LhNCED3b gene as well as expression protein and application thereof

Abstract

The invention discloses an LhNCED3b gene as well as an expression protein and application thereof, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the LhNCED3b gene provided by the invention is as shown in SEQ ID NO.1, and the amino acid sequence of protein expressed by the LhNCED3b gene is as shown in SEQ ID NO.2. According to the application, by constructing a CRISPR / Cas9 editing vector, LhNCED3b knockout of hybrid liriodendron is realized, and in combination with LhNCED3b gene overexpression analysis, it is found that under a salt stress condition, an LhNCED3b overexpression strain significantly improves salt tolerance by inhibiting active oxygen accumulation, maintaining moisture balance and enhancing membrane stability; and the knockout strain shows serious stress damage due to pore regulation disorder and oxidation resistance weakening, which indicates that the LhNCED3b gene positively regulates and controls the salt stress response of the hybridized liriodendron fine variety by regulating and controlling the redox steady state and the osmotic protection mechanism.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, and more specifically, relates to an LhNCED3b gene, its expressed protein, and its applications. Background Technology

[0002] The NCED (9-cis-epoxycarotenoid dioxygenase) gene, encoding a key rate-limiting enzyme in the abscisic acid (ABA) biosynthesis pathway, has been a hot topic in plant stress physiology and molecular biology research since its discovery. In 1997, Schwartz et al. first cloned the VP14 gene (later named ZmNCED1) from a maize mutant, discovering that the protease encoded by this gene has the ability to catalyze the cleavage of 9-cis-epoxycarotenoids to produce flavonoids, a cleavage reaction that has been confirmed as a key step in ABA synthesis. Further experimental verification showed a significant positive correlation between the expression level of the NCED gene and the ABA content in plants. Moreover, the activity of the NCED gene is strongly induced under abiotic stress conditions such as drought and high salinity. These findings fully highlight the importance of NCED in plant stress responses. With the development of molecular biology techniques, the NCED gene has been successively identified in plants such as tobacco (Nicotiana tabacum), soybean (Glycinemax), potato (Solanum tuberosum), and strawberry (Fragaria × ananassa).

[0003] The hybrid tulip tree (Liriodendron chinense × L. tulipifera) is an interspecific hybrid of the genus Liriodendron, exhibiting significant hybrid vigor, characterized by rapid growth, excellent timber quality, and strong stress resistance. It is an important fast-growing timber and landscaping tree species. However, the molecular mechanisms underlying its superior stress resistance are not yet fully understood. Therefore, obtaining and studying the NCED gene in the hybrid tulip tree is crucial for revealing the physiological mechanisms of its excellent stress resistance (such as drought and salt tolerance) at the molecular level. It can also provide key gene resources for molecular-assisted breeding and genetic improvement of stress resistance, thereby further enhancing its ecological and economic value. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, the primary technical problem solved by this application is to provide an LhNCED3b gene and its expressed protein. A further technical problem to be solved by this application is to provide specific applications of the aforementioned LhNCED3b gene.

[0005] An LhNCED3b gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The amino acid sequence of the expressed protein of the LhNCED3b gene is shown in SEQ ID NO.2.

[0007] A biological material, said biological material being an expression cassette, recombinant vector, or recombinant cell containing the LhNCED3b gene.

[0008] The application of the LhNCED3b gene, the expressed protein of the LhNCED3b gene, or the biological material in molecular breeding of Liriodendron tulipifera.

[0009] The application of the LhNCED3b gene, the LhNCED3b gene expression protein, or the biological material in regulating the resistance of tulip trees to abiotic stress.

[0010] In some embodiments, the application specifically involves overexpressing the LhNCED3b gene in Liriodendron tulipifera.

[0011] In some embodiments, the application specifically involves: constructing an overexpression vector involved in the LhNCED3b gene, transforming it into tulip trees, and culturing and screening to obtain transgenic tulip trees with enhanced resistance to abiotic stress.

[0012] In some embodiments, the abiotic stress is salt stress or drought stress.

[0013] In some embodiments, the overexpression vector of the LhNCED3b gene is pBI121-LhNCED3b.

[0014] In some embodiments, the transformation is mediated by Agrobacterium.

[0015] Compared with the prior art, the beneficial effects of this application are as follows:

[0016] This application provides an LhNCED3b gene, the nucleotide sequence of which is shown in SEQ ID NO.1, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2. Subsequently, by using the LhU6-3, LhU6-7, and LhU3-3 promoters to drive sgRNA expression and the 35S promoter to drive Cas9 expression, a three-target gene editing vector for LhNCED3b was constructed, successfully achieving a large deletion of approximately 230 bp in a hybrid tulip tree variety. Combined with LhNCED3b gene overexpression analysis, it was found that under salt stress conditions, LhNCED3b overexpression lines significantly improved salt tolerance by inhibiting reactive oxygen species accumulation, maintaining water balance, and enhancing membrane stability; while knockout lines exhibited severe stress damage due to stomatal regulation dysregulation and weakened antioxidant capacity. These results indicate that the LhNCED3b gene positively regulates the salt stress response of hybrid tulip tree varieties by regulating redox homeostasis and osmotic protection mechanisms. This application provides an effective genetic resource for revealing the mechanism of the excellent stress resistance of hybrid tulip trees (such as drought resistance and salt tolerance) at the molecular level and improving their stress resistance. Attached Figure Description

[0017] Figure 1-1 Image for identifying callus edited by LhNCED3b gene in hybrid tulip tree: (a) Regenerated callus edited by LhNCED3b gene in hybrid tulip tree, (b) Schematic diagram of CRISPR / Cas9-LhNCED3b vector, (c) Gel electrophoresis image of LhTRX-h3-KO callus DNA, "+" represents positive control, "-" represents negative control;

[0018] Figure 1-2 Sequencing diagram of LhTRX-h3-KO callus DNA target;

[0019] Figure 2 The images show the identification of LhNCED3b overexpression callus in hybrid tulip tree: (a) LhNCED3b overexpression regenerated callus, (b) schematic diagram of LhNCED3b overexpression vector, (c) gel electrophoresis image of LhNCED3b-OE callus DNA, where "+" represents positive control and "-" represents negative control, and (d) determination of LhNCED3b-OE overexpression level in different strains.

