 RNA ligase 2: positions 62, 103, 166, 168, 193, 217, 260, 297, 298, 303, 306, 311, 313, and 318.

[0012] Secondly, embodiments of the present invention provide an isolated nucleic acid that encodes the T4 RNA ligase 2 mutant described in the foregoing embodiments.

[0013] Thirdly, embodiments of the present invention provide a carrier containing the isolated nucleic acid described in the foregoing embodiments.

[0014] Fourthly, embodiments of the present invention provide a host cell containing the vector described in the foregoing embodiments.

[0015] Fifthly, embodiments of the present invention provide a method for preparing the T4 RNA ligase 2 mutant as described in the foregoing embodiments, which includes: culturing the host cells described in the foregoing embodiments.

[0016] Sixthly, embodiments of the present invention provide the use of the T4 RNA ligase 2 mutant as described in the foregoing embodiments in the synthesis of target nucleotide chains or in the preparation of products for the synthesis of target nucleotide chains.

[0017] The present invention has the following beneficial effects: (1) By rationally designing T4 RNA ligase 2, a group of T4 RNA ligase 2 mutants were obtained. The thermostability of the mutants was significantly improved and they were able to maintain high ligase activity. Compared with wild-type T4 RNA ligase 2, the thermostability mutants still had high ligase activity at high temperatures such as 45℃ and 50℃. (2) In addition to ligating natural RNA sequences, the T4 RNA ligase 2 mutant provided in this embodiment of the invention can also ligate modified nucleic acid substrates at high temperature; (3) The T4 RNA ligase 2 mutant provided in this embodiment of the invention can achieve the ligation of double-stranded nucleic acid molecules with notches at high temperature to synthesize RNA double strands and / or RNA / DNA hybrid double strands, thereby reducing the generation of byproducts due to base mismatch, improving the efficiency of nucleotide chain synthesis, and facilitating the large-scale and high-quality production of nucleic acid drugs. Attached Figure Description

[0018] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram of a rapid detection scheme for RNA ligase activity. Figure 2 Scatter plots showing Tm values ​​and residual activity for T4 Rnl2 single-point and double-point mutants; where A~E correspond to experimental batches 1~5; Figure 3 Scatter plot of Tm values ​​and residual activity for T4 Rnl2 multi-point combination mutants; Figure 4 The ligase activity of the T4 Rnl2 ligase mutant at different temperatures was measured. Figure 5Figure A shows the SDS-PAGE results of proteins in the supernatant after heating T4 Rnl2 and its mutants at 45℃ for 1 h and 16 h, or at 50℃ for 1 h and 4 h, respectively, followed by high-speed centrifugation; Figure B shows the ratio of supernatant protein content after different temperature treatments to that after incubation at 4℃, obtained by integrating the grayscale values ​​of each electrophoretic band in Figure A. Figure 6 The oligonucleotides and their ligation products used in Example 6; Figure 7 The ribonucleotide fragments and their ligation products used in Example 7; Figure 8 The oligonucleotides and their ligation products used in Example 8; Figure 9 The oligonucleotides and their ligation products used in Example 9; Figure 10 The oligonucleotides and their ligation products used in Example 10 are shown. Detailed Implementation

[0020] The following description uses a number of technical terms. To ensure a clearer and more consistent understanding of the specification and claims, including the scope of these terms, the following definitions are provided.

[0021] Oligonucleotides: Generally, they refer to linear polynucleotide fragments consisting of 2 to 10 nucleotide residues linked by phosphodiester bonds. However, it should be noted that there is no strict rule regarding the number of nucleotides in oligonucleotides. In some literature, polynucleotide molecules containing 30 or even more, up to 200, 300, 400, or 500 nucleotide residues, can also be called oligonucleotides.

[0022] Natural ribonucleotides are composed of one molecule of phosphate, one molecule of ribose (a pentose sugar), and one nitrogenous base. Based on the type of nitrogenous base, ribonucleotides are classified into adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, and uracil ribonucleotides.

[0023] 2'-Deoxyribonucleotides: Composed of one molecule of phosphate, one molecule of 2'-deoxyribose (the 2' of the ribose undergoes deoxygenation, becoming a hydrogen atom), and one nitrogenous base. Based on the type of nitrogenous base, naturally occurring 2'-deoxyribonucleotides are classified into adenine deoxyribonucleotides, guanine deoxyribonucleotides, cytosine deoxyribonucleotides, and thymine deoxyribonucleotides.

[0024] Non-natural nucleotides: Nucleotides produced by modifying the phosphate groups, nitrogenous bases, sugar rings, and glycosidic bonds of natural nucleotides.

[0025] RNA: A molecule formed by natural or non-natural ribonucleotides linked by phosphodiester bonds. While typical RNA molecules are linked together by standard phosphodiester bonds, RNA used as a drug may contain one or more non-standard bonds. RNA can be single-stranded or double-stranded, or contain both single-stranded and double-stranded regions. Furthermore, ribonucleotides can be classified according to their morphology into linear ribonucleotide chains and cyclic ribonucleotide chains. Cyclic ribonucleotide chains consist of one or more linear ribonucleotide chains linked end-to-end by phosphodiester bonds, forming a closed ring structure.

[0026] DNA: refers to molecules formed by 2' deoxyribonucleotides linked together by phosphate ester bonds.

[0027] As used in this article, "wild type" refers to the form found in nature. For example, wild type protein sequences are forms found in nature that can be isolated from natural sources and have not been intentionally modified or altered by humans.

[0028] In this article, the term "nick" refers to the absence of a phosphodiester bond between two adjacent nucleotide segments in a double-stranded structure. A nick can be catalyzed by double-strand ligase to form a complete phosphodiester bond; that is, the 3' hydroxyl group of one nucleotide unit at the nick site forms a complete phosphodiester bond with the 5' monophosphate group of the other nucleotide unit at the same nick site through double-strand ligase catalysis. A "nick" can also be understood as a gap in a double-stranded nucleic acid molecule caused by the breakage of a phosphodiester bond.

[0029] The term "gap" in this article refers to a situation in which one strand of a double-stranded structure breaks into two strands due to the absence of one or more consecutive nucleotides, and these two strands form a gap.

[0030] The nucleic acid substrates described in this article are oligonucleotides capable of forming nicked double-stranded nucleic acid molecules, wherein the 5' end of the oligonucleotide contains a monophosphate group and / or the 3' end contains a hydroxyl group.

[0031] The term "denaturation" in this article refers to the process of breaking the hydrogen bonds between double-stranded nucleic acids, such as double-stranded DNA, double-stranded RNA, or DNA / RNA base pairs, through high-temperature incubation, thereby converting double-stranded nucleic acids into single-stranded nucleic acids.

[0032] The term "annealing" in this article refers to the process of slowly cooling a nucleic acid solution that has been denatured at high temperatures to a lower temperature, allowing single-stranded nucleic acids to reform into double-stranded nucleic acids.

[0033] This article uses the term "sequence identity percentage (%)" to refer to comparisons between polynucleotides and peptides, and it is determined by comparing two optimally aligned sequences across a comparison window. For optimal alignment of the two sequences, the portion of the polynucleotide or peptide sequence in the comparison window compared to the reference sequence may contain additions or deletions (i.e., vacancies). The percentage can be calculated as follows: determine the number of positions in both sequences where the same nucleic acid base or amino acid residue appears to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Alternatively, the percentage can be calculated as follows: determine the number of positions in both sequences where the same nucleic acid base or amino acid residue appears, or the number of positions where the nucleic acid base or amino acid residue is aligned with a vacancy to obtain the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Those skilled in the art will understand that there are currently various algorithms available for sequence alignment, such as the Smith-Waterman local homology algorithm (Smith and Waterman, Adv. Appl. Math., 2:482

[1981] ) and the Needleman-Wunsch global homology alignment algorithm (Needleman and Wunsch, J. Mol. Biol., 48:443

[1970] ). These algorithms have been designed into related software, which researchers in the field can use to quickly align protein or nucleotide sequences, such as the open software EMBOSS Water (https: / / www.ebi.ac.uk / jdispatcher / psa / emboss_water) based on the Smith-Waterman algorithm developed by the European Institute for Bioinformatics (EMBL-EBI) and the EMBOSS needle software (https: / / www.ebi.ac.uk / jdispatcher / psa / emboss_needle) based on the Needleman-Wunsch algorithm. Protein sequence alignment and sequence alignment consistency percentage (%) can be performed using the open-source software EMBOSS Water. The scoring matrix used during alignment is BLOSUM62, with the gap open score set to 10 and the gap extend score set to 1.

