Recombinant humanized type III collagen, preparation methods and applications

Abstract

This invention discloses recombinant humanized type III collagen, its preparation method, and its applications, belonging to the field of medical materials technology. The amino acid sequence of this recombinant humanized type III collagen is any one of SEQ ID No. 2-6. Compared to traditional extraction methods, the amino acid sequence of this recombinant protein is highly consistent with that of natural human proteins, completely avoiding the biosafety risks of pathogens, prions, etc., that may exist during animal-derived extraction, while also exhibiting lower immunogenicity. Furthermore, this protein effectively maintains the natural biological activity and stability of collagen. When used as a wound dressing, this material can efficiently promote cell migration, spreading, and proliferation, accelerate tissue regeneration and wound healing, while possessing excellent biocompatibility, controllable degradation, and low immunogenicity.

Description

Technical Field

[0001] This invention belongs to the field of medical materials technology, specifically relating to recombinant humanized type III collagen, its preparation method, and its application. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Collagen, as a major structural protein of the extracellular matrix, is widely found in skin, bone, tendons, ligaments, cartilage, and almost all tissues and organs, and is widely used in wound repair and tissue engineering. Its natural triple helix structure and bioactivity provide an ideal foundation for its use as a fundamental material in wound dressings, cosmetics, tissue engineering, and medical devices. Currently, production mainly relies on animal tissue extraction, which can easily lead to loss of activity and biosafety risks.

[0004] Recombinant protein technology has opened new avenues for obtaining highly safe and customizable human collagen, but further improvements are needed to enhance its specific binding ability to cells and its functionality in clinical applications. Developing novel collagen materials with enhanced cell adhesion properties has become an important direction for improving existing wound dressings and other products. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide recombinant humanized type III collagen, its preparation method, and its applications. Based on the complete amino acid sequence of human type III collagen, this invention systematically screens and identifies its core functional sequences possessing key biological activities. Based on these sequence characteristics, through rational design and targeted repetitive construction, a series of recombinant humanized type III collagens with well-defined structures and enhanced functions are obtained. The recombinant humanized type III collagen provided by this invention is based on a gene sequence optimized using bioinformatics, ensuring its ability to form a stable triple helix structure and fully preserving the functional domains unique to natural collagen. It significantly outperforms animal-derived collagen, whose structure is damaged due to traditional extraction processes, in terms of biological functions such as cell proliferation and adhesion.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides a recombinant humanized type III collagen protein, wherein the amino acid sequence of the recombinant humanized type III collagen protein is any one of SEQ ID No. 2-6.

[0008] Experiments have shown that the recombinant humanized type III collagen provided by this invention significantly enhances its specific adhesion ability to cells. Compared with traditional extraction methods, this recombinant protein completely avoids the risk of pathogen contamination from animal-derived materials and effectively maintains the natural biological activity and stability of collagen.

[0009] A second aspect of the present invention provides a nucleic acid fragment encoding the recombinant humanized type III collagen described in the first aspect.

[0010] In some embodiments of the present invention, the nucleotide sequence of the nucleic acid fragment is any one of SEQ ID No. 7-11. The sequence shown here does not contain an amino acid (such as methionine (Met)) encoded by a start codon (such as ATG) at its N-terminus. Those skilled in the art will understand that during the preparation of proteins through genetic engineering, the first nucleotide of the resulting polypeptide chain is often an amino acid (such as Met) encoded by the start codon due to the effect of the start codon. The nucleic acid fragment of the recombinant humanized type III collagen of the present invention encompasses not only amino acid sequences that do not contain an amino acid (such as Met) encoded by a start codon at their N-terminus, but also amino acid sequences that do contain an amino acid (such as Met) encoded by a start codon at their N-terminus. Therefore, sequences that further contain an amino acid (such as Met) encoded by a start codon at the N-terminus of the above-mentioned amino acid sequences are also within the scope of protection of the present invention.

[0011] A third aspect of the present invention provides a recombinant expression vector comprising a vector plasmid and the nucleic acid fragment described in the second aspect.