[0020] Figure 3Phenotypic and growth trait statistics of LhNCED3b transgenic lines: (a) Phenotypic diagrams of overexpression (LhNCED3b-OE), gene knockout (LhNCED3b-KO) and wild type (WT) plants; (b, c, d) Main root length (b), plant height (c), and leaf area (d) of WT, LhNCED3b-OE and LhNCED3b-KO transgenic lines. Different letters represent significant differences under Tukey HSD test (p < 0.05);

[0021] Figure 4-1 Phenotypic dynamics analysis of different LhNCED3b genotypes under salt stress: (a) Overall phenotypic changes of wild-type (WT), overexpression (LhNCED3b-OE) and knockout (LhNCED3b-KO) plants after 0, 1, 3, 5 and 7 days of salt stress treatment, with each time point containing images of plants with three biological replicates;

[0022] Figure 4-2 The graph shows the results of H2O2 content (top), relative water content (bottom left), and MDA content (bottom right) of LhNCED3b plants with different genotypes after 0 and 3 days of salt stress treatment. Different letters indicate significant differences between groups (p < 0.05, Tukey HSD test).

[0023] Figure 5 Comparison of DAB and NBT staining of leaves of WT, LhNCED3b-OE and LhNCED3b-KO plants after 0 and 3 days of salt stress treatment.

[0024] Figure 6 Phenotypic and statistical analysis of stomatal aperture of different LhNCED3b genotypes under salt stress: (a) Microscopic images of stomata of wild-type (WT), overexpressing (LhNCED3b-OE) and knockout (LhNCED3b-KO) plants before salt stress treatment (day 0) and day 3 after treatment (scale bar = 50 µm), (b) Comparison of stomatal aperture (stomatal width / length ratio) of each genotype before and after salt stress treatment. Data are expressed as mean ± standard deviation (n = 30). Different letters indicate significant differences between groups (p < 0.05, Tukey HSD test). Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention is further described below with reference to specific embodiments. Unless otherwise described in detail, the technical means used in the following embodiments are all conventional means well known to those skilled in the art. Alternatively, they may be carried out according to the kit and product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0026] Example 1

[0027] I. Materials and Methods

[0028] Plant material: embryogenic callus from the hybrid tulip tree variety 'Nanlin-Jinsen E1'.

[0029] Experimental equipment: sterile workbench, incubator, shaker, PCR instrument, electrophoresis apparatus, gel imaging system, centrifuge, constant temperature water bath, confocal microscope, sterile filter paper, petri dishes, conical flasks, pipettes, and precision weighing balance.

[0030] 1. Construction of the LhNCED3b multi-target gene editing vector

[0031] (1) Identification and cloning of the LhNCED3b gene

[0032] First, homologous gene sequences of the NCED family were retrieved using databases such as NCBI and Phytozome. Using known NCED3 protein sequences from other species as reference sequences, BLAST alignment was performed in the genome database of *Liriodendron tulipifera* to screen for highly similar candidate genes. The online bioinformatics tool Pfam was used to predict the structural domains of the LhNCED3b gene-encoded protein and analyze whether it possesses typical structural features of the NCED family. Using extracted total RNA as a template, the first strand of cDNA was synthesized using a reverse transcription kit. Based on the identified conserved sequence of the LhNCED3 gene, specific primers were designed, and PCR amplification was performed using the cDNA as a template. The DNA sequence was sequenced and aligned, and introns, exons, extremely conserved sites, and SNP sites were labeled. The nucleotide sequence of the obtained LhNCED3b gene is shown in SEQ ID NO.1, and the nucleotide sequence of its expressed protein is shown in SEQ ID NO.2.

[0033] (2) Selection of LhNCED3b gene target sites

[0034] The website http: / / crispr.hzau.edu.cn / CRISPR2 / was used to search for all PAM sequences in the LhNCED3b gene sequence, as well as the 20 bases immediately upstream of the PAM sequence, as candidate target sequences. The GC content of the target sequences was required to be controlled between 40% and 60% to improve binding stability; sequences ending with more than four Ts were avoided to prevent premature transcription termination. The candidate target sequences were ligated to the 5' end of the gRNA, and their secondary structure was analyzed using the online website http: / / www.unafold.org / mfold / applications / rna-folding-form-v2.php to avoid consecutive pairings of more than 7 bp. Finally, the candidate target sequences after elimination were subjected to local BLAST with the hybrid tulip tree genome to select specific target sequences with only one matching site, reducing the probability of off-target effects of the sgRNA.

