A biosensor for detecting serum miRNA-21 of cervical cancer patient
By assembling Ru(bpy)32+ and Ag nanoparticles in a biosensor and combining chain displacement reaction and catalytic hairpin self-assembly, the problem of low energy transfer efficiency caused by donor-acceptor steric hindrance was solved, and highly sensitive detection of miRNA-21 in the serum of cervical cancer patients was achieved with high accuracy and strong sensitivity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XUZHOU CENT HOSPITAL
- Filing Date
- 2026-03-12
- Publication Date
- 2026-06-09
AI Technical Summary
When existing biosensors detect miRNA-21 in the serum of cervical cancer patients, the spatial steric hindrance between the donor and receptor leads to low energy transfer efficiency, which reduces the stability and sensitivity of the detection.
By assembling Ru(bpy)32+ molecules and Ag nanoparticles in the same UiO-66-NH2 material, and combining the standpoint-mediated chain substitution reaction and the catalytic hairpin self-assembly signal amplification strategy, a highly efficient intramolecular RET-ECL biosensor was constructed using the catalytic action of glucose oxidase.
It improves the sensitivity and accuracy of detection, achieving highly sensitive detection of miRNA-21 in the serum of cervical cancer patients, with advantages of high accuracy, strong sensitivity and good specificity.
Smart Images

Figure CN121830839B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosensor technology, and in particular to a biosensor for detecting serum miRNA-21 in cervical cancer patients. Background Technology
[0002] Cervical cancer is one of the most common malignant tumors of the female reproductive tract. It originates from cervical intraepithelial lesions and can progress to invasive carcinoma over a long period, seriously threatening women's health. However, it is preventable and treatable, and early detection leads to a good prognosis. Currently, the main diagnostic methods for cervical cancer are cytology, colposcopy, imaging examinations, and HPV testing. However, some challenges cannot be ignored, such as the risk of false negatives, errors in biopsy sampling, insensitivity in early lesions, long diagnostic cycles, and reliance on procedures and judgment. As a diagnostic biomarker, miRNA-21 is abnormally highly expressed in the cervical lesion stage and is a key "oncogenic miRNA" promoting the development of cervical cancer. It can be detected through blood and cervical secretions to assist in early screening. Given the association between miRNA-21 expression levels and cervical cancer progression, designing an accurate and sensitive method to assess the miRNA-21 content in the serum of cervical cancer patients is crucial.
[0003] Researchers have designed various resonant energy transfer-based electrochemiluminescence (RET-ECL) biosensors, such as quantum dot-gold nanosphere pairing, quantum dot-silver nanocluster pairing, g-C3N4 nanolayer-MnO2 nanoflower pairing, and Ru(phen)3... 2+ -Au nanocage pairing, etc. However, the steric hindrance of biomolecules between the donor and acceptor leads to low energy transfer efficiency, thereby reducing the efficiency of RET-ECL. For intramolecular RET-ECL, reducing steric hindrance can avoid the problems of random spatial fluctuations and poor assembly stability of donor-acceptor pairs, significantly improving the stability, anti-interference ability, and application flexibility of the RET-ECL system. This invention aims to develop a biosensor based on intramolecular RET-ECL to achieve highly sensitive detection of miRNA-21 in the serum of cervical cancer patients. Summary of the Invention
[0004] The purpose of this invention is to provide a biosensor for detecting serum miRNA-21 in cervical cancer patients, thereby addressing the problems existing in the prior art. The biosensor of this invention utilizes the large specific surface area of UiO-66-NH2 to incorporate a large amount of Ru(bpy)3. 2+The molecule (energy donor) and Ag nanoparticles (energy acceptor) are assembled in the same UiO-66-NH2, exhibiting a highly efficient intramolecular RET-ECL effect, enhancing the ECL sensing response. Based on a foothold-mediated chain substitution reaction and a catalytic hairpin self-assembly signal amplification strategy, the diversity of substrate selection and the sensitivity of detection are improved. The catalysis of a biological enzyme (glucose oxidase, GOD) improves the accuracy and timeliness of the biosensor. The biosensor of this invention has advantages such as high accuracy, high sensitivity, and good specificity, and can be applied to the sensitive determination of miRNA-21 in the serum of cervical cancer patients, demonstrating significant application value.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides a biosensor for detecting miRNA-21 in the serum of cervical cancer patients, the biosensor comprising a sensing substrate and a DNA molecule system;
[0007] The sensing substrate is a glassy carbon electrode modified with an H1 chain and a Ru@UiO-66-NH2@Ag complex; the nucleotide sequence of the H1 chain is shown in SEQ ID NO.6;
[0008] The DNA molecular system includes an F strand, an S:L:T double strand, and H2-GOD;
[0009] The nucleotide sequence of the F chain is shown in SEQ ID NO.5;
[0010] In the S:L:T double strand, the nucleotide sequence of the S strand is shown in SEQ ID NO.2, the nucleotide sequence of the L strand is shown in SEQ ID NO.3, and the nucleotide sequence of the T strand is shown in SEQ ID NO.4.
