Mesenchymal stem cell exosome for overexpressing miR-29 and application of mesenchymal stem cell exosome

By using mesenchymal stem cell exosomes that overexpress miR-29, the problems of insufficient function and low miRNA expression of exosomes in the treatment of ischemic stroke in existing technologies have been solved, resulting in stronger therapeutic effects and more comprehensive treatment options.

CN121852476APending Publication Date: 2026-04-14WEIFANG MEDICAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610328168.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-18
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing mesenchymal stem cell exosomes have problems such as insufficient function, low miRNA expression, weak targeting, difficulty in preparation and transformation in the treatment of ischemic stroke, and lack standardized, mass-producible and pharmaceutically suitable treatment solutions.

Method used

Mesenchymal stem cell exosomes overexpressing miR-29 were used to increase the content of key miRNAs in the exosomes. The preparation method included culture, purification and identification, and the exosomes were used to prepare drugs for the treatment of ischemic stroke, thereby enhancing the therapeutic effect.

Benefits of technology

It significantly improves the function of exosomes in the treatment of cerebral ischemia, protects neurons, promotes angiogenesis, inhibits inflammatory response, improves learning and memory function, and provides a more comprehensive and reliable therapeutic effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121852476A_ABST
    Figure CN121852476A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biology, and particularly relates to a mesenchymal stem cell exosome for overexpressing miR-29 and application of the mesenchymal stem cell exosome. The miR-29 is overexpressed by the mesenchymal stem cells, so that the content of key miRNA in the exosome is remarkably increased, and the function of the exosome in cerebral ischemia treatment is enhanced; the exosome is used as a cell-free treatment mode, so that the risks of cell proliferation, differentiation, immunological rejection and the like possibly caused by MSC transplantation are avoided, and standardization and large-scale preparation are easier; the mesenchymal stem cell exosome of the overexpressed miR-29 can simultaneously realize multiple effects, such as protecting neurons, promoting vascular regeneration, inhibiting inflammatory response, repairing blood-brain barrier and the like, so that cerebral arterial thrombosis can be more comprehensively treated; according to the scheme, through miRNA function enhancement, a stronger treatment effect is provided, and the problems of insufficient function, low miRNA content and weak targeting in existing mesenchymal stem cell exosome treatment are solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a mesenchymal stem cell exosome overexpressing miR-29 and its uses. Background Technology

[0002] Stroke is characterized by five major features: high incidence, high disability rate, high mortality rate, high recurrence rate, and high economic burden. It seriously endangers human health and imposes a heavy burden on patients' families and society. Ischemic stroke accounts for the largest proportion of all stroke types, approximately 65.3%, and has the highest incidence and mortality rate, making it the second leading cause of death worldwide. It is usually caused by cardioembolic events, cerebral microcirculatory dysfunction, atherosclerosis, or coagulation disorders. Currently, the main treatments for ischemic stroke are intravenous thrombolysis and endovascular thrombectomy to achieve rapid reperfusion. However, these two treatment methods have short therapeutic windows and limited ability to repair reperfusion injury and nerve damage, leaving considerable room for improvement.

[0003] In recent years, mesenchymal stem cells (MSCs) have been considered a potential cell therapy or cell-free therapy due to their secretion of exosomes. The exosomes released by MSCs (MSC-Exos) contain various miRNAs, mRNAs, and proteins, which can regulate the damaged tissue microenvironment, promote angiogenesis, reduce neuronal apoptosis, and inhibit inflammation. Previous studies have shown that MSC-Exos have a protective effect in cerebral ischemia models, promoting angiogenesis and inhibiting apoptosis through multiple miRNA-mediated mechanisms. Furthermore, research has found that miR-29 family expression decreases in the hypoxic-ischemic environment of the brain, while increasing miR-29a expression in the brain can improve neuronal survival and promote angiogenesis.

