Plant pollen development related protein OsBW as well as coding gene and application thereof

Abstract

The invention discloses a plant pollen wall development related protein as well as a coding gene and application thereof. The protein provided by the invention is a protein composed of an amino acid sequence as shown in SEQ ID NO. 1. The plant pollen development related protein provided by the invention affects the male gametophyte development process of plants. The inhibition of the expression of the protein coding gene can lead to abnormal development of plant male gametophytes and influence the formation of grains, so that transgenic plants with abnormal pollen wall development and male sterile transgenic plants can be cultivated. When the coding gene of the protein is introduced into a male sterile plant, a plant with normally developed male gametophyte can be cultivated. The protein and the coding gene thereof can be applied to plant genetic improvement.

Description

Technical Field

[0001] This invention relates to a plant pollen development-related protein OsBW, its encoding gene, and its applications. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, feeding nearly half the world's population and holding a vital position among food crops. Faced with increasing population pressure and decreasing arable land, increasing rice yield is particularly important. The three-line hybrid rice method is a classic approach, but its drawbacks include constraints imposed by the restorer relationship, limited pairing freedom, and low utilization of heterosis; while the two-line method is greatly affected by external environmental factors such as temperature and light. With the rapid development of biotechnology, a third-generation hybrid rice seed production system composed of ordinary recessive male-sterile lines and engineered breeding lines has added a new avenue for increasing grain yield. Ordinary recessive male-sterile materials are sterile under any environment, exhibiting complete abortion and simple genetics, making them an ideal genetic tool for utilizing heterosis in crops. Third-generation hybrid rice not only overcomes the limitations of three-line male-sterile lines in pairing and the potential instability of fertility in two-line male-sterile lines due to climatic anomalies, but also combines the advantages of stable fertility in three-line male-sterile lines and the free pairing freedom in two-line male-sterile lines. The recessive nuclear male sterility gene and the sterile lines generated by mutations in this gene provide the components and theoretical basis for the research and development of third-generation hybrid rice seed production. Therefore, the creation of stable recessive nuclear male sterile lines is of great significance to the development of hybrid rice.

[0003] The development of male and female gametophytes is fundamental to the alternation of generations in plants. Damage to the pollen wall structure often leads to pollen abortion and consequently male sterility. Structurally, the pollen wall mainly consists of three layers: the pollen sheath, the exine, and the inner wall. Sporophytin, composed of long-chain fatty acids and phenylpropanoid derivatives, is an important component of the pollen exine. The F375 mutant involved in this patent application exhibits abnormal pollen exine development. The mutant protein OsBW belongs to the STRL (Strictosidine synthase-like) family, and its biological function has not yet been reported. Summary of the Invention

[0005] The purpose of this invention is to provide a plant pollen development-related protein OsBW, its encoding gene, and its applications.

[0006] The pollen development-related protein (OsBW) provided by this invention is derived from rice (Oryza sativa var. Ningjing 4) and is a protein as shown in (a) or (b):

[0007] (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1;

[0008] (b) A protein derived from SEQ ID NO.1 that is associated with plant pollen development and is modified by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of SEQ ID NO.1.

[0009] SEQ ID NO.1 consists of 480 amino acid residues, with the STRL domain located from position 266 to 353 from the amino terminus.

[0010] To facilitate the purification of OsBW in (a), a tag as shown in Table 1 can be attached to the amino or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO.1.

[0011] Table 1: Label Sequence

[0012] Label amino acid residues sequence Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK

[0013] The OsBW in (b) above can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically. The encoding gene of OsBW in (b) above can be obtained by deleting one or more amino acid residues from the codons in the DNA sequence shown in SEQ ID NO.2, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.

[0014] The gene OsBW, which encodes the aforementioned plant pollen development-related proteins, also falls within the scope of protection of this invention.

[0015] The gene may be a DNA molecule as follows: 1) or 2) or 3) or 4):

[0016] 1) CDS of the OsBW shown in SEQ ID NO.2;

[0017] 2) Genomic DNA of OsBW as shown in SEQ ID NO.3;

[0018] 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein;

[0019] 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant pollen development.

[0020] SEQ ID NO.2 consists of 1443 nucleotides and is the CDS of the OsBW gene.

[0021] Recombinant expression vectors containing any of the genes described above.

[0022] Recombinant expression vectors containing the gene can be constructed using existing plant expression vectors.

[0023] The plant expression vector includes binary Agrobacterium vectors or vectors that can be used for plant microbombardment. The plant expression vector may also contain the 3' untranslated region of a foreign gene, i.e., containing a polyadenylated signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylated signal can guide the addition of polyadenylated acid to the 3' end of the mRNA precursor; similar functions exist in the untranslated regions transcribed at the 3' end of Agrobacterium crown gall tumor-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthase) and plant genes (such as the soybean storage protein gene).

[0024] When constructing recombinant plant expression vectors using the aforementioned genes, any type of enhancing promoter or constitutive promoter, such as the cauliflower mosaic virus (CAMV) 35S promoter or the maize ubiquitin promoter, can be added before the transcription initiation nucleotide. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0025] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS gene, green fluorescent protein gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).

[0026] The recombinant expression vector is preferably a recombinant plasmid obtained by inserting the gene OsBW into the recombinant site BamHI of the pCAMBIA1305.1 vector, and named pCAMBIA1305.1-OsBW.

[0027] Expression cassettes, transgenic cell lines, and recombinant bacteria containing any of the genes (OsBW) mentioned above.

[0028] Primer pairs that amplify the full length or any fragment of the gene (OsBW) are also within the scope of protection of this invention.