[0011] The H2-GOD is obtained by coupling the H2 chain with GOD; the nucleotide sequence of the H2 chain is shown in SEQ ID NO.7.
[0012] Furthermore, the preparation method of the Ru@UiO-66-NH2@Ag complex includes the following steps:
[0013] A1. Disperse UiO-66-NH2 in ethanol, and then disperse Ru(bpy)3. 2+ Dissolved in N,N-dimethylformamide; the two solutions were mixed in equal volumes to obtain Ru@UiO-66-NH2;
[0014] A2. Mix the Ru@UiO-66-NH2 solution with a tannic acid solution, adjust the pH to 7.2-7.6, add AgNO3 solution, and incubate to obtain the Ru@UiO-66-NH2@Ag complex.
[0015] Further, in step A1, the mass-to-volume ratio of UiO-66-NH2 to ethanol is 1 mg: 8-12 mL;
[0016] The Ru(bpy)3 2+ The mass-to-volume ratio of the N,N-dimethylformamide to the N,N-dimethylformamide is 1 mg: 4-6 mL;
[0017] The mixing temperature is 85-95℃, and the mixing time is 10-14 h;
[0018] In step A2, the volume ratio of the Ru@UiO-66-NH2 solution to the tannic acid solution and the AgNO3 solution is 8-15:0.4-0.6:0.4-0.6;
[0019] The concentration of the Ru@UiO-66-NH2 solution is 1.5-1.8 mg / mL; the concentration of the tannic acid solution is 35-45 mg / mL; and the concentration of the AgNO3 solution is 0.15-0.3 M.
[0020] The incubation temperature is 20-25℃, and the incubation time is 1-2 h.
[0021] The present invention also provides a method for constructing the biosensor as described above, the method comprising the following steps:
[0022] S1. Add Ru@UiO-66-NH2@Ag composite to the polished glassy carbon electrode surface to obtain Ru@UiO-66-NH2@Ag / GCE electrode;
[0023] S2. Immerse the Ru@UiO-66-NH2@Ag / GCE electrode in a solution of H1 chains and react to obtain the sensing substrate;
[0024] S3. Mix the S chain, L chain and T chain in an equimolar ratio to obtain the S:L:T double chain; couple the H2 chain with GOD via a bifunctional coupling agent to obtain H2-GOD.
[0025] Furthermore, the amount of Ru@UiO-66-NH2@Ag complex added is 8-12 μL;
[0026] The concentration of the H1 chain solution is 2-3 μM;
[0027] The reaction conditions are: reaction at 4℃ for 2-4 h.
[0028] Furthermore, the solution of the H1 chain is incubated with 10 mM tris(2-carboxyethyl)phosphonic acid hydrochloride at 25°C for 1 h before use to break the disulfide bonds.
[0029] Optionally, the bifunctional coupling agent is maleimide benzoate succinimide ester.
[0030] The present invention also provides the application of the above-mentioned biosensor in the preparation of products for detecting the content of miRNA-21 in the serum of cervical cancer patients.