[0035] (3) Construction of multi-target gene editing vectors

[0036] The three finalized target sequences T1 (TGAAGGGCTTTGGGAGGCTG), T2 (CTCTTTCATCTCCCGCTTGT), and T3 (CTCCTCCTCTTCTATGCCCG) were ligated to their corresponding promoters (LhU6-3 (SEQ ID NO.3), LhU6-7 (SEQ ID NO.4), and LhU3-3 (SEQ ID NO.5)) and gRNA, respectively. Finally, the three expression cassettes were tandemly linked together. The primer sequences are shown in Table 1:

[0037] Table 1 Primer sequences for constructing the LhNCED3b gene editing vector sgRNA

[0038]

[0039] The reaction system and procedure for the first round are shown below (Tables 2 and 3):

[0040] Table 2. PCR reaction system for constructing the LhNCED3b gene editing vector sgRNA

[0041]

[0042] Table 3. PCR reaction procedure for constructing the LhNCED3b gene editing vector sgRNA

[0043]

[0044] Each promoter fragment and sgRNA fragment was matched and used as a template for the second round of PCR. The specific reaction system and procedure are shown below (Tables 4 and 5):

[0045] Table 4. Second-round PCR reaction system for constructing the LhNCED3b gene editing vector

[0046]

[0047] Table 5. Procedure for the second round of PCR reaction in the construction of the LhNCED3b gene editing vector.

[0048]

[0049] The PCR products were verified by gel electrophoresis imaging and then recovered. The three fragments were named U63-T1-gR, U67-T2-gR, and U33-T3-gR, respectively. Subsequently, sgRNA expression cassettes and CRISPR / Cas9 vectors were ligated. The specific reaction procedures and reaction systems are as follows (Tables 6 and 7):

[0050] Table 6. Enzyme digestion system for LhNCED3b gene editing vector

[0051]

[0052] Table 7 Recombinant Ligation System of LhNCED3b Gene Editing Vector

[0053]

[0054] LhNCED3b gene editing vector digestion program: 37°C 1 h; 80°C, 30 min; 4°C ∞.

[0055] LhNCED3b gene editing vector recombination ligation procedure: 50°C, 20 min; 4°C ∞.

[0056] After the reaction was completed, a transformation experiment of DH5α Escherichia coli competent cells was performed. The specific operation procedure is as follows:

[0057] Take 100 µL of competent cell suspension that has been thawed in an ice bath, add 10 µL of ligation product, and gently pipette to mix. Immediately transfer the centrifuge tube to an ice bath and let it stand for 25 min to allow the competent cells to fully contact the DNA.

[0058] The pre-cooled reaction system was transferred to a 42°C constant temperature bath for heat shock for 45–60 s, and then immediately transferred back to an ice bath and allowed to stand for 2 min to stabilize the cell membrane structure. During this process, shaking of the sample was avoided to ensure conversion efficiency.

[0059] Add 700 µL of antibiotic-free LB liquid culture medium to the resuscitation tube and mix well. After mixing by inverting, place the tube in a 37°C constant temperature shaking incubator and perform resuscitation culture at 200 rpm for 1 h.

[0060] Using a sterile glass spreader, an appropriate amount of resuscitated bacterial suspension was evenly spread onto the surface of LB solid medium containing ampicillin. After complete absorption by the bacterial suspension, the culture dish was inverted and placed in a 37°C incubator overnight. Once single colonies formed, positive clones were identified through colony PCR verification. The specific experimental setup is shown below and in Tables 8 and 9.

[0061] The monoclonal positive verification primers (5'-3') are:

[0062] M13-pF: TGTAAAACGACGGCCAGT,

[0063] M13-pR: CAGGAAACAGCTATGACC.

[0064] Table 8. PCR reaction system for monoclonal positive verification

[0065]

[0066] Table 9. PCR reaction procedure for monoclonal positive verification

[0067]

[0068] The length of PCR bands in the bacterial culture was examined by gel electrophoresis, and a portion of single-clone bacterial cultures were sequenced. The correctly sequenced bacterial cultures were then cultured overnight in LB broth containing ampicillin antibiotic to extract plasmids. The specific steps are as follows:

[0069] Bacterial collection: Transfer the cultured bacteria after shaking to centrifuge tubes, generally using 1.5 mL or 2 mL tubes, with 1–1.5 mL of bacterial culture in each tube. Transfer the centrifuge tubes to a pre-cooled high-speed centrifuge, set the speed to 12,000 rpm, and centrifuge for 2 min to allow the bacterial cells to form a dense precipitate at the bottom of the tube. Discard the supernatant.

[0070] Cell resuspension: Add 100–200 µL of Solution I to the centrifuge tube containing the bacterial pellet, and gently vortex to completely depolymerize the bacteria and form a homogeneous suspension. The resuspended bacterial cells should be evenly distributed in the solution. This step is crucial to ensure complete resuspension of the bacteria; otherwise, it will affect the subsequent lysis results.

[0071] Cell lysis: Add 200–400 µL of Solution II to the resuspended bacterial cells, and gently invert the centrifuge tube 5–10 times to mix. The solution will become viscous at this point because the bacterial cell walls and membranes are disrupted, releasing cell contents, including chromosomal DNA and plasmid DNA. Then, place the centrifuge tube on ice for 2–3 minutes to allow the lysis reaction to proceed fully. NaOH can completely denature the DNA.

[0072] Neutralization reaction: Add 300–600 µL of Solution III, gently invert the centrifuge tube 10–15 times to mix thoroughly. A white precipitate will appear, which mainly consists of renatured chromosomal DNA and protein impurities. Place the centrifuge tube back on ice and let it stand for 5–10 minutes to allow the precipitate to form completely.

