Method for improving water-resistant straw-like dwarf virus capability of rice based on D14 protein site editing and application of method
By selectively modifying the 102nd amino acid of the D14 protein in rice to asparagine and editing the D14 gene using the CBE system, the problem of promoting resistance to rice grass dwarf virus in existing technologies has been solved, and a highly efficient disease-resistant breeding effect has been achieved in non-transgenic rice.
Patent Information
- Application Number
- CN202610063929.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-19
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies make it difficult to rapidly and widely promote the ability to resist rice straw dwarf virus in rice through gene editing, and the traditional CRISPR/Cas system is subject to restrictions on the continuous expression of exogenous Cas proteins and gRNA in plants due to transgenic safety policies.
By modifying the 102nd amino acid of the D14 protein in rice from aspartic acid to asparagine, and using the cytidine base editor (CBE) system to achieve precise editing of the D14 gene, D14 (D102N) mutant rice was obtained, which enhanced its resistance to rice grass dwarf virus. Through genetic screening, homozygous non-transgenic disease-resistant materials without exogenous transgenic components were obtained.
It significantly enhances rice resistance to rice straw dwarf virus without affecting rice agronomic traits, reduces virus phenotype and accumulation, and has good prospects for breeding applications.
Smart Images

Figure CN121874154A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to a method and its application for enhancing the resistance of rice to rice grassy dwarf virus based on D14 protein site editing. This scheme uses gene editing technology to target and modify the strigolactone (SL) receptor protein D14 in rice to enhance the resistance of rice to rice grassy dwarf virus (RGSV), thereby creating a new antiviral rice variety. Background Technology
[0002] Rice viral diseases are among the most important diseases affecting rice production, with their explosive and intermittent nature severely impacting yields. Currently, there are 19 common rice viral diseases, 10 of which cause severe damage in Asia. All of these are caused by RNA viruses, including single-stranded and double-stranded RNA viruses. Rice grassy stuntvirus (RGSV) is a common negative single-stranded RNA virus in rice, belonging to the genus Tenuivirus. It is transmitted via the brown planthopper and spreads non-ovarianly through persistent replication. RGSV infection significantly inhibits rice growth, leading to a surge in ineffective tillers, hindered panicle development, and almost no grain setting, resulting in severe yield reduction. RGSV virus particles are 6-8 nm filamentous particles or long branched filamentous particles of 950-1350 nm. The RGSV genome consists of six negative single-stranded RNAs, employing a bispeech coding strategy to encode 12 proteins. Among them, the P3 protein encoded by RNA3 is the main pathogenic protein of RGSV. Its expression in rice can lead to dwarfing and increased tillering in rice.
[0003] SLs are carotenoid-derived terpene lactones, first discovered approximately 60 years ago. SLs are released from the host plant roots into the soil, inducing the germination of strigolactone and broomrape parasitic seeds. Before 2008, SLs were considered rhizosphere signals connecting host and parasitic plants. With further research, SLs have also been recognized as plant hormones, and like other plant hormones, they not only regulate plant structure, such as inhibiting bud growth and branching, but also participate in plant defense. D14 (DWARF14) is a well-identified strigolactone receptor protein in rice, belonging to the α / β hydrolase superfamily, possessing both signal recognition and enzymatic catalysis functions. Upon binding to D14, strigolactone molecules undergo hydrolysis at their active site, inducing a conformational change in the D14 protein, thereby initiating strigolactone signal transduction. The conformationally altered D14 interacts with the rice F-box protein D3 and participates in the formation of an SCF-type E3 ubiquitin ligase complex. This complex further specifically recognizes the strigolactone signaling pathway inhibitor D53 and mediates its polyubiquitination and degradation via the 26S proteasome pathway. With the degradation of D53, its inhibitory effect on downstream gene expression, such as FC1, is relieved, thereby inhibiting tiller formation and regulating rice plant architecture. Studies have shown that loss of function or mutation of D14 in rice leads to impaired strigolactone signaling, exhibiting significant phenotypic changes, including dwarfing, a significant increase in tiller number, and a loose plant architecture, further demonstrating that D14 plays an important regulatory role in the inhibition of tillering and the maintenance of normal growth and development in rice. D14 plays a crucial role in rice development. If its function is inadvertently affected, it can lead to abnormal rice development. This poses a challenge to the development of disease-resistant rice varieties based on D14.