[0031] The present invention also provides a kit for detecting the level of miRNA-21 in the serum of cervical cancer patients, the kit comprising the above-mentioned biosensor.
[0032] This invention also provides the application of the above-mentioned biosensor in the detection of miRNA-21 for non-diagnostic purposes, wherein the method for detecting miRNA-21 includes the following steps:
[0033] N1. Mix the sample to be tested with the F chain and the S:L:T double strand, and react to obtain the miRNA-21-dependent S chain;
[0034] N2. The sensing substrate is mixed with the miRNA-21-dependent S-chain and the H2-GOD and reacted. The reacted sensing substrate is then immersed in a glucose solution and incubated. A three-electrode system is formed using the incubated sensing substrate as the working electrode, the Ag / AgCl electrode as the reference electrode, and the platinum wire as the auxiliary electrode. The electrochemiluminescence signal is detected in a tri-n-propylamine solution, and the miRNA-21 content is calculated based on the standard curve.
[0035] Further, in step N1, the final concentration of the F chain and the final concentration of the S:L:T double chain in the resulting solution are 2-3 μM.
[0036] The reaction conditions are: 0.5-1.5 h at 37°C.
[0037] Further, in step N2, the final concentration of H2-GOD in the resulting solution is 2-3 μM;
[0038] The reaction conditions are: 37℃ for 40-60 min;
[0039] The incubation conditions are: incubation at 20-25℃ for 0.5-1.5 h.
[0040] The present invention discloses the following technical effects:
[0041] This invention constructs a miRNA-21 biosensor based on intramolecular ECL-RET, enabling precise detection of miRNA-21 levels in the serum of cervical cancer patients. A schematic diagram of the biosensor's fabrication process and detection mechanism is shown below. Figure 1 As shown, this biosensor uses H1 / Ru@UiO-66-NH2@Ag / GCE as the ECL sensing substrate, Ru@UiO-66-NH2 as the energy donor, and Ag nanoparticles as the energy receiver to perform intramolecular RET-ECL effect. Through a foothold-mediated chain substitution reaction, it achieves signal amplification and transduction of miRNA-21 (S-chain). The H2 chain, labeled with a bioenzyme (glucose oxidase, GOD), is self-assembled onto the electrode surface via a catalytic hairpin, further amplifying the signal cyclically. Based on changes in the bioenzyme ECL signal, it achieves highly sensitive detection of miRNA-21, with a sensitivity as low as 30 aM.
[0042] This invention utilizes the large specific surface area of UiO-66-NH2 to incorporate a large amount of Ru(bpy)3. 2+ The assemblies of molecules (energy donors) and Ag nanoparticles (energy acceptors) within the same UiO-66-NH2 matrix exhibit a highly efficient intramolecular RET-ECL effect, enhancing the ECL sensing response. Based on a foothold-mediated chain substitution reaction and a catalytic hairpin self-assembly signal amplification strategy, the diversity of substrate selection and detection sensitivity are improved. The catalysis of bioenzymes further enhances the accuracy and timeliness of the biosensor. The biosensor prepared in this invention possesses advantages such as high accuracy, strong sensitivity, and good specificity, and can be applied to the sensitive determination of miRNA-21 in the serum of cervical cancer patients, demonstrating significant application value in the clinical diagnosis and drug research of cervical cancer. Attached Figure Description
[0043] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0044] Figure 1 This is a schematic diagram illustrating the fabrication process and detection mechanism of the biosensor of the present invention;
[0045] Figure 2 Figure 1 shows the structural characterization results of the Ru@UiO-66-NH2@Ag complex; where (A) is the transmission electron microscope image of the Ru@UiO-66-NH2@Ag complex; and (B) is the X-ray photoelectron spectrum of the Ru@UiO-66-NH2@Ag complex.