[0012] The recombinant expression vector of the present invention is obtained by effectively ligating the above-mentioned nucleic acid fragment to a vector plasmid. Specifically, the recombinant expression vector can be obtained by amplifying a single fragment to obtain the coding region gene fragment of recombinant humanized type III collagen, and then ligating it to a vector plasmid; alternatively, it can be obtained by ligating the gene encoding the above-mentioned recombinant humanized type III collagen to a vector plasmid.

[0013] In some embodiments of the present invention, the vector plasmid is the pET28a plasmid. The use of this plasmid in the present invention is more conducive to its expression in engineered bacteria.

[0014] A fourth aspect of the present invention provides a recombinant host cell containing the nucleic acid fragment described in the second aspect or the recombinant expression vector described in the third aspect.

[0015] The recombinant host cells described in this invention can be obtained by introducing the recombinant expression vector into the host cells through chemical transformation or electroporation.

[0016] The recombinant host cell described in this invention can be a prokaryotic cell or a eukaryotic cell. Specifically, it can be any one or more of bacterial cells, fungal cells, or plant cells. More specifically, it includes, but is not limited to, Escherichia coli, Bacillus subtilis, lactic acid bacteria, Saccharomyces cerevisiae, or Streptomyces.

[0017] To obtain the target recombinant host cells, positive clones need to be screened for verification. The screening can be based on antibiotic screening, blue-white screening, PCR screening, enzyme digestion screening, or sequencing screening, etc., and is not limited here. It can be selected according to the actual situation.

[0018] The purpose of the above-mentioned nucleic acid fragments, recombinant expression vectors, or recombinant host cells provided by this invention is to express the aforementioned recombinant humanized type III collagen. When inducing recombinant host cells to express recombinant humanized type III collagen, methods such as isopropyl-β-D-thiogalactoside (IPTG) induction, pH / temperature induction, ester compound induction, or metal ion induction are not limited here and can be flexibly selected according to the characteristics of the recombinant expression vector and engineered bacteria.

[0019] A fifth aspect of the present invention provides a method for preparing the recombinant humanized type III collagen described in the first aspect, comprising:

[0020] Construct the recombinant expression vector described in the third aspect;

[0021] The recombinant expression vector was transferred into cells for expression, producing the recombinant humanized type III collagen.

[0022] After recombinant humanized type III collagen is expressed in recombinant host cells, it can be obtained by sonication and purification of the recombinant host cells. Purification includes precipitation and affinity chromatography. Specifically, the affinity chromatography can be anion exchange chromatography, nickel affinity chromatography, glutathione affinity chromatography, or metal chelation chromatography, etc., and is not limited thereto; it can be selected according to the characteristics of the protein.

[0023] A sixth aspect of the present invention provides the application of the recombinant humanized type III collagen described in the first aspect in biomedical materials.

[0024] In some embodiments of the present invention, the biomedical material includes any one or more of collagen hemostatic cotton, surgical sutures, and wound dressings. When the recombinant humanized type III collagen of the present invention is used as a wound dressing, it can promote cell adhesion and exhibits high bioactivity.

[0025] A seventh aspect of the present invention provides a biomedical material comprising any one or a combination of the following (1) to (5):

[0026] (1) The recombinant humanized type III collagen described in the first aspect;

[0027] (2) The nucleic acid fragments described in the second aspect;

[0028] (3) The recombinant expression vector described in the third aspect;

[0029] (4) The recombinant host cell described in the fourth aspect.

[0030] The beneficial effects of this invention are as follows:

[0031] This invention provides a novel recombinant humanized type III collagen protein. Through molecular design optimization of its structure and functional domains, its specific adhesion to cells is significantly enhanced. Compared to traditional extraction methods, the amino acid sequence of this recombinant protein is highly consistent with that of natural human proteins, completely avoiding the biosafety risks of pathogens and prions that may exist during animal-derived extraction. It also exhibits lower immunogenicity, significantly improving the safety of the product for clinical use. Furthermore, this protein effectively maintains the natural biological activity and stability of collagen. When used as a wound dressing, this material can efficiently promote cell migration, spreading, and proliferation, accelerating tissue regeneration and wound healing. It also possesses excellent biocompatibility, controllable degradation, and low immunogenicity, providing a superior and safer solution for tissue engineering and medical device fields.