[0034] A “reference sequence” refers to a designated sequence used as the basis for sequence comparison. A reference sequence can be a subset of a larger sequence, such as a segment of a full-length gene or polypeptide sequence. Typically, a reference sequence is at least 20 nucleotides or amino acid residues long, at least 25 residues long, at least 50 residues long, at least 100 residues long, or the full length of a nucleic acid or polypeptide. Since two polynucleotides or polypeptides can each (1) contain sequences similar to each other (i.e., a portion of the complete sequence) and (2) also contain sequences different from each other, sequence comparisons between two (or more) polynucleotides or polypeptides are typically performed by comparing the sequences of the two polynucleotides or polypeptides on a “comparison window” to identify and compare local regions of sequence similarity. In some embodiments, a “reference sequence” can be based on a primary amino acid sequence, wherein the reference sequence is a sequence that may have one or more variations in the primary sequence.

[0035] A “comparison window” refers to a conceptual segment of at least about 20 consecutive nucleotide positions or amino acid residues, wherein the sequence can be compared with a reference sequence of at least 20 consecutive nucleotides or amino acids, and wherein, for optimal alignment of the two sequences, the portion of the sequence within the comparison window may contain 20% or less of additions or deletions (i.e., vacancies). The comparison window may be longer than 20 consecutive residues and optionally include windows of 30, 40, 50, 100, or longer.

[0036] In the context of numbering a given amino acid or polynucleotide sequence, "corresponding to," "referring to," or "relative to" refers to the number of reference sequence residues specified when the given amino acid or polynucleotide sequence is compared to a reference sequence. In other words, the number or position of residues in a given polymer is specified with respect to a reference sequence, rather than by the actual numerical position of residues within the given amino acid or polynucleotide sequence. For example, a given amino acid sequence, such as the amino acid sequence of a T4 RNA ligase 2 mutant, can have its residue matching optimized by introducing vacancies to align with a reference sequence. In these cases, the numbering of residues in the given amino acid or polynucleotide sequence is made according to the reference sequence with which it is aligned, despite the presence of vacancies.

[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0038] On one hand, embodiments of the present invention provide a T4 RNA ligase 2 mutant, which, compared with wild-type T4 RNA ligase 2, has mutations at any one or more of the following positions in the amino acid sequence of wild-type T4 RNA ligase 2: positions 62, 103, 166, 168, 193, 217, 260, 297, 298, 303, 306, 311, 313, and 318.

[0039] In some embodiments, the mutation refers to the substitution or deletion of an amino acid residue at the corresponding site.

[0040] In some embodiments, the mutation at position 62 includes A62W, where "A62W" means that the A at position 62 of the amino acid sequence is replaced by W; the mutation at position 103 includes P103G, where "P103G" means that the P at position 103 of the amino acid sequence is replaced by G; the mutation at position 166 includes N166P, where "N166P" means that the N at position 166 of the amino acid sequence is replaced by P; the mutation at position 168 includes L168F, where "L168F" means that the L at position 168 of the amino acid sequence is replaced by F; and the mutation at position 193 includes N193K, where "N193K" means that the N at position 193 of the amino acid sequence is replaced by W. The position is replaced by K; the mutation at position 217 includes any one of R217A, R217Q, R217N, and R217P; the mutation at position 260 includes C260D; the mutation at position 297 includes T297A; the mutation at position 298 includes S298E; the mutation at position 303 includes T303D; the mutation at position 306 includes any one of Q306A, Q306D, and Q306E; the mutation at position 311 includes any one of S311E, S311D, S311A, and S311V; the mutation at position 313 includes I313V.

[0041] In some embodiments, the T4 RNA ligase 2 mutant has any one of the following mutations or a combination thereof relative to the wild-type T4 RNA ligase 2: A62W, P103G, N166P, L168F, R217P, R217A, R217N, R217P, R217Q, and C260D. This combination refers to any two or more mutations, including any three, four, and five.

[0042] In some embodiments, the T4 RNA ligase 2 mutant has any of the following mutation combinations or combinations thereof relative to the wild-type T4 RNA ligase 2: N193K-R217P, N193K-T297A, N193K-T303D, N193K-S311D, N193K-I313V, R217P-T297A, R217P-S298E, R217P-I313V, T297A-Q306D, and S311E-I313V. This combination refers to any two or more mutations.

[0043] In some embodiments, the T4 RNA ligase 2 mutant has any of the following mutation combinations or combinations thereof relative to the wild-type T4 RNA ligase 2: R217P-T297A-S311E, R217P-S298E-S311D, R217P-T297A-I313V, N193K-R217P-C260D, R217P-S311E-I313V, R217P-T303D-I313V, N193K-R217P-T303D-S311E, N193K-R217P-T303D-I313V, N193K-R217P-T303D-V318T, N193K-R217P-S311E-I 313V, N193K-R217P-T303D-S311E-I313V, A62W-N193K-R217P-T303D-S311E-I313V, P103G-N193K-R217P-T303D-S311E-I313V, N166P- N193K-R217P-T303D-S311E-I313V, L168F-N193K-R217P-T303D-S311E-I313V, N193K-R217P-C260D-I303V-S311E-I313V-V318T, L168 F-N193K-R217P-C260D-S311E-T303D-I313V-V318T, A62W-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-L168F-N19 3K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-P103G-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-P103G-N16 6P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, and N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T.

[0044] In some embodiments, the T4 RNA ligase 2 mutant has any of the following mutation combinations relative to the wild-type T4 RNA ligase 2: N193K-R217P-C260D, R217P-S311E-I313V, N193K-R217P-T303D-S311E, N193K-R217P-T303D-V318T, N193K-R217P-S311E-I313V, and N193K-R217P-T303D-S311E-I313V.

[0045] In some embodiments, the amino acid sequence of the wild-type T4 RNA ligase 2 has at least 80% identity with the sequence shown in SEQ ID NO:1 or 2.

[0046] "Identity" refers to the proportion of two sequences that are completely identical in terms of nucleotide or amino acid residues at the same site. In some embodiments, having at least 80% identity specifically means having an identity range of any one or any two of 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, and 100%.

[0047] In some embodiments, the amino acid sequence of the wild-type T4 RNA ligase 2 is as shown in SEQ ID NO:1 or 2. SEQ ID NO:1 (uniprot entry: P32277) and SEQ ID NO:2 (D9IEL2 or A0A7S9SW04) are both T4 RNA ligase 2 sequences labeled in the Uniprot database. The sequence difference between SEQ ID NO:2 and SEQ ID NO:1 is the 112th amino acid residue; SEQ ID NO:2 contains glycine, while SEQ ID NO:1 contains cysteine. This is a normal phenomenon due to differences in protein sequences from different sequencing samples.

[0048] In some embodiments, the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO:1 is shown in SEQ ID NO:3, and the nucleic acid sequence encoding the amino acid sequence shown in SEQ ID NO:2 is shown in SEQ ID NO:4.

[0049] On the other hand, embodiments of the present invention provide an isolated nucleic acid that encodes the T4 RNA ligase 2 mutant described in any of the foregoing embodiments.

[0050] On the other hand, embodiments of the present invention also provide a carrier containing the isolated nucleic acid described in any of the foregoing embodiments.

[0051] On the other hand, embodiments of the present invention also provide a host cell containing the vector described in any of the foregoing embodiments.

[0052] On the other hand, embodiments of the present invention also provide a method for preparing the T4 RNA ligase 2 mutant as described in any of the foregoing embodiments, which includes: culturing the host cells described in any of the foregoing embodiments.

[0053] On the other hand, embodiments of the present invention also provide the application of the T4 RNA ligase 2 mutant as described in any of the foregoing embodiments in the synthesis of nucleotide chains or in the preparation of products for the synthesis of target nucleotide chains.