[0004] CRISPR / Cas-based genome editing technology can rapidly achieve site-specific deletions or insertions of genomic DNA fragments, base substitutions, and gene expression regulation, demonstrating significant application potential in improving yield, disease resistance, stress tolerance, and quality. In recent years, researchers have used the CRISPR / Cas system to precisely identify exogenous DNA or RNA viral sequences, suppressing, deleting, or mutating key functional regions of viruses, such as viral replication proteins, coat protein genes, or conserved intergenic spacers, effectively inhibiting further viral damage to plants. However, antiviral strategies targeting the viral genome based on the CRISPR / Cas system require the continuous expression of exogenous Cas proteins and gRNA in plants, which is subject to strict regulations under transgenic safety policies. Therefore, even if highly effective antiviral rice materials are obtained, they cannot be rapidly and widely promoted. Identifying viral target proteins, screening viral protein binding sites, and editing key interaction sites of target proteins are important means of obtaining stable-yielding and highly resistant non-transgenic rice and antiviral breeding. Summary of the Invention
[0005] In view of this, the purpose of this invention is to propose an antiviral breeding strategy that enhances rice resistance to RGSV by selectively modifying the SL receptor protein D14 through gene editing, especially a method for improving rice resistance to rice grass dwarf virus based on D14 protein site editing and its application.
[0006] To achieve the above-mentioned technical objectives, the technical solution adopted by this invention is as follows: This scheme proposes a mutant protein that enhances resistance to rice straw dwarf virus, the amino acid sequence of which is shown in SEQ ID NO: 1.
[0007] The mutant protein is the D14 protein encoded by the D14 gene of rice plants, which has a mutation at the 102nd amino acid position, changing from aspartic acid (Asp, D) to asparagine (Asn, N), i.e., the D14 (D102N) mutation.
[0008] The gene encoding the mutant protein described above has the nucleotide sequence shown in SEQ ID NO: 2.
[0009] This scheme also proposes a rice plant that enhances resistance to rice straw dwarf virus, wherein the D14 protein encoded by the D14 gene of the rice plant is mutated at the 102nd amino acid position, changing from aspartic acid (Asp, D) to asparagine (Asn, N), i.e., the D14 (D102N) mutation.
[0010] In some instances, the D14 gene of the rice plant undergoes a single base substitution mutation, i.e., GAC is changed to AAC.
[0011] In some instances, the mutations in the rice plants are obtained through base editing technology, and the base editing system includes a cytosine base editor (CBE).
[0012] In some instances, the rice plants were obtained without transgenic backbone sequences, thus being non-transgenic rice materials.
[0013] In some instances, the rice plants inoculated with RGSV virus exhibited a weaker disease phenotype and lower virus accumulation than wild-type rice, with no significant differences in major agronomic traits compared to wild-type.
[0014] This solution also proposes a rice seed derived from any of the rice plants described above or containing the genes described above.
[0015] This scheme also proposes a method for enhancing rice breeding resistance to RGSV, which includes the following steps: (1) Design a base editing system targeting site 102 of the rice D14 gene; (2) The editing system was introduced into rice cells to induce mutations and obtain D14 (D102N) plants; (3) Screening for homozygous mutant offspring without edited backbones; (4) Evaluate its disease resistance and agronomic traits to obtain the target germplasm.
[0016] Compared with existing technologies, the present invention, employing the above technical solution, has the following beneficial effects: This solution uses structural biology methods to analyze the interaction interface between RGSV P3 and rice D14 protein, determining that the binding site between D14 and P3 is aspartic acid (Asp, D) at the 102nd residue of D14. Subsequently, the D14 gene is precisely edited in rice using a cytidine base editor (CBE) system, mutating this site to asparagine (Asn, N), obtaining D14 (D102N) transgenic rice. Disease resistance identification confirms that this mutant exhibits significant resistance to RGSV. Furthermore, genetic screening yields homozygous non-transgenic disease-resistant materials without exogenous transgenic components, demonstrating promising breeding application prospects. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1This is a schematic diagram illustrating the results of yeast two-hybrid, BiFC, and Pull-down verification of the interaction between RGSV P3 and D14 in this embodiment of the scheme; Figure 2 This is a schematic diagram of the interaction between the RGSV P3 and D14 composite structures in Embodiment 2 of this scheme; Figure 3 This is a schematic diagram illustrating the results of MST and Pull-down verification in Example 3 of this scheme, showing that D14 (D102A) does not interact with P3; Figure 4 This is a phenotypic analysis of D14 (D102N) rice in Example 4 of this scheme; Figure 5 This is an identification of the disease resistance of D14 (D102N) rice in Example 5 of this scheme. Detailed Implementation
[0019] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be particularly noted that the following embodiments are for illustrative purposes only and do not limit the scope of the invention. Similarly, the following embodiments are only some, not all, embodiments of the present invention, and all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0020] This method provides a way to identify the interaction site between the pathogenic protein P3 of rice straw dwarf virus and the receptor protein D14 of rice SLs, and to construct antiviral rice materials by site-directed mutagenesis of this key amino acid site.