[0046] Figure 3 The image shows the verification results of the intramolecular RET-ECL effect of the Ru@UiO-66-NH2@Ag complex; where (A) is the UV-Vis absorption spectrum of Ag nanoparticles and Ru(bpy)3. 2+ (A) ECL emission spectrum; (B) Transmission electron microscopy image of Ru@UiO-66-NH2@Ag after treatment with GOD and glucose;
[0047] Figure 4 Figure 1 shows the feasibility verification results of the standpoint-mediated chain substitution reaction and the catalytic hairpin self-assembly reaction. In this figure, (A) is a gel electrophoresis diagram of the feasibility of the standpoint-mediated chain substitution reaction, where lane 1 represents the T chain, lane 2 represents the S chain, lane 3 represents the L chain, lane 4 represents miRNA-21, lane 5 represents a mixture of T, L and S chains, lane 6 represents the substance after incubation of S:L:T double strands with miRNA-21, lane 7 represents the F chain, and lane 8 represents the substance after F chain treatment in lane 6; (B) is a gel electrophoresis diagram of the feasibility of the catalytic hairpin self-assembly reaction, where lane 1 represents the H1 chain, lane 2 represents the S chain, lane 3 represents the H2 chain, lane 4 represents a mixture of H1 and S chains, and lane 5 represents the substance after H2 chain incubation in lane 4.
[0048] Figure 5 EIS response diagram of the sensor substrate interface construction process; where a represents naked GCE, b represents Ru@UiO-66-NH2@Ag / GCE, c represents H1 / Ru@UiO-66-NH2@Ag / GCE sensor substrate, d represents the sensor substrate after c reacts with miRNA-21-dependent S-strand, and e represents the sensor substrate after d reacts with H2-GOD.
[0049] Figure 6 ECL-potential response diagrams for different sensing substrate interfaces; where a represents Ru@UiO-66-NH2@Ag / GCE, b represents H1 / Ru@UiO-66-NH2@Ag / GCE, c represents the sensing substrate after b reacts with H2-GOD, and d represents the sensing substrate after b reacts with a mixture of miRNA-21-dependent S-chain and H2-GOD.
[0050] Figure 7 ECL-time response curves for different concentrations of miRNA-21 are shown; where ai corresponds to concentrations of 0, 100 aM, 500 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, and 100 pM, respectively.
[0051] Figure 8 This is a graph showing the linear relationship between ΔECL and the logarithm of miRNA-21 concentration.
[0052] Figure 9 This is a graph showing the specific detection results of the biosensor of the present invention; where 1-3 are the results of three parallel measurements.
[0053] Figure 10 The graph shows the results of the detection of miRNA-21 levels in serum samples from healthy individuals and cervical cancer patients.
[0054] Figure 11 This is a comparison chart showing the detection results of miRNA-21 content in serum samples from cervical cancer patients using the biosensor of this invention and the qRT-PCR method. Detailed Implementation
[0055] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0056] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0057] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0058] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0059] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0060] The sequence information involved in this invention is as follows:
[0061] miRNA-21: 5′-UAGCUUAUCAGACUGAUGUUGA-3′; SEQ ID NO.1;
[0062] S-chain: 5′-GTGCGATACTGTACATCTTCGTTTC-3′; SEQ ID NO.2;
[0063] L chain: 5′-TCAACATCAGTCTGATAAGCTATATAGGGGAAACGAAGATGTACAGTAT CGCAC-3′; SEQID NO.3;
[0064] T-chain: 5′-AAACCTATATAGCTTATCAGACTG-3′; SEQ ID NO.4;
[0065] F chain: 5′-GTGCGATACTGTACATCTTCGTTTCCCCTATATAGCTTATCAGACTGA-3′; SEQ IDNO.5;
[0066] H1 chain: 5′-SH-GAAACGAAGATGTACAGTATCGCACCCATGTGTAGACGACATACTGTACATCCCTTGT-3′; SEQ ID NO.6;;
[0067] H2 chain: 5′-GTATGTCGTCTACACATGGGTGCGATACTGTACATCCCATGTGTAGC-SH-3′; SEQ ID NO.7.