[0073] Centrifugation: Solid-liquid separation was performed using a high-speed centrifuge pre-cooled to 4°C. The centrifugation parameters were set to 12,000 rpm for 10–15 min. After centrifugation, plasmid DNA and other small molecules remained in the supernatant, while the precipitate mainly consisted of impurities such as chromosomal DNA and proteins. The supernatant was transferred to a new centrifuge tube using a pipette, minimizing the amount of impurities carried over during the transfer.

[0074] Plasmid precipitation: Add an equal volume of isopropanol or 2 to 2.5 times the volume of anhydrous ethanol to the supernatant and mix thoroughly by gentle shaking. Then place the centrifuge tube in a -20°C freezer for 30 min to 1 h, or incubate at room temperature for 10 to 15 min to allow the plasmid DNA to precipitate.

[0075] Precipitation washing: After centrifugation at 12000 rpm for 10–15 min, discard the supernatant and immediately add 1 mL of pre-cooled 70% ethanol solution. Wash the precipitate using an inverted mixing method, repeating the centrifugation process to thoroughly remove salt ions and residual organic reagents. The washing procedure must be strictly performed twice, and the precipitate morphology should be observed after each wash to ensure complete removal of impurities.

[0076] DNA Dissolution: Discard the supernatant and allow the precipitate to air dry for a few minutes, being careful not to let the DNA dry completely, otherwise it will be difficult to dissolve. Add 20–50 µL of TE buffer or sterile double-distilled water to the precipitate and resuspend the DNA by repeated pipetting. The final plasmid solution needs to be tested for concentration and purity using a UV spectrophotometer to confirm A… 260 / A 280 A ratio in the range of 1.8 to 2.0 is required for subsequent experiments.

[0077] After transforming the recombinant products into DH5α Escherichia coli competent cells, the vectors were validated using the following primers (5'-3'):

[0078] SP-L2-New:GTCGTGTCCACATGTTGACCGGTAA,

[0079] M13 Forward: TGTAAAACGACGGCCAGT.

[0080] After confirming the accuracy of the vector plasmid sequencing results, it was introduced into EHA105 Agrobacterium. The specific experimental procedure is as follows:

[0081] EHA105 Agrobacterium competent cells were rapidly removed from their -80°C cryogenic storage environment and thawed on ice. 5 µL of the target plasmid (approximately 1–2 µg) was added to 100 µL of Agrobacterium competent cells and mixed thoroughly. The mixture was incubated on ice for 5 min, flash-frozen in liquid nitrogen for 5 min, then incubated in water at 37°C for 5 min, followed by an ice bath for 5 min. 700 µL of antibiotic-free liquid LB medium was added, and the cells were incubated at 28°C and 220 rpm for 2–3 h using a shaker. The supernatant was removed by centrifugation at 6000 rpm for 1 min, and the remaining bacterial culture was resuspended by pipetting and evenly spread onto kanamycin-containing LB medium.

[0082] Invert the inoculation plate and place it in a 28°C incubator. Incubate statically for 2–3 days until single colonies are visible. Select typical colonies and inoculate them into LB broth containing the same concentration of kanamycin. Amplify the culture by shaking at 28°C and 220 rpm for 16 h. Use an appropriate amount of the bacterial culture directly as a PCR template. The primer combination and reaction parameters used should be completely consistent with the previous plasmid validation experiment.

[0083] 2. Construction of LhNCED3b overexpression vector

[0084] The pBI121 plasmid vector was digested with SacⅠ and XbaⅠ restriction enzymes. Homologous arms were ligated to both ends of the LhNCED3b gene, followed by homologous recombination. This was then used to transform DH5α *E. coli* competent cells and *Agrobacterium* cells. For detailed operational steps, refer to "1. Construction of LhNCED3b multi-target gene editing vector". LhNCED3b overexpression vector overlap extension PCR primer sequence information:

[0085] OL-LhNCED3b-F: agaacacgggggactATGGCTTCAATCACTCCTAATCTCCC,

[0086] L-LhNCED3b-R:cggggaaattcgagctCTAGGCCTGATTGGCCAACT.

[0087] 3. Genetic transformation of hybrid tulip tree callus

[0088] Pre-culture of hybrid tulip tree callus: Place the hybrid tulip tree callus on 3 / 4 MS solid medium containing 1 mg / mL acetylsuccinone (AS) and culture for 20-25 days before Agrobacterium infection experiment, at which time the callus is in the most vigorous growth period.

[0089] Agrobacterium culture and preparation: 50 µL of Agrobacterium culture containing the target plasmid was added to 3 mL of LB liquid medium containing kanamycin and incubated at 28°C and 220 rpm for 12 h. Then, 3 mL of the culture was added to 50 mL of LB liquid medium containing kanamycin for further culture for approximately 6 h. The OD600 value of Agrobacterium was measured using a UV spectrophotometer and maintained between 0.7 and 0.9. Subsequently, the culture was centrifuged at 6000 rpm for 8 min, the supernatant was removed, and an equal volume of 3 / 4 MS liquid medium containing 1 mg / mL acetylsylphenone (AS) was added and mixed thoroughly with pipetting to prepare for infection.

[0090] Infection treatment and co-culture: First, the hybrid tulip tree callus was picked up with sterile forceps and gently placed at the mouth of a 100mL Erlenmeyer flask. Moderate crushing was used to thoroughly disperse the tissue. Then, the dispersed callus was flushed into the bottom of the flask using a pre-prepared Agrobacterium resuspension. To promote effective Agrobacterium adhesion, the Erlenmeyer flask was transferred to a 90rpm shaking incubator and shaken continuously for 10 minutes. After infection, the mixture was separated into solid and liquid phases using a 150-mesh sterile sieve, and residual liquid was gently absorbed using sterile absorbent cotton. Finally, the treated callus was transferred to 3 / 4 MS solid medium containing 1 mg / L acetylsyringone (AS) and incubated in the dark at 25°C for 48 h to complete the co-culture phase.