[0021] In summary, the technical approach of this solution is as follows: 1. The interaction between P3 and D14 was confirmed using a variety of biological methods; 2. The binding sites of P3 and D14 were identified using various biological methods; 3. Achieving precise mutation of the D14 gene locus in rice based on the CBE system; 4. Agronomic traits of the obtained D14 mutant rice materials were analyzed; 5. Evaluation of disease resistance in D14 mutant rice to verify its application value.
[0022] The technical solution of the present invention will be further described below with reference to specific embodiments, but is not limited thereto.
[0023] Example 1: Screening the interaction verification between RGSV P3 and D14 (1) Using RGSV strains and rice NIP cDNA as templates, the RGSV P3 and D14 sequences were amplified using primers containing attB1 / 2. The primers containing attB1 / 2 include the following: pDONR221-P3-F: ggggacaagtttgtacaaaaaagcaggcttcATGTCACTTAGTTCAAGTAGTTC pDONR221-P3-R: ggggaccactttgtacaagaaagctgggtcCTAATCTATTCTTAAGAACTGCCC pDONR221-D14-F: ggggacaagtttgtacaaaaaagcaggcttcATGCTGCGATCGACGCATCCG pDONR221-D14-R: ggggaccactttgtacaagaaagctgggtcTTAGTACCGGGCGAGAGCGCG.
[0024] Using the Gateway® BP Clonase™ II Enzyme Mix kit, the sequences of P3 and D14 were fused into the intermediate vector 221 via homologous recombination to obtain the P3-221 and D14-221 vectors.
[0025] The P3-221 and D14-221 vectors were subjected to Mlu After enzyme digestion, the recovered products were used to obtain the bait vectors pGADT7 (AD) and pGBKT7 (BD) for the yeast two-hybrid system via homologous recombination using the Gateway® LR Clonase™ II Enzyme Mix kit, yielding AD-P3 and BD-D14 vectors, as well as AD-D14 and BD-P3. The recovered products were then fused into the BiFC vectors pEarleyGate201-YN and pEarleyGate202-YC to obtain P3-YN and D14-YC. Using adapter primers with restriction sites as templates, the P3-221 and D14-221 vectors were amplified to obtain the vectors containing restriction sites. BamH I and Sal I restriction enzyme cleavage site linker P3 and D14 The PCR product was then fused to the target cell via homologous recombination. BamH I and Sal I double enzyme digestion pET28a and pMAL His-P3 and MBP-D14 vectors were obtained on the vector.
[0026] The adapter primers with enzyme cleavage sites include the following: His-P3-F: aatgggtcgcggatccATGTCACTTAGTTCAAGTAGTTCAATG His-P3-R:ccgcaagcttgtcgacCTAATCTATTCTTAAGAACTGCCCT GST-D14-F:ggggcccctgggatccATGCTGCGATCGACGCATCCG GST-D14-R: ggccgctcgagtcgacTTAGTACCGGGCGAGAGCGCG The interaction between P3 and D14 was verified using yeast two-hybrid, BiFC, and pull-down assays, respectively. Figure 1 ).
[0027] Example 2: Screening for interaction sites between P3 and D14 using structural biology.
[0028] (1) Through structural analysis of the P3-D14 complex, the interaction surface area between P3 and D14 was determined to be 886.9 Ų, and the interaction interface can be divided into a major interface and a minor interface. Within the major interface, hydrophobic and hydrophilic regions were further distinguished. The hydrophobic region involves V65, L89, V98, L100, and D102 residues of D14, and V123 and I128 residues of P3. The hydrophilic region includes multiple hydrogen bond interactions, where A54, Q58, R63, A64, and G66 residues of D14 form a hydrogen bond network with the β-sheet regions of P3 (E131, Q133, D136, S151, and Y182). The minor interface mainly consists of extensive intermolecular hydrogen bonds formed by four residues, including A135 and R137 of D14, which interact with L164 and N165 of P3 (…). Figure 2 ).