[0054] On the other hand, embodiments of the present invention provide a method for synthesizing a target nucleotide chain, comprising: performing a ligation reaction on a notched double-stranded nucleic acid molecule and / or a nucleic acid substrate capable of forming the notched double-stranded nucleic acid molecule at a first set temperature; wherein the first set temperature is ≥42°C.

[0055] In some embodiments, the first set temperature can be any one or a range between any two of 42, 45, 48, 50, 52, 55, 57, and 60°C.

[0056] In some embodiments, the reaction time under the first set temperature condition is ≥30s.

[0057] In some embodiments, the reaction time under the first set temperature condition is 5 min to 16 h, specifically it can be any one or any two of the following: 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, 16 h.

[0058] In some embodiments, before, during, and / or after the reaction at the first set temperature, the synthesis method further includes performing at least one high-temperature denaturation-low-temperature annealing procedure; wherein the high-temperature denaturation includes a first incubation at a second set temperature, the second set temperature being ≥ the first set temperature; and the low-temperature annealing includes a second incubation at a third set temperature, the third set temperature being < the second set temperature.

[0059] In some embodiments, the second set temperature is 42~60°C, specifically any one or any two of 42, 44, 45, 46, 48, 50, 52, 54, 56, 58, and 60°C.

[0060] In some embodiments, the third set temperature is ≥4°C.

[0061] In some embodiments, the third set temperature is any one of 4, 5, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40°C.

[0062] In some embodiments, the synthesis method further includes performing the high-temperature denaturation-low-temperature annealing process two or more times. "Two or more times" includes two or more instances.

[0063] In some embodiments, the first incubation time is ≥30s.

[0064] In some embodiments, the first incubation time is 5 min to 16 h, specifically any one or any two of the following: 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, and 16 h.

[0065] In some embodiments, the second incubation time is ≥30s.

[0066] In some embodiments, the second incubation time is 5 min to 16 h, specifically any one or any two of the following: 5 min, 10 min, 15 min, 20 min, 25 min, 30 min, 35 min, 40 min, 45 min, 50 min, 55 min, 60 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, and 16 h.

[0067] On the other hand, embodiments of the present invention provide a method for synthesizing a target nucleotide chain, comprising: performing a ligation reaction on a notched double-stranded nucleic acid molecule and / or a nucleic acid substrate capable of forming the notched double-stranded nucleic acid molecule; and, during the ligation reaction, performing at least once the high-temperature denaturation-low-temperature annealing procedure described in any of the foregoing embodiments.

[0068] In some embodiments, the synthesis method includes performing the high-temperature denaturation-low-temperature annealing procedure two or more times.

[0069] In some embodiments, the term "two or more times" specifically includes ≥2, 3, 4, 5, 6, 7, 8, 9, or 10 times.

[0070] The high-temperature denaturation-low-temperature annealing process can eliminate non-target nicked double-stranded nucleic acid molecules or double-stranded nucleic acid molecules with "gaps" formed due to mismatches, thereby improving ligation efficiency and reducing the formation of ligation byproducts. Furthermore, since high temperatures can damage the structure of double strands, direct reaction at high temperatures may lead to reduced ligation efficiency. Therefore, by first raising the temperature to open up non-specific double-stranded nucleic acids, and then annealing to a slightly lower temperature, more target double-stranded nicked molecules can be formed and ligated, improving ligation efficiency and reducing byproduct formation.

[0071] In some embodiments, the notched double-stranded nucleic acid molecule includes any one or more of notched RNA double strands and notched DNA / RNA hybrid double strands.

[0072] In some embodiments, in the notched double-stranded nucleic acid molecule, the notch can refer to at least one notch on at least one strand of the double-stranded nucleic acid molecule, that is, there can be a notch on one strand or there can be a notch on both strands.

[0073] Specifically, the notched DNA / RNA hybrid double strand includes at least one deoxyribonucleic acid, and at least one notched end (3' hydroxyl group and / or 5' phosphate group) is RNA.

[0074] In some embodiments, the notched double-stranded nucleic acid molecule comprises linear and / or circular molecules.

[0075] In some embodiments, the notched double-stranded nucleic acid molecule comprises natural and / or modified varieties.

[0076] In some embodiments, the notched double-stranded nucleic acid molecule comprises a nucleic acid substrate or is formed by mixing or annealing nucleic acid substrates.

[0077] In some embodiments, the nucleic acid substrate includes any one or more of the following: natural and / or modified RNA single strand, natural and / or modified RNA double strand, natural and / or modified DNA single strand, and natural and / or modified DNA / RNA hybrid single strand and natural and / or modified DNA / RNA hybrid double strand.

[0078] In some embodiments, in the nucleic acid substrate, the RNA single strand includes linear RNA single strand and / or circular RNA single strand, the RNA double strand includes linear RNA double strand and / or circular RNA double strand, the DNA single strand includes linear DNA single strand and / or circular DNA single strand, the DNA / RNA hybrid single strand includes linear DNA / RNA hybrid single strand and / or circular DNA / RNA hybrid single strand, and the DNA / RNA hybrid double strand includes linear DNA / RNA hybrid double strand and / or circular DNA / RNA hybrid double strand.

[0079] In some embodiments, the RNA single strand includes any one or more of mRNA, antisense oligonucleotide, siRNAi, sgRNA, lncRNA, circRNA, and miRNA.

[0080] When the nucleic acid substrate is double-stranded with notches, the nucleic acid substrate itself is a notched double-stranded nucleic acid molecule. When the nucleic acid substrate is single-stranded, a notched double-stranded nucleic acid molecule can be formed by mixing the nucleic acid substrate or by annealing the mixed nucleic acid substrate.

[0081] In some embodiments, the annealing temperature of the nucleic acid substrate is 0~100℃. Specifically, it can be any one or any two of the following temperatures: 0, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100℃ or higher.

[0082] In some embodiments, the process of forming notched double-stranded nucleic acid molecules from nucleic acid substrates can occur during the mixing of nucleic acid substrates without a separate heating and annealing process. The nucleic acid substrates, enzymes, ATP, and Mg can be directly mixed. 2+ After the necessary molecules and solutions for the reaction are mixed, they are linked together. The nucleic acid substrate binds specifically during the mixing process to form a notched double-stranded nucleic acid molecule.

[0083] In some embodiments, the fragment length of the nucleic acid substrate is ≥2 nt.

[0084] In some embodiments, the fragment length of the nucleic acid substrate is 2 to 200 nt, specifically any one or any two of the following: 2, 5, 7, 10, 13, 15, 17, 20, 23, 25, 27, 30, 33, 35, 37, 40, 43, 45, 47, 50, 53, 55, 57, 60, 63, 62, 67, 70, 73, 75, 77, 80, 85, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, and 200 nt.

[0085] In some embodiments, the number of nucleic acid substrates is ≥1. When the nucleic acid substrate is a circular, notched double-stranded nucleic acid molecule, the number of nucleic acid substrates can be 1.

[0086] In some embodiments, the number of nucleic acid substrates is 1 to 50, specifically any one or any two of the following: 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, and 50.

[0087] The method of this application has no special restrictions on the type of modification and is applicable to all types of modifications. In some embodiments, the modification includes modifications for enhancing stability and / or reducing innate immune response.

[0088] In some embodiments, the modification includes any one of the following: modification of phosphate groups, modification of bases, modification of sugar rings, and modification of glycosidic bonds.

[0089] In some embodiments, the modification of the phosphate group includes any one or more of the following: 5′-(E)-vinylphosphonic acid modification (5′-(E)-vinylphosphonate, 5′-VP), thiophosphate modification, triphosphate modification, 5′-VP, etc. Methylphosphonate modification, 5 - Morpholinium modification, dithiophosphate modification, methoxypropylphosphonate modification, S-5 -C methyl analogue modification, short-chain alkyl or cycloalkyl sugar inter-bond modification, short-chain heteroatom or heterocyclic sugar inter-bond modification, or the entire phosphate group being substituted by any one of amide, aminooxy, alkoxy and triazole groups.