[0091] Screening for sterilization and positive callus: After two days of co-culture, hybrid tulip tree callus tissue was rinsed three times alternately with 1000 mg / L 3 / 4 MS liquid medium and ddH2O. The liquid was then blotted dry with sterile cotton, and the callus tissue was placed on 500 mg / L cephalosporin 3 / 4 MS solid medium. On the eighth day, the medium was changed to 500 mg / L cephalosporin and 85 mg / L G418 3 / 4 MS solid medium. The medium was then changed every 30 days until recovered callus appeared.

[0092] 4. Salt stress treatment

[0093] Three-month-old hybrid tulip tree seedlings with uniform growth were selected and placed in 3 / 4 MS basal medium containing 200 mmol / L NaCl. Each genotype line included 10 biological replicates. The response of each type of hybrid tulip tree seedling to salt stress was continuously observed.

[0094] 5. Expression level measurement

[0095] Hybrid tulip tree tissue culture seedlings were sampled on days 0 (untreated control), 1, 3, 5, and 7 after salt stress. At least three biological replicates were performed for each time point and genotype. Root tips and leaves were rapidly flash-frozen in liquid nitrogen and stored at -80°C for later use. After collecting samples at each time point, RNA was extracted from each sample using a plant total RNA extraction kit and converted to cDNA. Specific primers targeting the conserved region of the target gene were designed, and amplification was performed using real-time quantitative PCR with an internal reference gene as a reference. The specificity of the product was verified by melting curve analysis, and the relative expression level of the target gene was calculated. The data were corrected for amplification efficiency before statistical analysis.

[0096] 6. Measurement of physiological indicators

[0097] Relative moisture content determination: Hybrid tulip tree seedlings with similar growth patterns were selected as experimental samples. Their initial fresh weight (FW) was accurately weighed and recorded using an electronic balance with an accuracy of 0.01%. The samples were then immersed in deionized water and allowed to absorb water at 4°C in the dark for 24 hours. Excess moisture was gently absorbed from the sample surface using filter paper, and the fresh weight (TW) at saturation was immediately measured. The samples were then placed in a 65°C oven for 48 hours until constant weight was achieved, and the dry weight (DW) was measured. The relative moisture content (RWC) was calculated using the formula RWC (%) = [(FW - DW) / (TW - DW)] × 100.

[0098] Hydrogen peroxide (H2O2) content determination: Plants were collected before and on day 3 after stress treatment, 72 h after the initial stress treatment. They were rapidly frozen in liquid nitrogen and stored at -80°C for later use. 0.1 g of fresh tissue was weighed into a pre-cooled mortar, and 0.9 mL of phosphate buffer solution was added. The mixture was homogenized and centrifuged at 12000 rpm for 10 min at 4°C. The supernatant was used as the test solution. Using the Nanjing Jiancheng H2O2 assay kit, with a blank control and standard concentration hydrogen peroxide solution as references, the absorbance was measured at 405 nm. The hydrogen peroxide content of the sample was calculated, and the results were expressed as mmol / g fresh weight.

[0099] Malondialdehyde (MDA) content determination: Plants were collected before and on day 3 after stress treatment, 72 h after the stress treatment. They were rapidly frozen in liquid nitrogen and stored at -80°C for later use. 0.1 g of fresh tissue was weighed into a pre-cooled mortar, and 1.0 mL of the kit extraction buffer (containing 10% trichloroacetic acid) was added. The mixture was ground on ice until homogenized, incubated at 4°C for 10 min, and then centrifuged at 10,000 rpm for 10 min at 4°C. The supernatant was collected as the sample to be tested. 0.5 mL of the supernatant was mixed thoroughly with 1.5 mL of the kit's colorimetric solution (containing 0.5% thiobarbituric acid), boiled in a water bath for 30 min, and immediately cooled under running water to terminate the reaction. The mixture was then centrifuged at 5,000 rpm for 10 min at room temperature. The absorbance of the supernatant was measured at 532 nm using a spectrophotometer. The MDA content was calculated according to the formula provided by the Nanjing Jiancheng MDA assay kit. The results are expressed as nmol / g fresh weight.

[0100] DAB staining: Intact leaves of hybrid tulip tree seedlings were collected before and 3 days after salt stress treatment. The petioles were preserved, and the underside of the leaves was slightly scratched to enhance staining penetration. The entire leaf was completely immersed in 1 mg / mL DAB staining solution (pH 3.8, containing 0.05% Tween-20) under vacuum for 15 min to remove interstitial gases. The leaves were then transferred to a 25°C dark environment and incubated for 12 h, with gentle shaking every 2 h to ensure uniform staining. After staining, the leaves were transferred to 95% ethanol and decolorized in a boiling water bath for 20 min to completely remove chlorophyll. Fresh ethanol was added until the leaves were completely transparent. After rinsing three times with distilled water, the leaves were laid flat in petri dishes, moistened with 4% glycerol to prevent dehydration and shrinkage, and stored at 4°C. The staining results were obtained by scanning whole-leaf images. Areas of H2O2 accumulation appeared as brownish-red patches. Six seedlings were used as biological replicates for each treatment, and each independent experiment was repeated three times.