[0004] While MSC-Exos have shown promise in the treatment of cerebral ischemia, most research is limited to exosomes at their natural expression levels. In recent years, research on specifically enhancing key miRNAs has emerged, but further investigation is needed regarding the controllability, stability, and regulatory mechanisms of therapeutic effects, and a mature, efficient, and universal strategy has not yet been developed. Although studies have validated some mechanisms of action of the miR-29 family in cerebral ischemia, there are no publicly disclosed patents for the preparation of drugs specifically using "MSC-Exos overexpressing miR-29" for ischemic stroke. Existing exosome therapy regimens still have technical shortcomings in preparation, purification, delivery to brain regions, dosage control, targeting, and safety. Currently, there is a lack of a standardized, mass-producible mesenchymal stem cell exosome therapy regimen with clearly defined miR-29 overexpression, suitable for pharmaceutical development, and clinical translation. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention proposes an application scheme for the preparation of drugs for the treatment of ischemic stroke using mesenchymal stem cell exosomes (MSC-Exos) that overexpress miR-29, thereby solving problems such as insufficient exosome function, low miRNA expression, insufficient targeted therapy effect, difficulty in preparation, and difficulty in transformation.

[0006] The first objective of this invention is to provide the use of mesenchymal stem cell exosomes overexpressing miR-29 in the preparation of a medicament for the treatment of ischemic stroke.

[0007] The second objective of this invention is to provide a drug for treating ischemic stroke, prepared using exosomes of mesenchymal stem cells overexpressing miR-29. This drug enhances the therapeutic effect of exosomes in the repair of ischemic brain injury, including but not limited to improving neuronal survival rate, promoting angiogenesis, inhibiting inflammatory response, and promoting blood-brain barrier repair, thereby improving the shortcomings of exosome therapy for ischemic stroke in the prior art.

[0008] This invention provides a treatment for ischemic stroke by preparing exosomes of mesenchymal stem cells overexpressing miR-29, which can reduce neuroinflammation and improve learning and memory functions.

[0009] In another aspect, the present invention provides a method for preparing mesenchymal stem cell exosomes overexpressing miR-29, comprising the following steps: 1. Culture mesenchymal stem cells overexpressing miR-29 Human umbilical cord mesenchymal stem cells (hUC-MSCs) were selected and cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The P4-P12 generation of human umbilical cord mesenchymal stem cells were cultured in a 37°C, 5% CO2 incubator. After the cultured human umbilical cord mesenchymal stem cells reached 80% confluence, 20 nM of miR-29a agomir [mature miR-29a sequence: UAGCCACCAUCUGAAAUCGGUUA] was added. Fluorescence was observed 48 hours after transfection. A positive transfection rate of 80% or higher was considered successful, and these cells were used as the cell source for exosome production.

[0010] 2. Preparation, purification and identification of exosomes After successful transfection, MSCs overexpressing miR-29 were cultured in exosome-free serum medium for three days. The cell supernatant was then collected for the extraction of exosomes overexpressing miR-29. Exosomes were extracted using ultracentrifugation. The supernatant of the culture medium containing exosomes was centrifuged at 2,000 × g for 20 minutes at 4°C. The supernatant was transferred to a new centrifuge tube and then centrifuged at 10,000 × g for 30 minutes at 4°C. The supernatant was then passed through a 0.22 μm filter and transferred to an ultracentrifuge tube to remove dead cells and cell debris from the culture medium supernatant. Subsequently, the filtrate was ultracentrifuged at 120,000 × g for 70 minutes at 4°C to precipitate the exosomes in the supernatant. After centrifugation, the supernatant was discarded. The exosomes precipitated at the bottom of the centrifuge tube were washed with filtered PBS, and then ultracentrifuged at 120,000 × g for 70 minutes at 4°C to reprecipitate the exosomes. The precipitate was then resuspended in sterile PBS and stored at -80°C. The purified exosomes were identified as follows: the morphology of exosomes was observed by transmission electron microscopy (TEM); the exosome marker proteins (CD63, TSG101) were detected by Western blot; and the particle size and concentration of exosomes were detected by nanoflow cytometry.