[0090] In some embodiments, the base modification includes any one or more of the following: 2,4-difluorotolyl ribonucleoside substitution, pseudouridine modification, 2-thiouridine modification, N1-methylpseudouridine modification, 5-methyluridine modification, 5-methoxyuridine modification, N6-methyladenosine modification, N6,N6-dimethyladenosine modification, 3-methylureaside modification, N7-methylguanosine modification, 2,7-dimethylguanosine modification, 2,2,7-trimethylguanosine modification, 5-methylcytidine modification, 5-hydroxymethylcytosine modification, 5-bromo-uracil modification, 5-iodo-uracil modification, propynyluracil nucleoside modification, N-ethylpiperidine-6-triazole modified adenosine modification, 6'-phenylpyrrolecytosine modification, 2 Aminopurine modification, inosine modification, 2,6 Diaminopurine modification, 2 Pyrimidinone modification and 5 Methylcytosine modification.

[0091] In some embodiments, the modification of the sugar ring includes any one or more of the following: 2'-methoxy modification, 2'-deoxy-2'-fluorine modification, 2' O Methoxyethyl modification, locked nucleic acid (LNA) modification, unlocked nucleic acid (UNA) modification, bridged nucleic acid (BNA) modification, tricyclo-DNA (tcDNA) modification, phosphodiamidate morpholino oligonucleotide (PMO) modification, 2' deoxyribonucleic acid modification, (S)-restricted ethyl bicyclic nucleic acid modification, peptide nucleic acid modification, and glycomimetic modification.

[0092] In some embodiments, the glycomimetic includes any one or more of the following: a cyclobutyl group replacing the pentafuranose group in cyclobutyl nucleotides, a morpholino group in morpholino nucleic acid (MNA), a peptide backbone in peptide nucleic acid (PNA), a polyethylene glycol backbone in glycol nucleic acid (GNA), a threose backbone in threose nucleic acid (TNA), and a butyl backbone in acyclic butyl nucleic acid (BuNA).

[0093] In some embodiments, the modification of the glycosidic bond includes replacing the CN bond connecting the glycosidic bond with any one of CC, CO, and CS.

[0094] In some embodiments, the target nucleotide chain has a sequence length of ≥2nt, 10nt, 20nt, or 50nt.

[0095] In some embodiments, the sequence length of the target nucleotide chain can be 10 to 200 nt, specifically any one or any two of the following: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, and 200 nt.

[0096] In some embodiments, the target nucleotide chain comprises linear and / or cyclic strands.

[0097] In some embodiments, the target nucleotide chain is any one or more of RNA single-stranded, RNA double-stranded, DNA / RNA hybrid single-stranded, and DNA / RNA hybrid double-stranded.

[0098] In some embodiments, the synthesis method further includes separating and purifying the ligated product to obtain the target nucleotide chain.

[0099] In some embodiments, the synthesis method further includes adding a ligase during the ligation reaction, the ligase linking the notches with phosphodiester bonds.

[0100] In some embodiments, the ligase comprises an RNA ligase that ligates double strands.

[0101] In some embodiments, the ligase includes RNA ligases from the Rnl2 and Rnl5 families.

[0102] In some embodiments, the ligase comprises a thermostable RNA ligase that ligates double strands. A thermostable ligase is one that exhibits high stability at a set temperature during the ligation process.

[0103] In some embodiments, the ligase comprises wild-type T4 RNA ligase 2 or a mutant thereof. The wild-type T4 RNA ligase 2 or its mutant is as described in any of the foregoing embodiments and will not be repeated here.

[0104] In some embodiments, the reaction time of the synthesis method is ≥5 min. In some embodiments, it can be 5 min to 16 h, specifically any one or any two of the following: 5 min, 30 min, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, and 16 h.

[0105] In some embodiments, the system of the synthetic reaction comprises: nucleic acid substrate, enzyme, ATP, and Mg. 2+ .

[0106] On the other hand, embodiments of the present invention also provide a kit comprising: reagents for carrying out the synthesis method described in any of the foregoing embodiments.

[0107] On the other hand, embodiments of the present invention also provide the application of the target reagent in the preparation of products for synthesizing nucleotide chains, wherein the target reagent is a reagent for carrying out the synthesis method described in any of the foregoing embodiments.

[0108] In some embodiments, the reagents used to carry out the synthesis method described in any of the foregoing embodiments include: the thermostable ligase described in any of the foregoing embodiments and the reaction solution for synthesizing nucleotide chains.

[0109] In some embodiments, the reaction solution used for synthesizing nucleotide chains includes: 40–60 mM Tris The active ingredients are any one or more of HCl (pH 7.8–8.2), 10–14 mM MgCl2, 0.1–5 mM DTT, and 1–10 mM ATP. Each concentration represents the effective concentration of each component in the reaction system.

[0110] Specifically, Tris The effective concentration of HCl can be any one or any two of the following: 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60 mM. The effective concentration of MgCl2 can be any one or any two of the following: 10, 11, 11.5, 12, 12.5, 13, 14 mM. The effective concentration of DTT can be any one or any two of the following: 0.1, 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5 mM. The effective concentration of ATP can be any one or any two of the following: 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 6, 7, 8, 9, 10 mM.

[0111] In some embodiments, a ligase with a final concentration of 0.03–30 μM is added for every 0.5–30 mM of nucleic acid substrate. Specifically, the 0.5–30 mM concentration can be any one or any combination of 0.5, 1, 1.5, 1.6, 1.8, 2, 2.5, 3, 3.5, 4, 4.5, 5, 10, 15, 20, 25, and 30 mM. Similarly, the 0.03–30 μM concentration can be any one or any combination of 0.03, 0.03, 0.04, 0.05, 0.1, 0.15, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, and 30 μM.

[0112] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0113] Example 1: T4 Rnl2 mutant In this embodiment, wild-type T4 Rnl2 (amino acid sequence as shown in SEQ ID NO:2) was obtained, and T4 Rnl2 mutants were designed based on wild-type T4 Rnl2. Compared with wild-type, the mutants have the following mutations, as shown in Table 1.

[0114] Table 1. T4 Rnl2 mutants .

[0115] Example 2: Construction of T4 Rnl2 recombinant plasmid and heat-resistant mutant plasmid (1) Cloning and expression of T4 Rnl2 (wild type) and / or T4 Rnl2 mutants The T4 Rnl2 gene and / or a designed T4 Rnl2 mutant gene were constructed into the pET-28a vector, with a 10×His tag fused to the amino terminus. Recombinant plasmids containing each RNA ligase were transformed into the expression strain BL21(DE3). The expression strain was inoculated into LB broth containing 50 mg / L kanamycin and cultured overnight at 37°C. Subsequently, it was inoculated at a 1:20 ratio into 400 mL of LB broth containing 50 mg / L ampicillin and kanamycin. The culture was maintained at 37°C with shaking at 180 rpm until OD (open-circuit closure). 600 The concentration was adjusted to between 0.6 and 0.8, then cooled to 16°C, and isopropyl alcohol was added to a final concentration of 0.5 mM. β D The culture medium was incubated with thiogalactoside (IPTG) at 16°C with shaking at 180 rpm for 20 h. After incubation, the bacterial cells were recovered by centrifugation at 8000 rpm for 5 min from 400 ml of the culture medium.

[0116] (2) Purification of T4 Rnl2 and its mutants The bacterial cells were resuspended in 25 mL of a disruption buffer (50 mM Tris 7.5, 150 mM NaCl, 10% glycerol, 0.5 mM DTT, 10 mM imidazole) and sonicated. The mixture was centrifuged at 12,000 rpm for 20 min at 4 °C to separate the supernatant and precipitate. The supernatant was then mixed with a pre-equilibrated nickel column and incubated at 4 °C for 30 min. Then, 30 mL of washbuffer (50 mM Tris 7.5, 150 mM NaCl, 10% glycerol, 0.5 mM DTT, 20 mM imidazole) was added three times to a gravity column to wash away non-specifically bound proteins. Next, 10 mL of elution buffer (50 mM Tris 7.5, 150 mM NaCl, 10% glycerol (v / v), 0.5 mM DTT, 500 mM imidazole) was added to the gravity column in three divided doses to elute the target protein. Then, the protein eluted from the nickel column was transferred to a pre-treated dialysis bag and dialyzed overnight in 1× storage buffer (10 mM Tris 7.5, 50 mM KCl, 35 mM (NH)4SO4, 1 mM DTT, 1 mM EDTA, 50% (v / v) glycerol). Finally, the protein was quantified using the BCA method.