[0029] (2) Based on structural analysis, point mutation primers D14-D102A-F and D14-D102A are used to perform PCR with the D14-221 vector as a template. The length of the point mutation primers is generally between 30-50 bp. The primers are centered on the base region to be mutated, with some of the sequences on both sides added, generally between 12-20 bp.
[0030] The primer sequences for D14-D102A-F and D14-D102A are as follows: D14-D102A-F: CTCTACGCGCTCGTCTGCGCCGGCAGCGTC; D14-D102A-R:GACGAGCGCGTAGAGCACGACGCGGTGGTC; Specifically, the primer sequence extending towards the point mutation site should be longer, and there needs to be a reverse complementary region between the upstream and downstream primers. The product is then utilized... Dpn The plasmid was digested with an enzyme I restriction enzyme, and then re-transformed into *E. coli* strain DH5α for amplification and sequencing. Using plasmids 221-D14 and 221-D14(D102A) as templates, the resulting plasmids were amplified using the following primers with adapters containing restriction sites. BamH I and Sal I restriction enzyme cleavage site linker D14 and D14 (D102A) The PCR products contain the following primers: GST-D14-FggggcccctgggatccATGCTGCGATCGACGCATCCG GST-D14-RggccgctcgagtcgacTTAGTACCGGGCGAGAGCGCG Based on the above, it is fused into the target through homologous recombination. BamH I and Sal I double enzyme digestion pGEX-6P GST-D14 and GST-D14(D102A) vectors were obtained on the vector. Figure 3 As shown, the MST experiment and the Pull-down experiment demonstrate that D14 (D102A) cannot interact with P3.
[0031] Example 3: Base Editing of Rice D14 Gene (1) When the CBE system is working, the fusion protein targets the genomic DNA under the guidance of sgRNA. The nCas9 protein causes local DNA unwinding. Cytidine deaminase binds to ssDNA in the R-loop complex that is not bound to sgRNA, deaminating a certain region of cytosine (C) into uracil (U). Then, through the DNA replication mechanism, uracil (U) is replaced by thymine (T), ultimately achieving the replacement of GC to AT. Example 2 shows that the D102 amino acid of D14 is the key site for the binding of P3 to D14. Based on the working principle of the CBE system, a sequence containing the D102 site on the D14 genome was selected, and the target sequence was designed as 5'-CGAGGTCGTAGAGCACGACG-3' based on the PAM site. The primers designed for building the CBE system using the website http: / / skl.scau.edu.cn / home / are as follows: UF: CTCCGTTTTACCTGTGGAATCG, gRNA-R: CGGAGGAAAATTCCATCCAC D14-U3T1: 5'-CGAGGTCGTAGAGCACGACGgttttagagctagaaat-3' D14-gRT1: 5'-CGTCGTGCTCTACGACCTCGTgccacggatcatctgc-3' B1':TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG, BL: AGCGTGggtctcGaccgGGTCCATCCACTCCAAGCTC (2) Using the intermediate vectors U3 and U6 as templates, the target gRNA expression cassette sequence was obtained by two rounds of PCR amplification using three pairs of primers: UF / D14-U3T1, D14-gRT1 / gRNA-R, and B1' / BL.
[0032] (3) The expression cassette sequence and CBE vector were processed by restriction endonuclease. Bsa I is digested and then ligated using T4 ligase.
[0033] (4) The ligation product was transferred into Escherichia coli strain DH5α, coated on a medium containing kanamycin resistance to obtain transformants, the plasmid of the transformants was extracted, and the positive transformants with correct sequencing were the final recombinant vectors, named CBE-D14.
[0034] Example 4: Agronomic Trait Analysis of D14 (D102N) Rice (1) The CBE-D14 vector was sent to Wuhan Boyuan Biotechnology Co., Ltd. for genetic transformation to obtain transgenic rice with D14 point mutation.