[0011] The beneficial effects of this invention are as follows: 1) Overexpression of miR-29 in mesenchymal stem cells significantly increases the content of key miRNAs in exosomes, thereby enhancing the function of exosomes in the treatment of cerebral ischemia; 2) As a cell-free therapy, exosomes avoid the risks of cell proliferation, differentiation, and immune rejection that may arise from MSC transplantation, and are easier to standardize and scale up. 3) Mesenchymal stem cell exosomes overexpressing miR-29 can simultaneously achieve multiple effects, such as protecting neurons, promoting angiogenesis, inhibiting inflammatory responses, and repairing the blood-brain barrier, thereby providing a more comprehensive treatment for ischemic stroke; 4) The miR-29 family is highly conserved. The mature miRNA sequences of mouse miR-29a and human miR-29a are completely identical [human (hsa-miR-29a-3p): UAGCCACCAUCUGAAAUCGGUUA; mouse (mmu-miR-29a-3p): UAGCCACCAUCUGAAAUCGGUUA], making it more valuable for research. The molecular mechanisms underlying the effects verified in mice can be largely extrapolated to humans.

[0012] 5) Compared to traditional mesenchymal stem cell exosome therapy, this regimen provides a stronger therapeutic effect through miRNA function enhancement, addressing the problems of insufficient function, low miRNA content, and weak targeting in existing mesenchymal stem cell exosome therapy; 6) Experimental results showed that the infarct area was reduced, neuromotor function was improved, and neuronal function and structural complexity were protected in the miR-29 MSC-Exo overexpression group, indicating that the therapeutic effect was reliable. Attached Figure Description

[0013] Figure 1 Characterization of exosomes derived from umbilical cord mesenchymal stem cells and expression levels of miR-29 in exosomes. Figure 1 Transmission electron microscopy identification of the morphology and particle size of umbilical cord mesenchymal stem cell exosomes (A). Figure 1 B. Nanoscale flow cytometry was used to determine the particle size and concentration of exosomes from umbilical cord mesenchymal stem cells. Figure 1 C. Western blot was used to detect surface markers of umbilical cord mesenchymal stem cells exosomes, including CD63 and TSG101. Figure 1 The expression of miR-29 in exosomes of each group was detected by D.qPCR. * P <0.05, n=4); Figure 2 The results of experiments showing that overexpression of miR-29 MSC-Exos reduced the infarct area in MCAO mice were presented. Figure 2 A.TTC schematic diagram, Figure 2 B. Statistical analysis of cerebral infarction area in each group of mice ( * P <0.05, ** P <0.01, *** P <0.001, n=4, scale bars: 1cm); Figure 3 The experimental results show the protective effect of miR-29 MSC-Exos overexpression on motor function in MCAO mice. Figure 3 A. Schematic diagram of the movement trajectory of mice in the open field experiment. Figure 3 B. Total distance traveled by mice in the open field experiment. Figure 3 C. Average speed of movement of mice in open field experiment Figure 3 The neurological function of MCAO mice was assessed using the D.mNSS scoring method. Figure 3 E. rotarod was used to detect motor function in MCAO mice. * P <0.05, ** P <0.01, *** P <0.001, n=6); Figure 4 The experimental results show the protective effect of miR-29 MSC-Exos overexpression on spatial memory and motor function in MCAO mice. Figure 4 A schematic diagram of the movement trajectory of a mouse in a water maze. Figure 4 B. Time required for mice in each group to find the platform during the experimental phase ( * P <0.05, *** P <0.001, n=3); Figure 5 The results of experiments showing that overexpression of miR-29 MSC-Exos promotes the recovery of cerebral blood flow in MCAO mice were presented. Figure 5 A. Schematic diagram of cerebral blood flow in MCAO mice detected by laser speckle imaging. Figure 5 Statistical diagram of cerebral blood flow in each group of the injury area (B) * P <0.05, *** P <0.001, n=3); Figure 6 The results of experiments on the protective effects of miR-29 MSC-Exos overexpression on neuronal survival and dendritic structure in MCAO mice are as follows. Figure 6 A. Schematic diagram of neuronal cell bodies and dendrites staining in the damaged brain region. Figure 6 B. Statistical map of neuron dendrite density Figure 6 C. Statistical diagram of surviving neuron density ( * P <0.05, ** P <0.01, *** P <0.001, n=4); Figure 7 The experimental results of reducing the expression of inflammatory factors in the lesion area of ​​MCAO mice by overexpressing miR-29 MSC-Exos were presented. Figure 7 The content of IL-1β was detected by A. ELISA. Figure 7 TNF-α levels were detected by ELISA in B. Figure 7 IFN-γ content was detected by C. ELISA (in traditional Chinese medicine). * P <0.05, ** P <0.01, *** P <0.001, n=4). Detailed Implementation