[0068] This embodiment provides a biosensor for detecting miRNA-21 in the serum of cervical cancer patients, comprising a sensing substrate and a DNA molecule system. Its construction process is as follows:
[0069] S1. The glassy carbon electrode (GCE) was successively polished with 0.3 μm and 0.05 μm aluminum powder, then ultrasonically cleaned with ethanol and deionized water for 5 min, and dried with nitrogen. 10 μL of Ru@UiO-66-NH2@Ag composite was dropped onto its surface to obtain the Ru@UiO-66-NH2@Ag / GCE electrode.
[0070] The preparation method of the Ru@UiO-66-NH2@Ag complex is as follows:
[0071] 1 mg of UiO-66-NH2 was dispersed in 10 mL of anhydrous ethanol, and 2 mg of Ru(bpy)3Cl2 was dissolved in 10 mL of N,N-dimethylformamide. The two solutions were mixed and stirred at 90 °C for 12 h to obtain the Ru@UiO-66-NH2 product. The product was washed with N,N-dimethylformamide and then dried under vacuum at 80 °C. 10 mL of Ru@UiO-66-NH2 (1.6 mg / mL) was added to 0.5 mL of tannic acid (40 mg / mL) solution, and the pH was adjusted to 7.5 with 0.1 M NaOH solution. Then, 0.5 mL of AgNO3 (0.2 M) was added, and the mixture was stirred at room temperature for 1.5 h to obtain the Ru@UiO-66-NH2@Ag complex.
[0072] S2. Immerse the Ru@UiO-66-NH2@Ag / GCE electrode in 100 μL of H1 chain (2.5 μM) solution and incubate at 4℃ for 3 h to obtain the sensing substrate H1 / Ru@UiO-66-NH2@Ag / GCE. Before use, the H1 chain needs to be incubated with 10 mM tris(2-carboxyethyl)phosphonic acid hydrochloride at 25℃ for 1 h to break the disulfide bonds.
[0073] S3, the DNA molecular system includes the F strand, S:L:T double strand, and H2-GOD;
[0074] The preparation method of S:L:T double chain is as follows: S chain, L chain and T chain are mixed in equimolar ratio and reacted for 1 h;
[0075] The preparation method of H2-GOD is as follows: 100 μM of thiol-labeled H2 chain is mixed with an equal volume of GOD (1 mg / mL) and reacted for 1 h in the presence of maleimide benzoate succinimide ester.
[0076] The method of using the biosensor constructed above is as follows:
[0077] N1. Serum samples from cervical cancer patients (containing miRNA-21) and the F chain were added to 100 μL of S:L:T double-stranded solution to achieve a final concentration of 2.5 μM for both the S:L:T double-stranded and F chains. The mixture was reacted at 37°C for 1 h to obtain the miRNA-21-dependent S chain. This step enables the signal transduction of miRNA-21 in the serum of cervical cancer patients.
[0078] N2. The sensing substrate H1 / Ru@UiO-66-NH2@Ag / GCE was reacted with 100 μL of a mixed solution containing miRNA-21-dependent S-chain and 2.5 μM H2-GOD at 37 °C for 50 min to activate the catalytic hairpin self-assembly cycle reaction on the surface of the sensing substrate. Then, the sensing substrate was placed in 100 μL of glucose solution (10 mM) and incubated at 25 °C for 1 h. Finally, using the incubated sensing substrate as the working electrode, an Ag / AgCl electrode as the reference electrode, and a platinum wire as the auxiliary electrode, a three-electrode system was formed, and the electrochemiluminescence (ECL) signal was detected in tri-n-propylamine solution. The ECL signal was detected using a multifunctional electrochemical and chemiluminescence instrument with a photomultiplier tube of 500 V and a cycling voltage range of 0–1.4 V. The level of miRNA-21 in the serum of cervical cancer patients can be calculated using a standard curve between ΔECL (the difference in ECL signal between the presence and absence of miRNA-21) and the logarithm of miRNA-21 concentration.