[0032] This invention uses a multi-stage purification process to efficiently remove host proteins, nucleic acids, and endotoxins, ultimately obtaining a recombinant collagen product with a purity of over 95%, meeting the stringent quality control requirements for cosmetics and medical devices. Attached Figure Description

[0033] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0034] Figure 1 This is a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) image of the purified recombinant humanized type III collagen obtained in Example 1 of this invention. Lane A represents the sample before anion purification, lane B represents the flow-through after anion purification, lane C represents the washing after anion purification, and lane D represents the elution after anion purification.

[0035] Figure 2 The sponge obtained by freeze-drying recombinant humanized type III collagen in Example 1 of this invention.

[0036] Figure 3This is an SDS-PAGE image of the purified recombinant humanized type III collagen obtained in Example 2 of this invention. Lane A represents the sample before anion purification, lane B represents the flow-through after anion purification, and lane C represents the elution after anion purification.

[0037] Figure 4 The sponge obtained by freeze-drying recombinant humanized type III collagen in Example 2 of this invention.

[0038] Figure 5 This is an SDS-PAGE image of the purified recombinant humanized type III collagen obtained in Example 3 of this invention. Lane A represents the sample before anion purification, lane B represents the flow-through after anion purification, and lane C represents the elution after anion purification.

[0039] Figure 6 The sponge obtained by freeze-drying recombinant humanized type III collagen in Example 3 of this invention.

[0040] Figure 7 This is an SDS-PAGE image of the purified recombinant humanized type III collagen obtained in Example 4 of this invention. Lane A represents the sample before anion purification, lane B represents the flow-through after anion purification, lane C represents the washing after anion purification, and lane D represents the elution after anion purification.

[0041] Figure 8 The sponge obtained by freeze-drying recombinant humanized type III collagen in Example 4 of this invention.

[0042] Figure 9 This is an SDS-PAGE image of the purified recombinant humanized type III collagen obtained in Example 5 of this invention. Lane A represents the sample before anion purification, lane B represents the flow-through after anion purification, lane C represents the washing after anion purification, and lane D represents the elution after anion purification.

[0043] Figure 10 The sponge obtained by freeze-drying recombinant humanized type III collagen in Example 5 of this invention.

[0044] Figure 11 The cell adhesion effects of recombinant humanized type III collagen at different concentrations obtained in Examples 1 to 5 of this invention are shown.

[0045] Figure 12 This is a schematic diagram of the structure of the expression plasmid obtained in Example 1 of the present invention. Detailed Implementation

[0046] This invention provides recombinant humanized type III collagen, its preparation method, and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0047] The test materials used in this invention are all common commercial products and can be purchased on the market.

[0048] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0049] Example 1

[0050] This embodiment provides a recombinant humanized type III collagen, the preparation method of which is as follows:

[0051] In the full-length triple helix region of the Homo sapiens COL3A1 (NP_000081) protein, Glagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 1) was selected as a repeating unit and repeated 6 times to obtain recombinant humanized type III collagen with the amino acid sequence shown in SEQ ID No. 2, with a theoretical molecular weight of approximately 30.6 kDa.

[0052] The sequence encoding this protein underwent codon optimization, and the optimized nucleotide sequence is shown in SEQ ID No. 7. Synthesis of the recombinant humanized type III collagen gene and construction of the expression vector: The whole gene was synthesized by BGI Genomics (Wuxi) Co., Ltd. After synthesis, the whole gene was ligated into the pET28a plasmid to construct the expression plasmid. The structure of this expression plasmid is shown below. Figure 12 The sequence is shown in SEQ ID No. 12. The expression plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB solid medium containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated onto LB liquid medium containing kanamycin, and cultured at 37°C with shaking until OD... 600 The concentration was 0.4–0.6, and IPTG was added to a final concentration of 0.1–1.0 mM. Expression was induced at 37°C for 4–6 h, and the cells were collected by high-speed centrifugation. After resuspending the cells in phosphate buffer, they were homogenized by high-pressure homogenizer, and the supernatant was collected by high-speed centrifugation.