[0101] NBT staining: Intact leaves of hybrid tulip tree seedlings were taken before and 3 days after salt stress treatment. The petioles were preserved, and the underside of the leaves was gently pricked evenly with a sterile needle to promote staining absorption. The entire leaf was immersed in 0.5 mg / mL NBT staining solution (10 mM phosphate buffer, pH 7.8, containing 0.05% Tween-20) under vacuum for 15 min, then transferred to a 25°C incubator for 8 h to ensure sufficient superoxide anion reaction to form a blue formazan precipitate. After staining, the leaves were immersed in 95% ethanol and destained in a boiling water bath for 25 min until the background was completely transparent. The ethanol was replaced twice during this period to thoroughly remove chlorophyll interference. After rinsing with distilled water, the leaves were laid flat on filter paper to absorb excess moisture, covered with a transparent film, flattened, and fixed before scanning imaging. O2 -Accumulation areas appeared as dark blue spots. Each treatment group included 6 seedlings as biological replicates, and the experiment was independently repeated 3 times to verify consistency. The staining process was carried out in the dark throughout, and the staining solution was prepared fresh each time to avoid oxidation and inactivation. The decolorization time was optimized through preliminary experiments to ensure leaf structural integrity and staining specificity.

[0102] 7. Stomatal aperture measurement

[0103] This application employs microscopic observation to quantitatively analyze stomatal aperture in leaves of different genotype hybrid tulip trees under salt stress. Several overexpressing, wild-type, and knockout plants with consistent growth status were selected, and samples were taken on the third day after treatment with 200 mM NaCl salt stress. For sampling, the third fully unfolded leaf from the top of each plant was selected, avoiding the midrib and leaf margin area. A 1 cm × 1 cm tissue block from the middle section of the leaf was cut using surgical scissors. To prepare epidermal samples, a modified double-sided tape method was used: transparent tape was gently pressed onto the lower epidermis of the leaf, slowly peeled off, and transferred to a glass slide pre-filled with one drop of distilled water. After covering with a coverslip, the sample was immediately stored at 4°C in the dark to inhibit stomatal movement changes.

[0104] Under the microscope, fields of view were randomly selected, and 10 non-overlapping areas were observed for each sample. Three to five intact stomatal structures without mechanical damage were captured in each area. Image acquisition used uniform parameter settings. Stomatal parameter measurements were performed using ImageJ software. The specific procedure included: establishing pixel-to-micrometer conversion coefficients using the calibration ruler function; measuring the maximum distance between the openings of two guard cells (stomatal width) and the distance between the two vertices of the guard cells (stomatal length) using the straight line tool. The stomatal aperture index was calculated using the formula: stomatal width / stomatal length. The final data was the average of 30 valid stomatal measurements. To control environmental variables, the entire experiment was conducted in a constant temperature and humidity chamber, and the time interval from leaf detachment to microscopic imaging was strictly controlled within 15 minutes. Data analysis used one-way ANOVA combined with Tukey's HSD test, with a significance level set at p < 0.05.

[0105] II. Experimental Results

[0106] 1. Validation of gene-edited positive callus

[0107] To verify the integration of the CRISPR / Cas9 gene-editing vector into the hybrid tulip tree genetic transformation system and its editing effect on the LhNCED3b gene, this application used PCR amplification and target site sequencing analysis to molecularly identify the transformed callus. Specific primers designed based on the CRISPR / Cas9 vector were used to amplify the genomic DNA of the regenerated callus. The results showed that the target band was detected in all transformed lines, while no amplification product was found in the wild-type control, preliminarily confirming that the gene-editing vector had been successfully integrated into the plant genome. Figure 1-1 , Figure 1-2 ).

[0108] Further sequencing analysis of the PCR products at the three sgRNA target sites revealed gene editing events in the target regions of all three independent transformed lines. The editing types included single-base insertions, single-base deletions, and large deletions of approximately 230 bp. Large deletion events accounted for the highest proportion and all started at target site one and terminated at target site two. The sgRNAs used in this application were driven by the endogenous promoters LhU6-3, LhU6-7, and LhU3-3 from hybrid tulip trees. The experimental results not only validated the functionality of the endogenous promoters from hybrid tulip trees in a multi-target CRISPR / Cas9 system but also successfully obtained the LhNCED3b gene-editing mutant, providing crucial material support for subsequent research into the biological function of this gene. Figure 1-1 , Figure 1-2 ).

[0109] 2. Positive verification of callus overexpression

[0110] To verify the integration and expression of the LhNCED3b overexpression vector in regenerated callus obtained through Agrobacterium-mediated genetic transformation, this experiment used PCR amplification and real-time quantitative PCR analysis to molecularly identify the transformation system. Specific primers designed based on the overexpression vector sequence were used to amplify the genomic DNA of the regenerated callus. The results showed that the expected bands were detected in all transformed lines, while no amplification products were observed in the wild-type control group, preliminarily confirming that the exogenous gene had been successfully integrated into the plant genome. Further, real-time quantitative PCR was used to detect the transcriptional level of the LhNCED3b gene. Using the expression level of LhNCED3b in the wild type as a control, and after standardization, the results showed that the relative expression level of the LhNCED3b gene in the three transformed lines was significantly increased by 2.4–7.5 times compared to the wild-type control. These results confirm that LhNCED3b overexpressing callus was successfully obtained through a stable Agrobacterium-mediated genetic transformation system, providing a reliable research material basis for subsequent functional analysis of this gene in the stress response of Liriodendron tulipifera. Figure 2 ).