[0079] Example 2
[0080] This embodiment tests the performance of the biosensor prepared in Example 1. The specific process is as follows:
[0081] (1) Characterization of Ru@UiO-66-NH2@Ag
[0082] The biosensor of this invention utilizes the intramolecular RET-ECL effect of Ru@UiO-66-NH2@Ag to improve the ECL sensing response. To verify the successful synthesis of Ru@UiO-66-NH2@Ag, the Ru@UiO-66-NH2@Ag prepared in Example 1 needs to be characterized. First, the structure of Ru@UiO-66-NH2@Ag was observed using transmission electron microscopy, as shown below. Figure 2 As shown in Figure A, a large number of Ag nanoparticles are assembled on the surface of the Ru@UiO-66-NH2 three-dimensional structure; secondly, X-ray photoelectron spectroscopy is used to analyze Ru@UiO-66-NH2@Ag, such as... Figure 2 As shown in Figure B, this material contains Zr, Ru, C, Ag, N, and O elements. The above results indicate that Ru@UiO-66-NH2@Ag was successfully synthesized.
[0083] Next, the intramolecular RET-ECL effect of Ru@UiO-66-NH2@Ag was verified by analyzing the UV-Vis absorption spectrum of Ag nanoparticles and the ECL emission spectrum of Ru@UiO-66-NH2@Ag. Figure 3As shown in Figure A, the ECL emission spectrum (600 nm) of Ru@UiO-66-NH2 shows significant overlap with the UV-Vis absorption spectrum of Ag nanoparticles. Energy transfer and partial spectral overlap provide the possibility for RET-ECL to occur between Ru@UiO-66-NH2 (energy donor) and Ag NPs (energy acceptors), leading to quenching of ECL intensity.
[0084] After treating Ru@UiO-66-NH2@Ag with 1 mg / mL GOD and 10 mM glucose, the results were analyzed using transmission electron microscopy. Figure 3 As shown in Figure B, the loading of Ag nanoparticles decreases. In the presence of O2, the H2O2 generated by GOD-catalyzed glucose oxidation continuously decomposes the Ag nanoparticles loaded on Ru@UiO-66-NH2 into Ag. + The ECL signal was restored.
[0085] (2) Characterization of the sensing substrate
[0086] The biosensor of this invention uses Ru@UiO-66-NH2@Ag as the sensing substrate and amplifies the signal through a foothold-mediated chain substitution reaction and a catalytic hairpin self-assembly signal amplification strategy to improve detection sensitivity. Therefore, the feasibility of the sensing interface construction process, the foothold-mediated chain substitution reaction, and the catalytic hairpin self-assembly reaction is monitored and verified.
[0087] like Figure 4 As shown in Figure A, lanes 1-4 represent the T, S, L, and miRNA-21 chains, respectively. Lane 5 represents a mixture of the T, L, and S chains, with the delayed new band indicating the formation of the S:L:T double helix. Lane 6 represents the incubation of the S:L:T double helix with miRNA-21, showing a new, rapidly migrating band, indicating that miRNA-21-induced S chain release is feasible. Lane 7 represents the F chain, and lane 8 represents the product from lane 6 further treated with the F chain, yielding two new bands. The slower band is attributed to the formation of the L:F double helix, while the other band indicates the release of miRNA-21, demonstrating the feasibility of basement-mediated strand displacement reactions and miRNA-21 cyclic amplification. Figure 4 In lane B, lanes 1-3 represent the H1, S, and H2 chains, respectively. Lane 4 represents a mixture of H1 and S chains, with the lagging new band representing the formation of the H1:S double chain. When the H1:S double chain is incubated with the H2 chain, two bands are observed in lane 5. The band with lower migration indicates the formation of the H1:H2 double chain, while the faster-migrating band is attributed to the release of the S chain. These observations confirm the feasibility of the catalytic hairpin self-assembly reaction.