[0053] The supernatant after the above-mentioned crushing and centrifugation was precipitated with 10%–40% (w / v) ammonium sulfate. After salting out, the precipitate was collected by high-speed centrifugation and dissolved in 50 mM Tris buffer (pH=8). Further purification was carried out by anion exchange chromatography: the column was equilibrated at 50 mM Tris, and contaminating proteins were washed with 50 mM Tris, 50–100 mM NaCl, and pH=8. The target protein was then eluted with 50 mM Tris, 300–500 mM NaCl, and pH=8.

[0054] The apparent molecular weight of recombinant collagen was analyzed using SDS-PAGE, and the results are as follows: Figure 1 As shown in the figure, the purified protein exhibited a single main band on the gel, with its migration position corresponding to approximately 30 kDa, consistent with the theoretically predicted molecular weight. The band was clear in morphology and uniform in width, without obvious contaminating protein tails or nonspecific bands, indicating that the obtained recombinant type III collagen had high purity.

[0055] Figure 2 This is the sponge obtained from the freeze-dried recombinant humanized type III collagen in Example 1. As shown in the figure, the freeze-dried product of the recombinant humanized type III collagen is a white, sponge-like solid with a loose and porous overall structure, a light texture, and natural flocculent / filamentous extensions at the edges, exhibiting typical characteristics of a freeze-dried sponge. The product is intact, without obvious collapse or fragmentation, indicating that its freeze-drying process is stable and can form a sponge-like scaffold with a good three-dimensional porous structure. This structural feature provides a structural basis for its application in the field of biomedical materials (such as tissue engineering scaffolds, wound repair materials, etc.).

[0056] The amino acid sequence is as follows:

[0057] GlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGl agypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (seq ID No.2).

[0058] Nucleotide sequence:

[0059] ggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaaggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaaggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaaggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaaggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaaggcctggcgggctatccgggcccggcgggcccgccgggcccgccgggcgaacgcggcctgccgggcccgccgggcgaaaaaggcgaaaccggcgaaccgggcccgcgcggcgaacgcggcgaagcgggcattccgggcgaacgcggcgcgccgggcgaaaaa(SEQ IDNo.7)。

[0060] Expression plasmid sequence:

[0061]

[0062] Example 2

[0063] This embodiment provides a recombinant humanized type III collagen, the preparation method of which is as follows:

[0064] In the full-length triple helix region of the Homo sapiens COL3A1 (NP_000081) protein, Glagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 1) was selected as a repeating unit and repeated 7 times to obtain recombinant humanized type III collagen with the amino acid sequence shown in SEQ ID No. 3, with a theoretical molecular weight of approximately 35.7 kDa.

[0065] The sequence encoding this protein was codon-optimized, and the optimized nucleotide sequence is shown in SEQ ID No. 8. Synthesis of the recombinant humanized type III collagen gene and construction of the expression vector: The whole gene was synthesized by BGI Genomics (Wuxi) Co., Ltd. After synthesis, the whole gene was ligated into the pET28a plasmid to construct the expression plasmid. The sequence of this expression plasmid is obtained by replacing positions 5074-6045 of the sequence shown in SEQ ID No. 12 with the sequence shown in SEQ ID No. 8. The expression plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB solid medium containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing kanamycin, and cultured at 37°C with shaking until OD... 600 The concentration was 0.4–0.6, and IPTG was added to a final concentration of 0.1–1.0 mM. Expression was induced at 37°C for 4–6 h, and the cells were collected by high-speed centrifugation. After resuspending the cells in phosphate buffer, they were homogenized by high-pressure homogenizer, and the supernatant was collected by high-speed centrifugation.