[0014] Example 1: Experimental Procedure 1. Culture mesenchymal stem cells overexpressing miR-29 Human umbilical cord mesenchymal stem cells (hUC-MSCs) were selected and cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The P4-P12 generation of human umbilical cord mesenchymal stem cells were cultured in a 37°C, 5% CO2 incubator. After the cultured human umbilical cord mesenchymal stem cells reached 80% confluence, 20 nM miR-29a agomir or negative control agomir (NC agomir) was added. Fluorescence was observed 48 hours after transfection. A positive transfection rate of 80% or higher was considered successful, and these cells were used as the cell source for exosome production. The miR-29 level in transfected MSCs was measured; the miR-29 level in the miR-29a agomir group was significantly higher than that in the negative control group.

[0015] 2. Preparation, purification and identification of exosomes After successful transfection, MSCs overexpressing miR-29 were cultured in exosome-free serum medium for three days. The cell supernatant was then collected to extract exosomes overexpressing miR-29 and exosomes from the control group.

[0016] Exosomes were extracted by ultracentrifugation. The supernatant of the culture medium containing exosomes was centrifuged at 2,000 × g for 20 minutes at 4°C. The supernatant was transferred to a new centrifuge tube and then centrifuged at 10,000 × g for 30 minutes at 4°C. The supernatant was then transferred to an ultracentrifuge tube through a 0.22 μm filter to remove dead cells and cell debris from the culture medium supernatant. Subsequently, the filtrate was ultracentrifuged at 120,000 × g for 70 minutes at 4°C to precipitate the exosomes in the supernatant. After centrifugation, the supernatant was discarded, and the exosomes precipitated at the bottom of the centrifuge tube were washed with filtered PBS. The precipitate was then ultracentrifuged at 120,000 × g for 70 minutes at 4°C to reprecipitate the exosomes. The precipitate was then resuspended in sterile PBS and stored at -80°C.

[0017] The purified exosomes were identified as follows: the morphology of exosomes was observed by transmission electron microscopy (TEM); the exosome marker proteins (CD63, TSG101) were detected by Western blot; and the particle size and concentration of exosomes were detected by nanoflow cytometry.

[0018] Verification of miR-29 content in exosomes: miR-29 expression was increased compared to the control group by RT-qPCR.

[0019] 3. Application in the treatment of ischemic stroke Animal model validation: A middle cerebral artery occlusion (MCAO) model was established using male C57BL / 6J rats (6-8 weeks old, weighing approximately 20-25 g). 10 μL of a 10% concentration was injected via the carotid artery. 9 Overexpression of miR-29 MSC-Exo (particles / mL), control MSC-Exo, or PBS. The following parameters were observed three days after administration: ① TTC staining to determine cerebral infarction volume.

[0020] ② Behavioral experiments such as mNSS score, Rotarod test, open field test, and Morris water maze are used to evaluate motor nerve function.

[0021] ③ Laser speckle imaging is used to detect the recovery of blood flow in the brain after injury.

[0022] ④ Immunofluorescence assay was used to detect the density of surviving neurons and dendritic structure.

[0023] ⑤ ELISA was used to detect the expression of inflammatory factors IL-1β, TNF-α and IFN-γ.

[0024] In in vivo validation, if the injection of miR-29 overexpressing MSC-Exo group shows a significant reduction in cerebral infarction volume, a significant improvement in neuromotor function, higher cerebral blood flow, and a decrease in inflammatory factor expression compared to the injection of control MSC-Exo group and the injection of PBS group, thus protecting neuronal survival and structural complexity, the effectiveness of this exosome preparation can be demonstrated.

[0025] If efficacy is achieved, further safety evaluation can be conducted, including in vivo toxicology, immunogenicity, risk of tumorigenesis, and exosome biodistribution. Ultimately, this exosome preparation will be developed into a clinical drug suitable for patients with acute ischemic stroke, as adjuvant therapy after thrombolysis / thrombectomy, or for use during the post-reperfusion protection period and brain repair period.

[0026] Example 2: Establishment of MSC-Exos preparation using umbilical cord mesenchymal stem cells overexpressing miR-29: In MSCs overexpressing miR-29 with a positive transfection rate of over 80%, the cell supernatant was collected after three days of culture in exosome-free serum medium. Exosomes overexpressing miR-29 were extracted by ultracentrifugation, and their morphology, size, concentration, and surface markers were characterized.