[0117] Example 3: Thermal stability analysis of T4 Rnl2 single-point and double-point mutations The thermal denaturation midpoint temperature (Tm) of T4 Rnl2 and its mutants was determined using the SYPRO Orange (S5692, Merk) fluorescent dye assay. This method is a commonly used approach for determining protein thermal stability; the relevant principles and specific experimental procedures can be found in the relevant literature (doi: 10.1002 / 0471140864.ps2809s79). In this implementation, the fluorescent dye binds to the hydrophobic region of the protein and emits fluorescence. As the temperature increases, the protein gradually unfolds, exposing the hydrophobic core, and the fluorescence intensity gradually increases. The Tm value of the protein can be calculated by fitting the sigmoid function.

[0118] Due to the potential trade-off between stability and activity, some mutations may improve stability while adversely affecting enzyme activity. Therefore, in this embodiment, the ligase activity of the protein at 50°C and 37°C was measured as another parameter for assessing thermostability. Specifically, to rapidly detect the ligase activity of the T4 Rnl2 mutant, the inventors designed a method based on the principle of fluorescence quenching to detect RNA ligase activity, based on relevant literature (doi: 10.1007 / s00216-014-8351-1). The principle of this scheme is described in [link to relevant literature]. Figure 1 .

[0119] More specifically, the inventors first designed two fluorescent probes: F1 fragment, 59 nt in length, with its 5' end having a 19 nt anticomplementary position to form a hairpin structure. Simultaneously, the second position at the 5' end is FITC-labeled thymine deoxyribonucleotide (FITC-dT), and the remaining positions are ribonucleotides. Both the 5' and 3' ends of F1 fragment contain PO4 groups, with the 5' PO4 group serving as a donor in the ligation reaction, and the addition of 3' PO4 to prevent intermolecular linkages between F1 fragments or self-cyclization of F1. Meanwhile, F2 fragment, also 19 nt in length, forms a complementary pair with F1 fragment, and its 3' OH provides an acceptor group for the ligation reaction. Simultaneously, the fourth position at the 3' end of F2 fragment is BHQ-1-labeled thymine deoxyribonucleotide (BHQ-1-dT), with the remaining positions being ribonucleotides. The sequence of F1 is: 5'-C / iFITC-dT / CGAUAGUCUCAGCUGAUUUUUCAGCUGAGACUAUCGAGAGUACAGUCAGUCAGUCAA-3' (SEQ ID NO: 5); the sequence of F2 is: 5'-UUGACUGACUGACUG / iBHQ1dT / ACU-3' (SEQ ID NO: 6). F1 and F2 were mixed in equal proportions and then annealed. The annealing process was as follows: first, the mixture was incubated at 85°C for 10 min, then the temperature was slowly lowered to 37°C for 10 min, then incubated at 22°C for 1 h, and finally incubated at 4°C for 1 h. After annealing, F1 and F2 formed double-stranded RNA with notches. Due to the proximity of the fluorescent group and the quenching group, a fluorescence quenching effect was produced. For successfully ligated substrates, due to the formation of phosphodiester bonds, the fluorophore and quencher groups remain close to each other, maintaining a fluorescence-quenched state even with increased temperature. However, for unligated substrates, increasing the temperature causes the base pairing to open, separating the quencher and fluorophores, resulting in fluorescence emission and an increase in fluorescence intensity. The ligation rate of T4 Rnl2 and its mutants under the current reaction conditions can then be calculated based on the decrease in fluorescence. The specific implementation method for this example is as follows: (1) Dilute the protein with 1× reaction buffer (50 mM Tris 8.0, 1 mM DTT, 0.4 mM ATP, 10 mM MgCl2) to 0.05 mg / mL.

[0120] (2) Prepare the reaction system according to the table below, and react the system at 37℃ and 50℃ for 1 h.

[0121] Table 2. Reaction system for detecting the ligase activity of T4Rnl2 and its mutants.

[0122] (3) Fluorescence detection and linkage rate calculation: Fluorescence was detected at 25℃ and 85℃ using a LightCycler® 96 fluorescence PCR instrument, and the linkage rate was calculated according to the following formula: ; .

[0123] A scatter plot was drawn with the measured protein Tm as the x-axis and the residual activity at 50℃ as the y-axis. Figure 2 The results were compiled into Table 3. It should be noted that the experiments were conducted in batches, and there may be differences in the state of the purified protein, as well as in the experimental procedures and detection methods between different batches. Therefore, T4 Rnl2 was used as a reference for each batch of experiments.

[0124] Experimental results showed that the Tm values ​​of mutants R217A / Q / N / P, P103G, N166P, L168F, A62W, C260D, N193K-R217P, R217P-T297A, R217P-S298E, R217P-I313V, and S311E-I313V were all increased by ≥2.0℃, and their residual activity at 50℃ was increased by more than 10%. While the Tm values ​​of N193K-S311D, N193K-T297A, and N193K-I313V were not significantly increased, their residual activity was increased by ≥15%. These results indicate that the aforementioned T4 Rnl2 mutants can tolerate higher temperatures compared to the wild type.

[0125] Table 3. Tm values ​​and residual activity of T4 Rnl2 single-point and double-point mutants

[0126] Example 4: Construction of T4 Rnl2 combinatorial mutation and thermal stability analysis This embodiment provides the following mutants: R217P-T297A-S311E, R217P-S298E-S311D, R217P-T297A-I313V, N193K-R217P-C260D, R217P-S311E-I313V, R217P-T303D-I313V, N193K-R217P-T303D-S311E, N193K-R217P-T303D-I313V, N193K-R217P-S311E-I313V, N193K-R217P-T303D-V318T, N193 K-R217P-T303D-S311E-I313V, A62W-N193K-R217P-T303D-S311E-I313V, P103G-N193K-R217P-T303D-S311E-I313V, N166P-N193K-R 217P-T303D-S311E-I313V, L168F-N193K-R217P-T303D-S311E-I313V, N193K-R217P-C260D-T303D-S311E-I313V-V318T, L168F-N193 K-R217P-C260D-S311E-T303D-I313V-V318T, A62W-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-L168F-N193K-R 217P-C260D-T303D-S311E-I313V-V318T, A62W-P103G-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-P103G-N166P- The mutants are L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, and N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T. The mutant with the amino acid sequence T4 Rnl2 as shown in SEQ ID NO:2 is wild-type.

[0127] The specific vector construction scheme and protein purification method were the same as in Example 2, and the Tm value determination method was the same as in Example 3. The activity detection scheme was basically the same as in Example 3, with the slight difference that the protein was first diluted with 1×reaction buffer (50 mM Tris 8.0, 1 mM DTT, 0.4 mM ATP, 10 mM MgCl2) to 0.05 mg / mL and incubated at 37℃ and 45℃ for 1 h, respectively. Then, the heat-incubated protein was added to the reaction system and reacted at 37℃ and 45℃ for 1 h, respectively. Finally, fluorescence was measured, and the linkage rate and residual activity were calculated. The Tm value and activity measurement results are shown in […]. Figure 3 The relevant data are summarized in Table 4. Among them, the T4 Rnl2 and the R217P-I313V mutant, which performed best in the screening of single-point and double-point mutants, were used as controls.

[0128] Experimental results show that all multipoint mutants, including R217P-T297A-S311E, R217P-S298E-S311D, R217P-T297A-I313V, N193K-R217P-C260D, R217P-S311E-I313V, R217P-T303D-I313V, N193K-R217P-T303D-S311E, N193K-R217P-T303D-I313V, N193K-R217P-T303D-V318T, N193K-R217P-S311E-I313V, and N193... K-R217P-T303D-S311E-I313V, A62W-N193K-R217P-T303D-S311E-I313V, P103G-N193K-R217P-T303D-S311E-I313V, N166P-N193K-R21 7P-T303D-S311E-I313V, L168F-N193K-R217P-T303D-S311E-I313V, N193K-R217P-C260D-T303D-S311E-I313V-V318T, L168F-N193K-R2 17P-C260D-S311E-T303D-I313V-V318T, A62W-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-L168F-N193K-R217P-C 260D-T303D-S311E-I313V-V318T, A62W-P103G-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-P103G-N166P-L168F-N1 93K-R217P-C260D-T303D-S311E-I313V-V318T, A62W-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, P103G-N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T, and N166P-L168F-N193K-R217P-C260D-T303D-S311E-I313V-V318T all exhibited higher residual activity. Figure 3Among them, the six multi-point mutants N193K-R217P-C260D, R217P-S311E-I313V, N193K-R217P-T303D-S311E, N193K-R217P-T303D-V318T, N193K-R217P-S311E-I313V, and N193K-R217P-T303D-S311E-I313V showed particularly outstanding performance, with residual activity >60%.