[0066] The supernatant after the above-mentioned crushing and centrifugation was precipitated with 10%–40% (w / v) ammonium sulfate. After salting out, the precipitate was collected by high-speed centrifugation and dissolved in 50 mM Tris buffer (pH=8). Further purification was carried out by anion exchange chromatography: the column was equilibrated at 50 mM Tris, and contaminating proteins were washed with 50 mM Tris, 50–100 mM NaCl, and pH=8. The target protein was then eluted with 50 mM Tris, 300–500 mM NaCl, and pH=8.

[0067] The apparent molecular weight of recombinant collagen was analyzed using SDS-PAGE, and the results are as follows: Figure 3As shown, the main band of the purified sample on the gel corresponds to approximately 36 kDa, consistent with the theoretical molecular weight. Notably, two weak bands are visible above the main band, which is speculated to be related to the retention of higher-order structures by some protein molecules during electrophoresis, leading to reduced migration.

[0068] Figure 4 The sponge obtained from the freeze-dried recombinant humanized type III collagen in Example 2 is shown in the figure. As can be seen from the figure, the freeze-dried product exhibits a white, loose, porous sponge-like structure with a regular shape, intact blocks, no obvious fragmentation or powdering at the edges, and maintains good formability. Compared to conventional freeze-dried products, the sponge structure obtained in Example 2 is denser and more uniform, with moderate volume shrinkage, demonstrating that the freeze-drying process of this invention can effectively control the porous structure and morphological stability of recombinant humanized type III collagen. This porous sponge structure possesses excellent porosity and support, providing an ideal structural basis for subsequent cell adhesion, nutrient transport, and biodegradation, making it suitable for tissue engineering, biomedical dressings, and other fields.

[0069] amino acid sequence:

[0070] GlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekge tgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 3).

[0071] Nucleotide sequence:

[0072]

[0073] Example 3

[0074] This embodiment provides a recombinant humanized type III collagen, the preparation method of which is as follows:

[0075] In the full-length triple helix region of the Homo sapiens COL3A1 (NP_000081) protein, Glagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 1) was selected as a repeating unit and repeated 8 times to obtain recombinant humanized type III collagen with the amino acid sequence shown in SEQ ID No. 4, with a theoretical molecular weight of approximately 40.8 kDa.

[0076] The sequence encoding this protein was codon-optimized, and the optimized nucleotide sequence is shown in SEQ ID No. 9. Synthesis of the recombinant humanized type III collagen gene and construction of the expression vector: The whole gene was synthesized by BGI Genomics (Wuxi) Co., Ltd. After synthesis, the whole gene was ligated into the pET28a plasmid to construct the expression plasmid. The sequence of this expression plasmid is obtained by replacing positions 5074-6045 of the sequence shown in SEQ ID No. 12 with the sequence shown in SEQ ID No. 9. The expression plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB solid medium containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing kanamycin, and cultured at 37°C with shaking until OD. 600 The concentration was 0.4–0.6, and IPTG was added to a final concentration of 0.1–1.0 mM. Expression was induced at 37°C for 4–6 h, and the cells were collected by high-speed centrifugation. After resuspending the cells in phosphate buffer, they were homogenized by high-pressure homogenizer, and the supernatant was collected by high-speed centrifugation.

[0077] The supernatant after the above-mentioned crushing and centrifugation was precipitated with 10%–40% (w / v) ammonium sulfate. After salting out, the precipitate was collected by high-speed centrifugation and dissolved in 50 mM Tris buffer (pH=8). Further purification was performed by anion exchange chromatography: the column was equilibrated at 50 mM Tris, and contaminating proteins were washed with 50 mM Tris, 50–100 mM NaCl, and pH=8. The target protein was then eluted with 50 mM Tris, 300–500 mM NaCl, and pH=8. After purification, the sample purity reached over 90%.