[0088] Next, the construction of the sensing interface was characterized using electrochemical impedance spectroscopy (EIS) and electrochemical liquid chromatography (ECL) techniques. For example... Figure 5 As shown in curve a, on the bare GCE surface, the electron transfer impedance (Ra) is... et The RΩ of the Ru@UiO-66-NH2@Ag electrode obtained after Ru@UiO-66-NH2@Ag is assembled onto the GCE surface is approximately 624 Ω. et The Ω value increased to 1628 Ω (curve b), which is attributed to Ru(bpy)3. 2+ The non-conductive nature of UiO-66-NH2. When the modified sensing substrate was incubated sequentially with H1 (2384 Ω, curve c) and the miRNA-21-dependent S-strand (2747 Ω, curve d), both the negative charge and non-electro-activity of the DNA strand hindered [Fe(CN)6]. 3- / 4- Diffusion transport to the electrode surface, which in turn leads to R et The value continued to increase. Finally, when H2-GOD was introduced onto the surface of the sensing substrate, R... et The maximum value (4252 Ω, curve e) was reached, confirming the feasibility of the catalytic hairpin self-assembly reaction and the formation of the sensing interface H1:H2-GOD assembly. According to R... et The change in the value proves the successful construction of the biosensor.
[0089] At the same time, Figure 6 In the first curve, after Ru@UiO-66-NH2@Ag was assembled onto the GCE surface, a low ECL signal of 2885 au was observed (curve a). Curve b represents the incubation of Ru@UiO-66-NH2@Ag / GCE with the H1 chain, where the ECL signal decreased to 2438 a.u. Notably, after H1 / Ru@UiO-66-NH2@Ag / GCE was directly incubated with H2-GOD, the ECL signal remained almost unchanged (2432 au, curve c), indicating that no hybridization reaction occurred between H1 and H2. Although H1 and H2 have the potential to form H1:H2 double strands, their spontaneous hybridization is kinetically hindered by the secondary structure of the hairpin probe itself. However, when the modified electrode was incubated with H2-GOD and reacted in glucose, the ECL intensity increased to 5764 au (curve d). The H2O2 generated in situ by the GOD enzymatic reaction can etch Ag nanoparticles loaded on the Ru@UiO-66-NH2 surface, thereby inhibiting the growth of Ag nanoparticles from Ru(bpy)3. 2+ The RET-ECL effect of Ag nanoparticles was observed. Simultaneously, the reduced coverage of Ag NPs also contributed to the recovery of ECL signal. Therefore, the content of the target miRNA-21 was directly related to the degree of signal recovery.
[0090] (3) Validation of the detection performance of the biosensor
[0091] The detection performance of the biosensor was verified using different concentrations of miRNA-21 (0, 100 aM, 500 aM, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM and 100 pM) according to the usage method described in Example 1.
[0092] ECL-time response curves of different concentrations of miRNA-21 are shown below Figure 7 As shown in the figure, the ECL intensity gradually increases with the increase of miRNA-21 concentration. The linear relationship between the ECL signal change value (ΔECL) and the logarithm of the miRNA-21 concentration is as follows: Figure 8 As shown, the linear regression equation is ΔECL = 1029.9 logc(M) - 16780.4(R²). 2 =0.997), detection limit is 30 aM (S / N=3).
[0093] Furthermore, miRNA-141, miRNA-155, and miRNA-122 were used as interfering agents to detect the specificity of the biosensor. The results are as follows: Figure 9 As shown, when miRNA-141, miRNA-155, and miRNA-122 replaced the target miRNA-21, the ECL response showed negligible changes compared to the blank control, demonstrating that the biosensor has high specificity for miRNA-21 detection.
[0094] Example 3
[0095] This embodiment uses serum samples from 15 cervical cancer patients and 15 healthy volunteers (collected from Xuzhou Central Hospital in May 2025) to verify the detection performance of the biosensor in Example 1. The specific procedure is as follows: Total RNA was extracted from the serum samples using Trizol reagent according to the kit instructions. Then, miRNA-21 was detected according to the method described in Example 1. The concentration of miRNA-21 in the serum samples was calculated using the linear regression equation from Example 2, and the results are as follows. Figure 10 As shown, based on the ECL response, the expression abundance of miRNA-21 in the serum samples of cervical cancer patients was significantly higher than the corresponding concentration in the serum of healthy volunteers, showing a significant statistical difference (p<0.001).