[0129] Table 4 Thermal stability analysis of T4 Rnl2 and its mutants .

[0130] Example 5: Activity analysis of T4 Rnl2 mutant at different temperatures This embodiment analyzes the thermal stability of T4 Rnl2 and its mutants N193K-R217P (Mut1), R217P-I313V (Mut2), N193K-R217P-C260D (Mut3), R217P-S311E-I313V (Mut4), N193K-R217P-T303D-S311E (Mut5), N193K-R217P-S311E-I313V (Mut6), N193K-R217P-T303D-V318T (Mut7), and N193K-R217P-T303D-S311E-I313V (Mut8) at different temperatures. The specific implementation method of this case is as follows: (1) Dilute the protein with 1× reaction buffer (50 mM Tris 8.0, 1 mM DTT, 0.4 mM ATP, 10 mM MgCl2) to 0.05 mg / mL and incubate at 35.7℃, 37.0℃, 42.6℃, 45.1℃, 48.1℃, 50.6℃ and 54.7℃ for 1 h.

[0131] (2) Prepare the reaction system according to the table below, and react the reaction system at the corresponding temperatures for protein incubation (35.7℃, 37.0℃, 42.6℃, 45.1℃, 48.1℃, 50.6℃ and 54.7℃) for 1 h.

[0132] Table 5. Reaction system for detecting the ligase activity of T4 Rnl2 and its mutants.

[0133] (3) Fluorescence detection and linkage rate calculation: Fluorescence was detected at 25℃ and 85℃ using a LightCycler® 96 fluorescence PCR instrument, and the linkage rate was calculated according to the following formula: ; .

[0134] The RNA ligation rate and residual activity of T4 Rnl2 and its mutants after 1 h of reaction at different temperatures are shown in the figures below. Figure 4 In Tables A and B, after treatment at 48.1℃ for 1 h, the T4 Rnl2 ligation rate was only 12.8%, with a residual activity of 20.3%; while under the same conditions, Mut1~8 achieved ligation rates between 43.4% and 66.5%, with residual activities ranging from 87.4% to 104% (Table 6). Further comparison of the ligation rates of different mutants at higher temperatures revealed that after treatment at 54.7℃ for 1 h, the ligation rates of Mut1 and Mut2 were 6.5% and 12.9%, respectively, with residual activities of 15.1% and 22.6%; while under the same conditions, Mut3~8 still maintained a ligation rate of ~40%, with residual activities exceeding 53.6% to 74.2% (Table 6).

[0135] Table 6. Ligation rate and residual activity of T4 Rnl2 and its mutants at different temperatures.

[0136] This embodiment also uses denaturing gel electrophoresis to analyze the thermal stability of the relevant mutants: First, the protein was diluted to 0.5 mg / mL, and then heated at 45℃ for 1 h and 16 h, or at 50℃ for 1 h and 4 h, respectively. Afterwards, it was centrifuged at 12000 rpm for 10 min, and the supernatant was used to prepare SDS-PAGE samples for denaturing gel electrophoresis. The results of SDS-PAGE (…) Figure 5 Figures A and B show that for T4 Rnl2, after heating at 45°C for 1 hour, the remaining protein in the supernatant was ~10%. After heating at 45°C for 16 hours or at 50°C for 1 hour, the protein was almost completely precipitated, and the supernatant contained almost no protein. For Mut1, after heating at 45°C for 1 hour, the remaining protein in the supernatant was ~40%. After heating at 45°C for 16 hours or at 50°C for 1 hour, the remaining protein in the supernatant was ~10%. For Mut2 and Mut4, after heating at 45°C for 1 hour, the supernatant still contained ~70% protein. After heating at 45°C for 16 hours, the supernatant still contained ~40% protein. After heating at 50°C for 1 hour, the supernatant still contained ~10% protein. For Mut3, Mut5, Mut6, Mut7, and Mut8, even after heating at 45°C for 16 hours, the supernatant still contained about 70% protein. After heating at 50°C for 4 hours, the supernatant still contained about 50% protein.

[0137] Example 6: Ligation of four non-natural RNA fragments from the T4 Rnl2 mutant at high temperature Non-natural modifications can increase RNA stability and reduce its immunogenicity. Therefore, currently used small RNAs and mRNAs often incorporate non-natural modifications. In this embodiment, a thermostable mutant obtained through screening is used to ligate the non-natural RNA.

[0138] The ligase activities of nine thermostable RNA ligases (Mut1-9) were determined under the following conditions. Oligonucleotides from four fragments listed in Table 7 were used as substrates, such as... Figure 6 The diagram shows the ligation of four oligonucleotide fragments to generate complementary RNA fragments. For convenience, the RNA generated by the ligation reactions F1 and F2 is designated as the sense strand (SS), and the RNA generated by F3 and F4 is designated as the antisense strand (AS).

[0139] The oligonucleotide fragments contained in the final concentration of 1.6 mM and 50 mM Tris 20 μL of reaction solution containing HCl (pH 8.0), 12 mM MgCl2, 1 mM DTT, 4 mM ATP, and 0.005 mg / mL of each enzyme was added to a 200 μL microtube. The ligation reaction was performed at 37℃, 42℃, 45℃, and 50℃ using a PCR instrument. Four hours after the start of the reaction, 1 μL of the reaction solution was sampled and 49 μL of 10 mM EDTA solution was added to terminate the reaction. Finally, the product was analyzed by HPLC. The percentage of product was calculated by dividing the peak area of ​​the SS+AS chain on the HPLC chromatogram by the sum of the peak areas of all nucleotides on the entire chromatogram, and the residual activity was also calculated. ; .

[0140] Table 7 shows the oligonucleotide fragments used in the ligation reaction of the four fragments.

[0141] Note: "Pho" indicates a 5'-terminal phosphate group; "f" indicates the use of a 2'-terminal phosphate group. Fluorine group modification; "m" indicates the use of 2' O The methyl group is used for modification; "-" indicates a phosphate diester bond.

[0142] The results of the examples are shown in Table 8.

[0143] Table 8. Non-natural RNA fragments ligated from the T4 Rnl2 mutant at high temperature

[0144] At 42℃, the ligation rates of T4 Rnl2 and its mutants Mut1-8 were all greater than those at 37℃, with Mut1, Mut2, Mut4, Mut7, and Mut8 having ligation rates >70%, and Mut3, Mut5, and Mut6 having ligation rates >80%. At 45℃, the ligation rates of Mut2, Mut4, and Mut8 were all >60%, the ligation rates of Mut1, Mut5, and Mut7 were all >70%, the ligation rate of Mut6 was ~81%, and the ligation rate of Mut3 was ~96%. At 50℃, the ligation rate of T4 Rnl2 was essentially lost, with a ligation rate <10%, while Mut2 still maintained a ligation rate of ~34%, the ligation rates of Mut1, Mut5, Mut6, Mut7, and Mut8 were >50%, and the ligation rate of Mut3 was ~96%.

[0145] Example 7: Using the T4 Rnl2 ligase mutant to reduce the generation of byproducts during high-temperature reaction.

[0146] The T4 Rnl2 thermostable mutant N193K-R217P-C260D (Mut3) provided in Example 4 was used as a ligase to ligate nucleic acid substrates to synthesize nucleotide chains.

[0147] Specifically, the nucleic acid substrate consists of four fragments, as detailed in Table 9. A connection diagram can be found in [reference needed]. Figure 7 .according to Figure 7 F2-1 (experimental group 1), F2-2 (experimental group 2), and F2-3 (experimental group 3) have paired regions of 3 nt, 2 nt, and 1 nt with F1, and unpaired regions of 4 nt, 5 nt, and 6 nt. The mismatch between the F3 fragment and the F2 fragment leads to incorrect linkage between F2 and F3. For ease of description, the F1 oligonucleotide is designated as the sense strand (SS), and the oligonucleotide formed from F2 and F3 is designated as the antisense strand (AS).