[0078] The apparent molecular weight of recombinant collagen was analyzed using SDS-PAGE technology. The results are as follows: Figure 5As shown, the sample exhibits a well-defined and clearly edged main band on the electrophoresis gel, with a migration distance corresponding to a molecular weight of approximately 40 kDa, which highly matches the calculated theoretical molecular weight. These morphological characteristics of the main band suggest that the target protein is abundant and homogeneous in the sample. Furthermore, a faint, lightly colored non-target band is visible above the main band; its origin may be a trace amount of co-purified impurities or post-translational modification products, and it does not affect the assessment of the purity and properties of the main product.

[0079] Figure 6 This is the freeze-dried sponge obtained from recombinant humanized type III collagen in Example 3. As shown in the figure, after freeze-drying, the product exhibits a white, blocky, sponge-like structure with a full and regular overall shape, good formability, no obvious breakage or collapse at the edges, and a loose and porous surface. Compared with Examples 1 and 2, the sponge obtained in this example has a complete block shape and uniform structure, demonstrating excellent freeze-drying molding effect and morphological stability. Its porous structure is beneficial to improving the porosity and specific surface area of ​​the material, providing good structural support for the application of recombinant humanized type III collagen sponge in the biomedical field (such as tissue engineering scaffolds, wound dressings, etc.).

[0080] amino acid sequence:

[0081] GlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekG lagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGl agypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGla gypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (seq ID No.4).

[0082] Nucleotide sequence:

[0083]

[0084] Example 4

[0085] This embodiment provides a recombinant humanized type III collagen, the preparation method of which is as follows:

[0086] In the full-length triple helix region of the Homo sapiens COL3A1 (NP_000081) protein, Glagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 1) was selected as a repeating unit and repeated 9 times to obtain recombinant humanized type III collagen with the amino acid sequence shown in SEQ ID No. 5, with a theoretical molecular weight of approximately 45.8 kDa.

[0087] The sequence encoding this protein was codon-optimized, and the optimized nucleotide sequence is shown in SEQ ID No. 10. Synthesis of the recombinant humanized type III collagen gene and construction of the expression vector: The whole gene was synthesized by BGI Genomics (Wuxi) Co., Ltd. After synthesis, the whole gene was ligated into the pET28a plasmid to construct the expression plasmid. The sequence of this expression plasmid is obtained by replacing positions 5074-6045 of the sequence shown in SEQ ID No. 12 with the sequence shown in SEQ ID No. 10. The expression plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB solid medium containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing kanamycin, and cultured at 37°C with shaking until OD. 600 The concentration was 0.4–0.6, and IPTG was added to a final concentration of 0.1–1.0 mM. Expression was induced at 37°C for 4–6 h, and the cells were collected by high-speed centrifugation. After resuspending the cells in phosphate buffer, they were homogenized by high-pressure homogenizer, and the supernatant was collected by high-speed centrifugation.

[0088] The supernatant after the above-mentioned crushing and centrifugation was precipitated with 10%–40% (w / v) ammonium sulfate. After salting out, the precipitate was collected by high-speed centrifugation and dissolved in 50 mM Tris buffer (pH=8). Further purification was carried out by anion exchange chromatography: the chromatography column was equilibrated under 50 mM Tris conditions, and contaminating proteins were washed with 50 mM Tris, 50–100 mM NaCl, and pH=8. The target protein was then eluted with 50 mM Tris, 300–500 mM NaCl, and pH=8.

[0089] The apparent molecular weight of the recombinant collagen samples was analyzed using SDS-PAGE. The results are as follows: Figure 7As shown, the purified product exhibits a single, broad, and deeply stained main band at approximately 45 kDa, with its migration position perfectly matching the theoretical molecular weight. This band morphology indicates high expression abundance and uniformity of the target protein, along with high purity and only a very small amount of nonspecific contaminants. In summary, this recombinant protein demonstrates stable yield, ease of purification, and good reproducibility and potential for large-scale preparation.