[0035] (2) DNA was extracted from the D14 point mutant rice using a plant genomic DNA extraction kit (Tiangen Biotech Co., Ltd., catalog number: DP350). Amplification and sequencing were performed using identification primers, and two independent lines were identified through sequence alignment. The sequences of the identification primers are as follows: D14(D102N)-genotyping-F:GAAGCGAGGCAAGAGTCAAGACCATCTCCC D14(D102N)-genotyping-R:GTTGAAGAGGGTGCGGCTGAACTCCTGCAC The results are as follows Figure 4 As shown in A, D14The amino acid sequence of the mutant protein is shown as SEQ ID NO:1, and its corresponding coding gene is shown as SEQ ID NO:2. The change of guanine (G) at position 304 in the forward chain to adenine (A) causes the change of aspartic acid (D) at position 102 to asparagine (N).
[0036] (3) Agronomic trait analysis of homozygous lines, such as Figure 4 As shown in B, the agronomic traits of D14 (D102N) rice, including plant height, tillering, and grain size, are consistent with the ZH11 phenotype, indicating that the mutation of D102 does not affect the function of D14.
[0037] Example 5: Creation and evaluation of RGSV-resistant rice germplasm Homozygous D14 point mutant lines were cultured in a sunny greenhouse for 14 days. RGSV virus strains were identified beforehand, removed from the soil, and their roots were rinsed. Some soil was left on the roots, which were then wrapped in moist soil and placed in boxes with a mesh cage placed on the side to facilitate climbing and feeding by young nymphs. A suitable number of 2nd-3rd instar brown planthopper nymphs were fed the virus onto the virus strains for 3 days. The remaining brown planthoppers were removed from the RGSV virus strains and transferred to prepared healthy rice seedlings, cycling for 7 days to enable the brown planthoppers to transmit the virus. Brown planthoppers were then transferred to the seedlings to be inoculated at a ratio of 1:2 (seedlings to virus-carrying brown planthoppers) for 3 days. The inoculated rice was transplanted to the field, and symptoms were observed, disease incidence was recorded, and virus accumulation and gene expression levels were measured. The results showed that the RGSV disease phenotype of the D14 (D102N) material was significantly weakened. Figure 5 The incidence rate and virus accumulation levels were significantly lower in the control group. This result confirms the important role of this mutation site in rice resistance to RGSV, and the D102 mutation in D14 enhances rice resistance to RGSV without affecting rice yield.
[0038] The above description is only a part of the embodiments of the present invention and does not limit the scope of protection of the present invention. Any equivalent device or equivalent process transformation made based on the content of the present invention specification and drawings, or direct or indirect application in other related technical fields, are similarly included within the patent protection scope of the present invention.
Claims
1. A mutant protein that enhances resistance to rice straw dwarf virus, characterized in that, Its amino acid sequence is shown in SEQ ID NO:
1.
2. The mutant protein that enhances resistance to rice straw dwarf virus according to claim 1, characterized in that, The mutant protein is the D14 protein encoded by the D14 gene of rice plants, which has a mutation at the 102nd amino acid position, changing from aspartic acid (Asp, D) to asparagine (Asn, N), i.e., the D14 (D102N) mutation.
3. A gene encoding the mutant protein of claim 1, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:
2.
4. A rice plant with enhanced resistance to rice straw dwarf virus, characterized in that, The D14 protein encoded by the D14 gene in the rice plant undergoes a mutation at amino acid position 102, changing from aspartic acid (Asp, D) to asparagine (Asn, N), i.e., the D14 (D102N) mutation.
5. The rice plant according to claim 4, characterized in that, The rice plant's D14 gene underwent a single base substitution mutation, that is, GAC was changed to AAC.
6. The rice plant according to claim 4 or 5, characterized in that, The mutations in the rice plants were obtained through base editing technology, and the base editing system included a cytosine base editor (CBE).
7. The rice plant according to any one of claims 4-6, characterized in that, It was obtained without a transgenic backbone sequence, thus it is a non-transgenic rice material; The rice plants inoculated with RGSV virus showed a weaker disease phenotype and lower virus accumulation than wild-type rice, and there were no significant differences in major agronomic traits compared with wild-type rice.
8. A type of rice seed, characterized in that, It is derived from the rice plant of any one of claims 4-7 or contains the gene described in claim 3.
9. A method for breeding rice varieties to enhance resistance to RGSV, characterized in that, It includes the following steps: (1) Design a base editing system targeting site 102 of the rice D14 gene; (2) The editing system was introduced into rice cells to induce mutations and obtain D14 (D102N) plants; (3) Screening for homozygous mutant offspring without edited backbones; (4) Evaluate its disease resistance and agronomic traits to obtain the target germplasm.