[0148] Table 9 Nucleic acid substrates used in Example 7

[0149] Note: "Pho" indicates a 5' terminal phosphate group; "-" indicates a phosphate diester bond.

[0150] The synthesis of the nucleotide chain includes: combining individual oligonucleotides at a final concentration of 1.6 mM and 50 mM Tris... 20 μL of a reaction solution containing HCl (pH 8.0), 12 mM MgCl2, 1 mM DTT, 4 mM ATP, and 0.005 mg / mL enzyme was added to a 200 μL microtube, and the reaction was incubated at 37℃ and 50℃ using a PCR instrument. After 4 h and 16 h of reaction, 1 μL of the reaction solution was sampled and 49 μL of 10 mM EDTA solution was added to terminate the reaction. Finally, the products were separated using HPLC, and the components of each peak were analyzed using mass spectrometry. The product percentage was calculated by dividing the peak area of ​​each product on the HPLC chromatogram by the sum of the peak areas of all oligonucleotides on the entire chromatogram. .

[0151] The results of this embodiment are shown in Table 10.

[0152] Table 10. Formation of staggered products (F2+F3) at different reaction temperatures

[0153] At 37℃ for 4 hours, the proportions of mislinked products in the three experimental groups were 16.2%, 17.2%, and 10.0%, respectively; while at 50℃ for 4 hours, the proportions were 4.1%, 2.6%, and 1.2%, respectively. At 37℃ for 16 hours, the proportions of mislinked products in the three experimental groups were 23.0%, 23.4%, and 17.7%, respectively; while at 50℃ for 4 hours, the proportions were 6.0%, 4.4%, and 2.9%, respectively.

[0154] The results showed that using the T4 Rnl2 ligase thermostable mutant at 50℃ could significantly reduce the generation of misligation products due to mismatch at high temperatures.

[0155] Example 8: Using the T4 Rnl2 ligase mutant to ligate double-stranded RNA sequences at high temperature and reduce the generation of byproducts.

[0156] Using the T4 Rnl2 thermostable mutants N193K-R217P-C260D (Mut3), N193K-R217P-S311E-I313V (Mut6), and L168F-N193K-R217P-T303D-S311E-I313V (Mut9) from Example 4 as ligases, the four fragments in Table 11 were used as nucleic acid substrates for nucleotide chain synthesis. The ligation diagram is shown below. Figure 8As a control group, T4 Rnl2 (wild type) purified under the same conditions was used for the control group reaction. For ease of description, the oligonucleotides generated by the ligation reactions of F1 and F2 are referred to as sense strands (abbreviated as SS), and the oligonucleotides generated by F3 and F4 are referred to as antisense strands (abbreviated as AS).

[0157] Table 11 Nucleic acid substrates used in the ligation reaction of Example 8

[0158] Note: "Pho" indicates a 5' terminal phosphate group; "-" indicates a phosphate diester bond.

[0159] Synthesis of nucleotide chains: Each oligonucleotide, with a final concentration of 1.6 mM, and 50 mM Tris... 20 μL of a reaction solution containing HCl (pH 8.0), 12 mM MgCl2, 1 mM DTT, 4 mM ATP, and 0.005 mg / mL enzyme was added to a 200 μL microtube and incubated at 37℃, 42℃, 45℃, and 50℃ using a PCR instrument. Two hours after the start of the reaction, 1 μL of the reaction solution was sampled and 49 μL of 10 mM EDTA solution was added to terminate the reaction. Finally, the products were separated using HPLC, and the components of each peak were analyzed using mass spectrometry. The product percentage was calculated by dividing the peak area of ​​each product on the HPLC chromatogram by the sum of the peak areas of all nucleotides on the entire chromatogram. .

[0160] The results of the examples are shown in Table 12.

[0161] Table 12 Product formation in the linkage reaction of Example 8

[0162] Note: "ND" indicates that the corresponding product was not detected during liquid chromatography and mass spectrometry analysis.

[0163] In this embodiment, the reaction at 37°C for 2 h yielded a 62.4% yield of the target product from wild-type T4 Rnl2, along with 13.6% of non-target byproducts. When the reaction temperature was increased to 42°C, the yield of the target product decreased slightly, but the byproducts decreased by approximately 50%, indicating that increasing the reaction temperature does indeed reduce byproduct formation. Further increases in reaction temperature to 45°C and 50°C further reduced byproduct formation. At 50°C, no byproducts were produced, but because wild-type T4 Rnl2 is essentially inactivated at high temperatures, the target product yield was only 10.8%. However, using Mut3, Mut6, and Mut9 at 45°C for 2 h yielded 88.9%, 88.2%, and 89.5% yields of the target product, respectively, and byproduct yields of 1.9%, 2.6%, and 2.3%, respectively. When Mut3, Mut6, and Mut9 were reacted at 50°C for 2 hours, the yields were 90.2%, 90.0%, and 91.6%, respectively, and no byproducts were detected by liquid chromatography-mass spectrometry. The results of this example demonstrate that using the thermostable mutants of the present invention at high temperatures significantly reduces byproducts caused by base mismatches. Furthermore, in this example, the yield of the target product under high-temperature conditions was significantly higher than that under 37°C conditions. This is partly due to the improved thermal stability of the protein, which allows it to maintain activity for a longer period at high temperatures, and partly because high temperatures may open some secondary structures, reducing their adverse effects on the ligation reaction and thus improving the efficiency of the ligation reaction.

[0164] Example 9: Using the T4 Rnl2 ligase mutant to ligate modified non-natural oligonucleotide chains at high temperature and reduce the generation of byproducts.

[0165] This embodiment uses the T4 Rnl2 thermostable mutants N193K-R217P-C260D (Mut3), N193K-R217P-S311E-I313V (Mut6), and L168F-N193K-R217P-T303D-S311E-I313V (Mut9) to ligate RNA with non-natural nucleotides at higher temperatures, reducing the generation of byproducts.

[0166] Using the T4 Rnl2 thermostable mutants N193K-R217P-C260D (Mut3), N193K-R217P-S311E-I313V (Mut6), and L168F-N193K-R217P-T303D-S311E-I313V (Mut9) from Example 4 as ligases, and the four fragments in Table 13 as nucleic acid substrates, nucleotide chains were synthesized. The ligation diagram is shown below. Figure 9As a control group, T4 Rnl2 (wild type) purified under the same conditions was used to control the reaction.

[0167] The nucleic acid substrates used in this embodiment are all non-natural ribonucleotides, including several common non-natural ribonucleotides used in RNA drug design: 2'-methoxy modification at the 2' position of the pentose ring (2'-OCH3), 2'-deoxy-2'-fluorine (2'-F), thiomodification at the α-phosphate position (P=S), 5'-(E)-vinylphosphonate at the 5' position of the pentose ring (5'-VP), and deoxyribonucleotides incorporated at certain sites. For ease of description, the oligonucleotides generated by the ligation reactions of F1 and F2 are referred to as sense strands (abbreviated as SS), and the oligonucleotides generated by F3 and F4 are referred to as antisense strands (abbreviated as AS).

[0168] Table 13. Oligonucleotides used in the ligation reaction of Example 7

[0169] Notes: "Pho" indicates a 5' phosphate group; "-" indicates a phosphodiester bond; m indicates 2' methoxy modification (2'-OCH3); "f" indicates 2' fluorine (2'-F) modification; "s" indicates α-phosphate thiomodification; "d" indicates that the nucleotide used is a deoxyribonucleotide; "VP" indicates 5' phosphate group. Modified with -(E)-vinylphosphonate.

[0170] The specific nucleotide chain synthesis scheme and analytical method are the same as those described in Example 8.

[0171] The results are shown in Table 14.

[0172] Table 14 Product formation in the linkage reaction of Example 9

[0173] Note: "ND" indicates that the corresponding product was not detected during liquid chromatography and mass spectrometry analysis.