[0111] 3. Phenotypic and trait analysis of LhNCED3b gene overexpression and gene-edited plants

[0112] This application systematically analyzed the effects of the LhNCED3b gene on the growth and development of hybrid tulip trees by measuring the taproot length, plant height, and leaf area of ​​the LhNCED3b gene-overexpressing line (LhNCED3b-OE), the gene knockout line (LhNCED3b-KO), and the wild type (WT). Taproot length measurements showed that compared to the wild type, the taproot length of the LhNCED3b-OE line generally decreased, with LhNCED3b-OE-1 / 2 / 3 showing decreases of 9.6%, 4.2%, and 8.1%, respectively. In contrast, the taproot length of the LhNCED3b-KO line significantly increased, with LhNCED3b-KO-2 / 3 / 24 showing increases of 15.6%, 16.8%, and 19.1%, respectively, indicating that LhNCED3b gene knockout can promote root elongation to some extent. Plant height measurements showed no significant difference between the LhNCED3b-OE and LhNCED3b-KO lines compared to the wild type. Leaf area data showed that the leaf area of ​​the LhNCED3b-OE lines decreased by 6.1%–12.2% compared to the WT lines, with LhNCED3b-OE-1 showing the largest decrease (12.2%). The leaf area of ​​the LhNCED3b-KO lines, however, increased significantly, with LhNCED3b-KO-2 / 3 / 24 increasing by 13.2%, 16.7%, and 18.6%, respectively. In conclusion, overexpression of the LhNCED3b gene inhibits taproot development and leaf expansion to some extent, while gene knockout significantly enhances these traits, providing key phenotypic evidence for elucidating the function of this gene. Figure 3 ).

[0113] 4. Measurement of physiological indicators under salt stress treatment

[0114] This application analyzed the physiological responses of wild-type (WT) LhNCED3b hybrids, LhNCED3b overexpressing lines (LhNCED3b-OE-1 / 2 / 3), and LhNCED3b knockout lines (LhNCED3b-KO-2 / 3 / 24) under salt stress conditions, revealing the regulatory role of this gene in salt stress tolerance. On the third day of salt stress treatment, phenotypic observation showed that the knockout lines exhibited the most severe leaf wilting, followed by the wild-type, while the overexpressing lines showed only slight water loss. This indicates that LhNCED3b deletion exacerbated salt stress damage, while overexpression significantly alleviated phenotypic deterioration.

[0115] Physiological analysis further supports this trend: after stress, the hydrogen peroxide content in the knockout lines was significantly higher than that in the wild type, with the LhNCED3b-KO-24 group showing an increase of approximately 65.3%, while the hydrogen peroxide content in the overexpression line LhNCED3b-OE-3 was 28.9% lower than that in the wild type. It is speculated that overexpression of this gene may inhibit the accumulation of reactive oxygen species, thereby mitigating oxidative damage. Regarding water balance, the relative water content of the knockout lines decreased significantly under salt stress, with the LhNCED3b-KO-3 group showing a decrease of 23.4% compared to the wild type, while the relative water content of the overexpression line LhNCED3b-OE-3 was 13.2% higher than that in the wild type. This suggests that LhNCED3b overexpression may alleviate water loss by maintaining cell osmotic pressure. The trend of MDA content, a marker of lipid peroxidation damage, was consistent with the oxidative stress response. The MDA content in the knockout line LhNCED3b-KO-3 increased by 12.7% compared to the wild type, while the MDA content in the overexpression line LhNCED3b-OE-3 decreased by 40.1% compared to the wild type, further confirming that this gene alleviates membrane system damage by regulating antioxidant pathways. Figure 4-1 , Figure 4-2 ).

[0116] DAB and NBT staining was performed on the leaves of plants subjected to stress on day 0 and day 3, and the results are shown in Figures 4-6. Under no stress, no obvious brown (DAB) patches were observed on the leaves of WT, LhNCED3b-OE, and LhNCED3b-KO plants, and a small amount of blue (NBT) precipitate patches were observed. After 3 days of salt stress treatment, the brown and blue precipitates in the leaves of WT and LhNCED3b-KO plants increased significantly, and the staining area expanded significantly. In contrast, the overexpression material only showed a slight increase in staining intensity, and the staining area was still significantly smaller than that of WT and gene-edited materials. This suggests that LhNCED3b may alleviate oxidative damage by regulating antioxidant pathways, and its loss of function exacerbates the salt stress-induced oxidative stress response. Figure 5 ).

[0117] In summary, overexpression of the LhNCED3b gene significantly enhanced the salt tolerance of hybrid tulip trees, specifically by alleviating oxidative stress (reducing hydrogen peroxide by 18.6%–30.9%), improving water retention (increasing relative water content by 10.0%–13.2%), and improving membrane stability (reducing MDA content by 33.9%–40.0%). Conversely, gene knockout led to a reversal of these indicators (increasing hydrogen peroxide by 5.7%–14.76%, decreasing relative water content by 13.6%–23.3%, and increasing MDA content by 3.8%–12.7%). These results suggest that LhNCED3b may play a crucial role in salt stress response through negative regulation of oxidative stress and positive regulation of osmotic protection mechanisms, providing a theoretical basis for elucidating the molecular mechanisms of stress resistance in hybrid tulip trees.