[0027] Transmission electron microscopy results showed that the exosomes extracted from umbilical cord mesenchymal stem cells had a complete spherical structure. Figure 1(A). Nanoflow cytometry showed an average particle size of 59.1 ± 19.3 nm and an average concentration of 3.20 × 10⁻⁶. 10 particles / ml ( Figure 1 (B) Western blot analysis showed positive results for exosome markers CD68 and TSG-101. Figure 1 (C); RT-qPCR showed that the expression level of miR-29 in exosomes overexpressing miR-29 was significantly higher than that in control exosomes. Figure 1 (D).

[0028] These results suggest that umbilical cord mesenchymal stem cell exosomes and mesenchymal stem cell exosomes overexpressing miR-29 were successfully extracted.

[0029] Example 3: Treatment of MCAO mice: Male C57BL / 6J rats (6-8 weeks old, weighing approximately 20-25 g) were used to establish a MCAO model. After 120 minutes of ischemia, the suture embolus was removed and reperfused. 10 μL of a 10% concentration was injected into the carotid artery using a micro-injection needle. 9 Mice were injected with miR-29-overexpressing MSC-Exos (particles / mL). Control groups received the same dose of negative control MSC-Exos or PBS. Mice were ultimately grouped into three groups: sham-operated mice (Sham), MCAO mice injected with PBS (PBS), MCAO mice injected with negative control exosomes (NC agomir), and MCAO mice injected with miR-29-overexpressing exosomes (miR-29 agomir). Postoperatively, mice were injected daily with 1 mL of 5% glucose solution and 0.3 mL of penicillin-dextrose antibody to maintain postoperative energy supply and prevent infection. To evaluate the therapeutic effect of miR-29-overexpressing exosomes on ischemic stroke, a systematic review was performed on day 3 postoperatively.

[0030] TTC staining was performed on mouse brain sections to assess the area of ​​cerebral infarction. TTC staining results showed a slight reduction in cerebral infarction area after exosome treatment, with treatment using exosomes overexpressing miR-29 showing a more significant reduction in infarction area and better therapeutic effect. Figure 2 This indicates that overexpression of miR-29 exosomes can further reduce the infarct area in mice on the basis of exosome treatment.

[0031] To evaluate neuromotor function in mice, mNSS scores, Rotard test, open field test, and Morris water maze test were performed. The open field test recorded the total distance and average speed of movement in the mice. The results showed that treatment with exosomes overexpressing miR-29 significantly increased the distance and average speed of movement in stroke-affected mice. Figure 3(AC); mNSS scoring results showed that on the third day after modeling, the PBS component value was the highest, while the miR-29 agomir component value decreased significantly and was lower than that of the NC agomir group ( Figure 3 The Rotard experiment showed that compared with the sham-operated group, the persistence time on the rotarod was decreased in all groups after surgery. The persistence time on the rotarod was increased in the NCagomir group compared with the PBS group, while the persistence time was longer in the miR-29 agomir group compared with the NC agomir group. Figure 3 (E); Water maze training will be conducted on days 27-30 post-surgery. Figure 4 (Middle A), Day 31 of the formal experiment. During the experimental phase, compared to the PBS group mice, the miR-29 agomir group mice were able to find the platform faster and faster than the NC group mice. Figure 4 (B). The above experimental results demonstrate that overexpression of miR-29 exosomes can improve motor function, spatial memory, and neurological function in mice after ischemic stroke.

[0032] To investigate the improvement in cerebral blood flow in mice, cerebral blood flow was measured 2 hours after embolism using a laser speckle imager to verify the successful establishment of the model. Cerebral blood flow was also measured on days 1, 3, and 7 after reperfusion. Figure 5 (A). The results showed that compared with before surgery, cerebral blood flow in the injured area of ​​mice was significantly reduced after modeling. Cerebral blood flow spontaneously improved on the third day after reperfusion. During this process, mice treated with exosomes overexpressing miR-29 showed even higher cerebral blood flow. Figure 5 (B) indicates that overexpression of miR-29 MSC-Exos can accelerate the recovery of cerebral blood flow in the injured area of ​​MCAO mice.