[0174] In this embodiment, the reaction at 37°C for 2 h yielded a 65.4% yield of the target product from wild-type T4 Rnl2, along with 14.9% of non-target byproducts. When the reaction temperature was increased to 42°C, the yield of the target product decreased slightly, but the byproducts decreased by approximately 60%. Further increases in reaction temperature to 45°C and 50°C further reduced the production of byproducts. At 50°C, no byproducts were observed, but because wild-type T4 Rnl2 is essentially inactivated at high temperatures, the target product yield was only 11%. However, using Mut3, Mut6, and Mut9 at 45°C for 2 h yielded 89.5%, 90.2%, and 88.2% yields of the target product, respectively, and byproduct yields of 1.7%, 2.1%, and 2.0%. When Mut3, Mut6, and Mut9 were reacted at 50°C for 2 hours, the yields were 89.2%, 88.6%, and 90.1%, respectively, and no byproducts were detected by liquid chromatography-mass spectrometry. The results of this example demonstrate that the thermostable mutants of the present invention can significantly reduce byproducts caused by base mismatches when reacted at high temperatures. This effect is not limited to ribonucleotide chains composed of natural ribonucleotides but is also applicable to ribonucleotide chains composed of non-natural ribonucleotides.

[0175] Example 10: Improving the efficiency of nucleotide synthesis and reducing byproduct generation by adding a "high-temperature denaturation-low-temperature annealing" procedure. The mixture contains each oligonucleotide (nucleic acid substrate) shown in Table 15 at a final concentration of 1.6 mM, and 50 mM Tris 20 μL of a reaction solution consisting of HCl (pH 8.0), 12 mM MgCl2, 1 mM DTT, 4 mM ATP, and 0.005 mg / mL wild-type T4 Rnl2 or thermostable ligases L168F-N193K-R217P-T303D-S311E-I313V (Mut9) and A62W-P103G-N166P-L168F-N193K-R217P-T303D-S311E-I313V (Mut23) was added to a 200 μL microtube, and the reaction was carried out under temperature control using a PCR instrument. Figure 10 The reaction shown.

[0176] This embodiment includes the following experimental groups: Experimental groups 1, 6, and 11 were directly incubated at 37°C for 4 hours; experimental groups 2, 7, and 12 were directly incubated at 45°C for 4 hours; experimental groups 3, 8, and 13 were directly incubated at 55°C for 4 hours; experimental groups 4, 9, and 14 were incubated at 45°C for 1 hour, then heated to 55°C for 1 hour, and then annealed to 45°C for 2 hours; experimental groups 5, 10, and 15 were first incubated at 55°C for 1 hour, then annealed to 45°C for 1 hour, then heated to 55°C for 1 hour, and then annealed to 45°C for 1 hour. After the reaction was completed, 1 μL of the reaction solution was sampled and 49 μL of 10 mM EDTA solution was added to terminate the reaction, and liquid chromatography-mass spectrometry was performed to analyze the reaction products.

[0177] Table 15 Oligonucleotides used in Example 10

[0178] Notes: "Pho" indicates a 5' phosphate group; "-" indicates a phosphodiester bond; m indicates 2' methoxy modification (2'-OCH3); "f" indicates 2'-deoxy-2'-fluorine (2'-F) modification; "s" indicates α-phosphate thiomodification; "d" indicates that the nucleotide used is a deoxyribonucleotide; "VP" indicates 5' phosphate group. -(E)-vinylphosphonate modification (5 -VP).

[0179] The detection and analysis methods are the same as those described in Example 5, and the results are shown in Table 16.

[0180] Table 16. Formation of products from the ligation reaction in Example 10

[0181] Note: "ND" indicates that the corresponding product was not detected during liquid chromatography and mass spectrometry analysis.

[0182] The results of the examples show that reacting Mut9 at 55°C for 4 hours (Experimental Group 8) yielded a 46.8% yield with no detectable byproducts, while reacting wild-type T4 Rnl2 at 55°C for 4 hours (Experimental Group 4) yielded no detectable target product. This result verifies that Mut9 has better thermal stability and that reacting with Mut9 at 55°C effectively reduces byproduct formation. However, according to the examples, the byproducts generated by reacting Mut9 at 55°C for 4 hours were significantly lower than those generated by reacting Mut9 at 45°C for 4 hours, but the yield of Mut9 at 55°C for 4 hours (Experimental Group 8) was 46.8%, lower than the 68.2% yield of Mut9 at 45°C for 4 hours. Using Mut9, incubation was first performed at 45°C for 1 hour, then increased to 55°C for 1 hour, and finally annealed to 45°C for 2 hours (Experimental Group 9). The yield of the target product was 89.7%, higher than the 68.2% yield of Mut9 directly incubated at 45°C for 4 hours (Experimental Group 7), while the byproduct ratio was even lower, at only 2%. Using Mut9, incubation was first performed at 55°C for 1 hour, then annealed to 45°C for 1 hour, followed by increasing to 55°C for 1 hour, and finally annealed to 45°C for 1 hour, resulting in a yield of 91.1% (Experimental Group 10), with no byproducts detected. The experimental results of Mut23 in this embodiment were basically consistent with those of Mut9. These results indicate that when using the thermally stable T4Rnl2 mutant for ligation, adding a "high-temperature denaturation-low-temperature annealing" step can significantly improve the yield of the target product while reducing byproduct generation.

[0183] The sequence information involved in this application is shown in the table below.

[0184]

[0185] The sequences shown in the computer-readable sequence list as SEQ ID NO:5~27 are the unmodified sequences.

[0186] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A T4 RNA ligase 2 mutant, characterized in that, Compared to wild-type T4 RNA ligase 2, the T4 ligase 2 mutant has mutations at any one or more of the following positions in the amino acid sequence of wild-type T4 RNA ligase 2: positions 62, 103, 166, 193, 260, 297, 298, 303, 306, 311, 313, and 318.

2. The T4 RNA ligase 2 mutant according to claim 1, characterized in that, The mutation at position 62 includes A62W; The mutation at position 103 includes P103G; The mutation at position 166 is N166P; The mutation at position 193 includes N193K; The mutation at position 260 includes: C260D; The mutation at position 297 includes: T297A; The mutation at position 298 includes: S298E; The mutation at position 303 includes: T303D; The mutation at position 306 includes any one of Q306A, Q306D, and Q306E; The mutation at position 311 includes any one of S311E, S311D, S311A, and S311V; The mutation at position 313 includes: I313V; Optionally, the T4 RNA ligase 2 mutant has any of the following mutations or combinations thereof relative to the wild-type T4 RNA ligase 2: A62W, P103G, N166P, L168F, and C260D.

3. The T4 RNA ligase 2 mutant according to claim 2, characterized in that, The T4 RNA ligase 2 mutant has any of the following mutation combinations and combinations thereof relative to the wild-type T4 RNA ligase 2: N193K-S311D, N193K-T303D, N193K-T297A, T297A-Q306D, N193K-I313V, R217P-T297A, S311E-I313V.

4. A T4 RNA ligase 2 mutant, characterized in that, Compared to wild-type T4 RNA ligase 2, the T4 ligase 2 mutant has mutations at positions 168 and 217 of the amino acid sequence of wild-type T4 RNA ligase 2. Optionally, the mutation at position 168 is L168F; Optionally, the mutation at position 217 can be any one of R217A, R217Q, R217N, and R217P.

5. The T4 RNA ligase 2 mutant according to any one of claims 1 to 4, characterized in that, The amino acid sequence of the wild-type T4 RNA ligase 2 has at least 80% sequence identity with the sequence shown in SEQ ID NO:1 or 2; Optionally, the amino acid sequence of the wild-type T4 RNA ligase 2 is as shown in SEQ ID NO:1 or 2.

6. An isolated nucleic acid, characterized in that, It encodes the T4 RNA ligase 2 mutant as described in any one of claims 1 to 5.

7. A carrier, characterized in that, It contains the isolated nucleic acid as described in claim 6.

8. A host cell, characterized in that, It contains the carrier as described in claim 7.

9. The method for preparing the T4 RNA ligase 2 mutant according to any one of claims 1 to 5, characterized in that, It includes: Cultivate the host cells as described in claim 8.

10. The use of the T4 RNA ligase 2 mutant as described in any one of claims 1 to 5 in the synthesis of the target nucleotide chain or in the preparation of a product for the synthesis of the target nucleotide chain; Optionally, the target nucleotide chain includes an RNA chain and / or an RNA / DNA hybrid chain.