[0090] Figure 8 This is the sponge obtained from the freeze-dried recombinant humanized type III collagen in Example 4. As shown in the figure, the freeze-dried product has a white, loose, sponge-like structure, is lightweight, and maintains a good overall fluffy and porous morphology with natural flocculent extensions at the edges, exhibiting typical characteristics of a freeze-dried scaffold. The product is stable in shape, without obvious collapse or powdering, indicating that the freeze-drying process of this example can effectively maintain the three-dimensional porous structure of recombinant humanized type III collagen, providing an ideal structural basis for its application in biomedical materials (such as wound repair, tissue engineering scaffolds, etc.).

[0091] amino acid sequence:

[0092] GlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgp pgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekge tgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeag ipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgekGlagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (seq ID No.5).

[0093] Nucleotide sequence:

[0094]

[0095] Example 5

[0096] This embodiment provides a recombinant humanized type III collagen, the preparation method of which is as follows:

[0097] In the full-length triple helix region of the Homo sapiens COL3A1 (NP_000081) protein, Glagypgpagppgppgerglpgppgekgetgepgprgergeagipgergapgek (SEQ ID No. 1) was selected as a repeating unit and repeated 14 times to obtain recombinant humanized type III collagen with the amino acid sequence shown in SEQ ID No. 6, with a theoretical molecular weight of approximately 71.3 kDa.

[0098] The sequence encoding this protein was codon-optimized, and the optimized nucleotide sequence is shown in SEQ ID No. 11. Synthesis of the recombinant humanized type III collagen gene and construction of the expression vector: The whole gene was synthesized by BGI Genomics (Wuxi) Co., Ltd. After synthesis, the whole gene was ligated into the pET28a plasmid to construct the expression plasmid. The sequence of this expression plasmid is obtained by replacing positions 5074-6045 of the sequence shown in SEQ ID No. 12 with the sequence shown in SEQ ID No. 11. The expression plasmid was transformed into *E. coli* BL21(DE3) competent cells, plated on LB solid medium containing kanamycin, and incubated overnight at 37°C. Single colonies were picked and inoculated into LB liquid medium containing kanamycin, and cultured at 37°C with shaking until OD... 600 The concentration was 0.4–0.6, and IPTG was added to a final concentration of 0.1–1.0 mM. Expression was induced at 37°C for 4–6 h, and the cells were collected by high-speed centrifugation. After resuspending the cells in phosphate buffer, they were homogenized by high-pressure homogenizer, and the supernatant was collected by high-speed centrifugation.

[0099] The supernatant after the above-mentioned crushing and centrifugation was precipitated with 10%–40% (w / v) ammonium sulfate. After salting out, the precipitate was collected by high-speed centrifugation and dissolved in 50 mM Tris buffer (pH=8). Further purification was carried out by anion exchange chromatography: the chromatography column was equilibrated under 50 mM Tris conditions, and contaminating proteins were washed with 50 mM Tris, 50–100 mM NaCl, and pH=8. The target protein was then eluted with 50 mM Tris, 300–500 mM NaCl, and pH=8.

[0100] The apparent molecular weight of recombinant collagen was analyzed using SDS-PAGE. The results are as follows: Figure 9As shown, the purified sample exhibits a well-defined and highly concentrated main band on the gel, corresponding to a molecular weight of approximately 72 kDa, perfectly consistent with the theoretical prediction. Notably, this main band has a strong signal and a clean background; no obvious non-specific stray bands or degradation traces were observed in the target region or adjacent lanes. This result clearly demonstrates that the obtained recombinant collagen has high purity and good uniformity, and that the preparation process effectively avoids impurity residues and product degradation, resulting in excellent sample quality.

[0101] Figure 10 This is the freeze-dried sponge obtained from recombinant humanized type III collagen in Example 5. As shown in the figure, the freeze-dried product exhibits a white, regular, blocky sponge structure with a loose, porous surface, uniform texture, and intact overall shape. There are no obvious cracks or collapses at the edges, demonstrating good formability and structural stability. The product retains typical three-dimensional porous scaffold characteristics. This structure is beneficial for providing a suitable microenvironment for cell adhesion, nutrient transport, and biodegradation, supporting its application in biomedical fields such as tissue engineering and wound repair.