[0096] In addition, miRNA-21 was detected using a standard qRT-PCR commercial kit (purchased from Guangzhou Ruibo Biotechnology Co., Ltd.), and the results were compared with those of the biosensor of this invention. The results are as follows: Figure 11As shown, the detection concentration error between the two methods is less than 5%. This result demonstrates that the biosensor of this invention has good detection capabilities and applications even for complex clinical serum samples.
[0097] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A biosensor for detecting serum miRNA-21 in cervical cancer patients, characterized in that, The biosensor includes a sensing substrate and a DNA molecule system; The sensing substrate is a glassy carbon electrode modified with an H1 chain and a Ru@UiO-66-NH2@Ag complex; the nucleotide sequence of the H1 chain is shown in SEQ ID NO.6; The DNA molecular system includes an F strand, an S:L:T double strand, and H2-GOD; The nucleotide sequence of the F chain is shown in SEQ ID NO.5; In the S:L:T double strand, the nucleotide sequence of the S strand is shown in SEQ ID NO.2, the nucleotide sequence of the L strand is shown in SEQ ID NO.3, and the nucleotide sequence of the T strand is shown in SEQ ID NO.
4. The H2-GOD is obtained by coupling the H2 chain with GOD; the nucleotide sequence of the H2 chain is shown in SEQ ID NO.
7.
2. The biosensor according to claim 1, characterized in that, The preparation method of the Ru@UiO-66-NH2@Ag complex includes the following steps: A1. Disperse UiO-66-NH2 in ethanol, and then disperse Ru(bpy)3. 2+ Dissolved in N,N-dimethylformamide; the two solutions were mixed in equal volumes to obtain Ru@UiO-66-NH2; A2. Mix the Ru@UiO-66-NH2 solution with a tannic acid solution, adjust the pH to 7.2-7.6, add AgNO3 solution, and incubate to obtain the Ru@UiO-66-NH2@Ag complex.
3. The biosensor according to claim 2, characterized in that, In step A1, the mass-to-volume ratio of UiO-66-NH2 to ethanol is 1 mg: 8-12 mL; The Ru(bpy)3 2+ The mass-to-volume ratio of the N,N-dimethylformamide is 1 mg: 4-6 mL; The mixing temperature is 85-95℃, and the mixing time is 10-14 h; In step A2, the volume ratio of the Ru@UiO-66-NH2 solution to the tannic acid solution and the AgNO3 solution is 8-15:0.4-0.6:0.4-0.6; The concentration of the Ru@UiO-66-NH2 solution is 1.5-1.8 mg / mL; the concentration of the tannic acid solution is 35-45 mg / mL; and the concentration of the AgNO3 solution is 0.15-0.3 M. The incubation temperature is 20-25℃, and the incubation time is 1-2 h.
4. A method for constructing a biosensor as described in any one of claims 1-3, characterized in that, The construction method includes the following steps: S1. Add Ru@UiO-66-NH2@Ag composite to the polished glassy carbon electrode surface to obtain Ru@UiO-66-NH2@Ag / GCE electrode; S2. Immerse the Ru@UiO-66-NH2@Ag / GCE electrode in a solution of H1 chains and react to obtain a sensing substrate; S3. Mix the S chain, L chain and T chain in an equimolar ratio to obtain the S:L:T double chain; couple the H2 chain with GOD via a bifunctional coupling agent to obtain H2-GOD.
5. The construction method according to claim 4, characterized in that, The amount of Ru@UiO-66-NH2@Ag complex added was 8-12 μL; The concentration of the H1 chain solution is 2-3 μM; The reaction conditions are: reaction at 4℃ for 2-4 h.
6. The use of the biosensor according to any one of claims 1-3 in the preparation of a product for detecting the level of miRNA-21 in the serum of cervical cancer patients.
7. A kit for detecting the level of miRNA-21 in the serum of cervical cancer patients, characterized in that, The kit contains the biosensor according to any one of claims 1-3.
Citation Information
Patent Citations
Method for detecting miRNA-21
CN113621687A
Integrated electrochemical biosensor capable of detecting double miRNAs with high sensitivity
CN120651941A