[0118] 5. Stomatal aperture measurement

[0119] This experiment systematically evaluated the dynamic changes in stomatal aperture (stomatal width / stomatal length) of different genotypes of hybrid tulip tree (Liriodendron tulipifera) under salt stress using microscopic observation. Before salt stress, there was no significant difference in stomatal aperture among the genotypes. After salt stress, the stomatal aperture of the overexpressing lines (LhNCED3b-OE-1 / 2 / 3) was significantly lower than that of the wild-type (WT) and some knockout lines (LhNCED3b-KO-2 / 3), with LhNCED3b-OE-3 showing the lowest aperture, indicating that LhNCED3b overexpression effectively promotes stomatal closure under abiotic stress. The knockout lines (LhNCED3b-KO-2 / 3) showed the highest aperture, significantly higher than WT, confirming that LhNCED3b deficiency weakens stomatal regulation. Figure 6 ).

[0120] In summary, based on previously optimized endogenous promoters (LhU6-3, LhU6-7, and LhU3-3) from hybrid tulip mania, this application successfully constructed a multi-target CRISPR / Cas9 gene editing vector and overexpression system targeting the LhNCED3b gene. Using an Agrobacterium-mediated genetic transformation system, stably heritable gene knockout and overexpression callus tissues were successfully obtained. Sanger sequencing technology was used to analyze the editing effect. The results showed that gene editing events included various types such as single-base insertions, deletions, and large-fragment deletions. Among these, large-fragment deletion events accounted for the highest proportion of all editing events. This application achieved a large-fragment directed deletion of approximately 230 bp near the target site in hybrid tulip mania, with the deletion starting at sgRNA1 and ending at sgRNA2. Simultaneously, real-time quantitative PCR was used to validate the overexpression in plants, revealing a significant increase in gene expression levels, providing reliable experimental samples for further in-depth analysis of gene function.

[0121] Analysis of the growth and development phenotypes of transgenic plants revealed that the LhNCED3b gene knockout lines exhibited a significant promoting effect on taproot elongation and leaf area expansion; while the LhNCED3b gene overexpression lines showed inhibited root development and restricted leaf growth. This suggests that the LhNCED3b gene may exert a negative regulatory effect on the vegetative growth of hybrid tulip trees by regulating the abscisic acid (ABA) synthesis pathway. Previous studies have shown that when plants respond to abiotic stress, the biosynthesis and accumulation of ABA significantly increase, while other hormones such as cytokinins, auxins, or ethylene also affect plant growth and development under osmotic stress conditions. ABA accumulation can regulate plant root growth by affecting the activity of multiple hormones. For example, in Arabidopsis thaliana, ABA inhibits root elongation by synergistically regulating the activity of auxins and ethylene. The phenotype of the overexpressing strains in this application is similar to that of this study. The knockout strains may have relieved their antagonistic effect on growth hormones due to the inhibition of ABA synthesis, thereby promoting organ development.

[0122] Salt stress experiments further revealed the core role of LhNCED3b in resisting abiotic stress. Under salt stress conditions, overexpression lines significantly enhanced salt tolerance by inhibiting reactive oxygen species accumulation, maintaining water balance, and reducing membrane lipid peroxidation damage, while knockout lines exhibited more severe stress damage due to weakened antioxidant capacity and osmotic dysregulation. Specifically, the H2O2 content in overexpression lines was reduced by an average of 18.6%–30.9% compared to the wild type, and the MDA content was reduced by an average of 33.9%–40.0%. The relative water content increased by an average of 10.0%–13.2% on the third day after salt stress, while knockout lines exhibited more severe stress damage due to weakened antioxidant capacity and osmotic dysregulation. These physiological responses may stem from the activation of the ABA signaling pathway: on the one hand, ABA scavenges reactive oxygen species and alleviates oxidative damage by inducing the expression of antioxidant enzymes (such as SOD and CAT); on the other hand, ABA promotes the synthesis of osmotic regulators (such as proline and soluble sugars) to maintain cell osmotic pressure. Furthermore, stomatal aperture dynamics analysis showed that LhNCED3b overexpression lines enhanced their salt stress adaptation by promoting stomatal closure to reduce water loss, a process that may depend on ABA-regulated SLAC1 / SLAH3 ion channel activity. Conversely, knockout lines exhibited significantly increased stomatal aperture, leading to intensified transpiration and further exacerbating water imbalance.

[0123] The above description is illustrative only and not restrictive of the present invention. Those skilled in the art will understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all such modifications, variations or equivalents will fall within the protection scope of the present invention.

Claims

1. An LhNCED3b gene, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. The expressed protein of the LhNCED3b gene according to claim 1, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. A biomaterial, characterized in that, The biological material is an expression cassette, recombinant vector, or recombinant cell containing the LhNCED3b gene as described in claim 1.

4. The application of the LhNCED3b gene of claim 1, the LhNCED3b gene expression protein of claim 2, or the biological material of claim 3 in molecular breeding of Liriodendron tulipifera.

5. The application of the LhNCED3b gene of claim 1, the LhNCED3b gene expression protein of claim 2, or the biomaterial of claim 3 in regulating the resistance of tulip trees to abiotic stress.

6. The application according to claim 5, characterized in that, The specific application is: overexpression of the LhNCED3b gene in Liriodendron tulipifera.

7. The application according to claim 6, characterized in that, The specific application involves constructing an overexpression vector for the LhNCED3b gene, transforming it into tulip trees, and then culturing and screening to obtain transgenic tulip trees with enhanced resistance to abiotic stress.

8. The application according to claim 7, characterized in that, The aforementioned abiotic stresses are salt stress or drought stress.

9. The application according to claim 7, characterized in that, The overexpression vector for the LhNCED3b gene is pBI121-LhNCED3b.

10. The application according to claim 7, characterized in that, The transformation was mediated by Agrobacterium.

Images