[0102] amino acid sequence:

[0103] (SEQ ID No.6).

[0104] Song:

[0105]

[0106] Performance validation: Cell adhesion activity assay

[0107] To verify whether the recombinant humanized type III collagen obtained in the examples possesses biological activity as a cell adhesion and migration matrix, a relative cell adhesion experiment was conducted. The specific steps are as follows:

[0108] The preparation steps for recombinant humanized type III collagen hydrogel dressing are as follows:

[0109] Step 1: Dissolve recombinant humanized type III collagen in phosphate-buffered saline (PBS) buffer (pH 7.4) to prepare solutions with concentrations of 100 μg / mL, 50 μg / mL and 10 μg / mL, respectively.

[0110] Step 2: Dissolve N-hydroxysuccinimide (NHS) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) in the above collagen solution at a molar ratio of 2:1, and stir at 4°C to obtain a mixture. Then transfer the mixture to a 25°C incubator to accelerate the gelation process.

[0111] Step 3: After confirming the formation of the hydrogel using the inverted method, transfer the gel to a dialysis bag and dialyze it three times with distilled water, with an interval of 6 hours between each dialyze, to fully remove unreacted EDC / NHS and its byproducts.

[0112] Step 4: After dialysis, the hydrogel is freeze-dried. Once completely dry, the recombinant humanized type III collagen dressing is obtained.

[0113] 10 mg of recombinant humanized type III collagen dressings containing 100 μg / mL, 50 μg / mL, and 10 μg / mL were added to each well of a 48-well plate, with four replicates for each concentration. 10 mg of commercially available recombinant collagen was added as a negative control. Subsequently, each well was uniformly seeded with approximately 5 × 10⁻⁶ mg of the dressing. 4 A suspension of L929 cells was prepared and then incubated statically for 2 hours in an incubator at 37°C, 5% CO2, and 95% humidity to allow cell adhesion. After incubation, the culture medium in each well was aspirated, and the cells were gently washed three times with PBS to remove any unadhered cells. Cell adhesion rate was then detected using the CCK-8 assay: absorbance was measured at 450 nm using a microplate reader. In this assay system, OD... 450 The value is positively correlated with the number and activity of cells adhering to the pores; the higher the value, the greater the amount of cell adhesion and the better the activity.

[0114] Test results as follows Figure 11As shown. Except for Example 3 (whose adhesion effect was not significantly different from that of commercially available collagen, possibly due to residual proteins in the sample affecting overall protein activity), the adhesion performance of the other examples was superior to that of commercially available collagen. This indicates that the recombinant humanized type III collagen prepared by the method of the present invention has higher biological activity.

[0115] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. Recombinant humanized type III collagen, characterized in that, Its amino acid sequence is any one of SEQ ID No. 2-6.

2. The nucleic acid fragment encoding the recombinant humanized type III collagen of claim 1.

3. The nucleic acid fragment as described in claim 2, characterized in that, Its nucleotide sequence is any one of SEQ ID No. 7-11.

4. A recombinant expression vector, characterized in that, Includes the vector plasmid and the nucleic acid fragment as described in claim 2 or 3.

5. The recombinant expression vector as described in claim 4, characterized in that, The vector plasmid is pET28a plasmid.

6. Recombinant host cells, characterized in that, The host cell contains the nucleic acid fragment of claim 2 or 3 or the recombinant expression vector of claim 4 or 5.

7. A method for preparing recombinant humanized type III collagen according to claim 1, characterized in that, include: Construct the recombinant expression vector as described in claim 4 or 5; The recombinant expression vector was transferred into cells for expression, producing the recombinant humanized type III collagen.

8. The application of the recombinant humanized type III collagen according to claim 1 in the preparation of biomedical materials.

9. The application as described in claim 8, characterized in that, The biomedical materials include any one or more of the following: collagen hemostatic cotton, surgical sutures, and wound dressings.

10. A biomedical material, characterized in that, Includes the recombinant humanized type III collagen as described in claim 1.

Images