[0033] To evaluate the protective effect of miR-29 overexpression exosomes on neurons, mice in each group underwent double immunofluorescence staining for MAP2 and NeuN. Figure 6 (A). Staining results showed that compared with the Sham group, the PBS group had a significant decrease in neuronal cell body and dendrite density, while the miR-29 agomir group showed an increase in neuronal and dendrite density after treatment, which was significantly higher than that of the NCagomir group. Figure 6 China B and Figure 6 (C) This result demonstrates that overexpression of miR-29 exosomes can protect neuronal survival and dendritic structural complexity.

[0034] ELISA was used to detect the expression of inflammatory factors IL-1β, TNF-α, and IFN-γ in the injured side of the mouse brain. Compared with the Sham group, the PBS group showed increased expression of inflammatory factors IL-1β, TNF-α, and IFN-γ due to activation. Compared with the PBS group, the miR-29 agomir group inhibited the activation of inflammatory factors, and the expression of IL-1β, TNF-α, and IFN-γ was significantly decreased and significantly lower than that in the NC agomir group. Figure 7 This indicates that the ability of exosomes overexpressing miR-29 to alleviate post-ischemic neuroinflammation is superior to that of exosome-only treatment.

[0035] The above experimental results demonstrate that this exosome preparation can significantly improve the injury indicators of the ischemic stroke model and has a significant therapeutic effect on ischemic stroke.

Claims

1. A method for preparing mesenchymal stem cell exosomes overexpressing miR-29, characterized in that, Includes the following steps: a. Culture mesenchymal stem cells overexpressing miR-29: Human umbilical cord mesenchymal stem cells (hUC-MSCs) were selected and cultured in DMEM / F12 medium supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin. The human umbilical cord mesenchymal stem cells of passages P4-P12 were cultured in a carbon dioxide incubator of 37°C and 5% CO2. After the cultured human umbilical cord mesenchymal stem cells reached 80% confluence, 20 nM miR-29aagomir was added. Fluorescence was observed 48 hours after transfection. A positive transfection rate of 80% or more was considered a successful transfection and the cells were used as the cell source for exosome production. b. Preparation, purification, and identification of exosomes: After successful transfection, MSCs overexpressing miR-29 were cultured in exosome-free serum medium for three days. The cell supernatant was then collected for the extraction of exosomes overexpressing miR-29. Exosomes were extracted using ultracentrifugation. The supernatant of the culture medium containing exosomes was centrifuged at 2,000 × g for 20 minutes at 4°C. The supernatant was transferred to a new centrifuge tube and then centrifuged at 10,000 × g for 30 minutes at 4°C. The supernatant was then passed through a 0.22 μm filter and transferred to an ultracentrifuge tube to remove dead cells and cell debris from the culture medium supernatant. Subsequently, the filtrate was ultracentrifuged at 120,000 × g for 70 minutes at 4°C to precipitate the exosomes in the supernatant. After centrifugation, the supernatant was discarded. The exosomes precipitated at the bottom of the centrifuge tube were washed with filtered PBS, and then ultracentrifuged at 120,000 × g for 70 minutes at 4°C to reprecipitate the exosomes. The precipitate was then resuspended in sterile PBS and stored at -80°C. The purified exosomes were identified.

2. The method for preparing mesenchymal stem cell exosomes overexpressing miR-29 as described in claim 1, characterized in that: The use of the mesenchymal stem cell exosomes prepared by the method in the preparation of drugs for the treatment of ischemic stroke.

3. A drug for treating ischemic stroke, characterized in that: The exosomes were prepared using the method for preparing mesenchymal stem cell exosomes overexpressing miR-29 as described in claim 1.

Citation Information

Patent Citations

  • Application of MicroRNA 29a-5p to preparation of drug for treating acute cerebral ischemia and cerebral ischemia reperfusion injury

    CN107287199A

  • Application of umbilical cord mesenchymal stem cell-derived exosome in preparation of medicine for preventing and / or treating cerebral arterial thrombosis

    CN116999465A

  • Zebra fish model for hypertrophic cardiomyopathy as well as construction method and application of zebra fish model

    CN120624551A

  • Micro RNAS to treat stroke, ischemic brain injury, traumatic brain injury, and neurodegenerative disease

    WO2013032962A2