[0029] This invention provides a male-sterile mutant sequence of the OsBW gene and a mutant material that causes male sterility. Specifically, the male-sterile mutant material is generated by mutating the endogenous OsBW gene in rice, or by mutating the nucleotide sequence of a highly homologous gene, thereby rendering the plant incapable of male reproduction. Mutation methods include, but are not limited to, gene mutations induced by physical or chemical methods, wherein chemical methods include mutagenesis using mutagens such as EMS. These mutations can be base substitutions, insertions or deletions of DNA fragments, and can also be generated through genetic engineering techniques such as RNAi and CRISPR. Recipients for creating male-sterile materials include all currently known rice varieties.

[0030] The application of the gene OsBW described in this invention in regulating the development of male gametes in plants.

[0031] Inhibiting the OsBW gene described in this invention can lead to abnormal development of male gametophytes in plants and affect seed formation. Introducing the gene encoding this protein into plants with male sterility caused by this gene mutation can cultivate plants with normally developing male gametophytes.

[0032] A method for restoring the fertility of male gametes in plants.

[0033] The method for restoring the fertility of male gametophytes in plants provided by this invention involves introducing the OsBW gene into male-sterile plants to obtain transgenic plants with normal male gametophyte development. The male-sterile plants are those with abnormal pollen wall development that do not produce seeds. The transgenic plants with normal male gametophyte development are those whose male gametophyte development is equivalent to that of the normal type. Specifically, the gene is introduced into male-sterile plants using the recombinant expression vector; the male-sterile plant is designated F375.

[0034] The protein, the gene, the recombinant expression vector, the expression cassette, the transgenic cell line or recombinant bacteria, or the method can all be applied to rice breeding.

[0035] By using any vector capable of guiding the expression of exogenous genes in plants, the gene encoding the stated protein can be introduced into plant cells to obtain transgenic cell lines and transgenic plants. The expression vector carrying the stated gene can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The plant host being transformed can be either monocotyledonous or dicotyledonous, such as tobacco, birdsfoot, Arabidopsis, rice, wheat, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.

[0036] Beneficial effects:

[0037] This invention is the first to discover, locate, and clone a novel gene, OsBW, for a plant pollen wall development-related protein. This pollen wall development-related protein affects the development of male gametophytes in plants. Inhibiting the expression of the gene encoding this protein leads to abnormal development of male gametophytes and affects seed formation, thereby enabling the cultivation of transgenic plants with abnormal pollen wall development and male-sterile transgenic plants. Introducing the gene encoding this protein into male-sterile plants can cultivate plants with normally developing male gametophytes. This protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description

[0038] Figure 1 Phenotypic comparison of wild-type Ningjing 4 and mutant F375 plants.

[0039] Figure 2 Comparison of anther and pollen morphology between wild-type Ningjing 4 and mutant F375.

[0040] Figure 3 Comparison of semi-thin sections of developing anthers from wild-type Ningjing 4 and mutant F375.

[0041] Figure 4 Comparison of the ultrafine structure of developing anthers in wild-type Ningjing 4 and mutant F375.

[0042] Figure 5 This is a schematic diagram for precise positioning.

[0043] Figure 6 This is a schematic diagram of the OsBW gene, showing the mutation form in F375.

[0044] Figure 7 Results of PCR molecular detection of transgenic plants.

[0045] Figure 8 Observation of anther and pollen morphology in replanted plants of F375 transformed with pCAMBIA1305.1-OsBW.

[0046] Figure 9 Sequencing revealed mutation sites in CR-osbw-1 and CR-osbw-2.

[0047] Figure 10 The anther and pollen morphology of CR-osbw-1 and CR-osbw-2 indicate that they are sterile. Detailed Implementation

[0048] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0049] Example 1: Discovery of plant pollen wall development-related proteins and their encoding genes

[0050] I. Phenotypic observation and genetic analysis of mature male gametophytes of the rice male-sterile mutant OsBW

[0051] In the mutant library of the japonica rice variety Ningjing 4 (from the research group of Bao Yiqun at Nanjing Agricultural University), a line with abnormal pollen development and failure to set fruit was screened through natural planting in the field and named F375.

[0052] Compared with the wild-type Ningjing 4, the main characteristic of F375 is that it does not form any grains at maturity. Figure 1 The anthers are small and whitish. Figure 2 A: Wild-type anthers, Figure 2 B: F375 anther abnormality), pollen shriveled and lacking starch filling ( Figure 2 C: Wild-type pollen can be stained with iodine normally. Figure 2 D: F375 pollen abortion).

[0053] Observation of semi-thin sections of developing anthers revealed that abnormal pollen development in F375 began in the late stage 10. Figure 3 The exine of F375 pollen was significantly thinner than that of the wild type under transmission electron microscopy. Figure 4 A: wild type pollen wall, Figure 4 B: The pollen wall of F375 is thinner, and the tapetum cells are highly fragmented. Figure 4 C: The tapetum layer that begins to degrade in the wild type. Figure 4 D: The internal structure of the tapetum cells of F375 has been degraded into fragments. Therefore, it is inferred that F375 affects the normal development of the pollen exine, ultimately leading to male sterility.

[0054] II. Mutant Gene Location

[0055] 1. Preliminary localization of the mutated gene

[0056] Artificial pollination of F375 plants was performed using pollen from Ningjing 4, and all F1 plants produced normal fruit set. After self-pollination of F1 plants, the number of normally fruiting plants and male-sterile plants in the F2 generation population met a segregation ratio of 3:1. Therefore, the male-sterile phenotype in F375 is controlled by a single recessive nuclear gene.

[0057] The mutant F375 was crossed with the indica rice variety Dular (from the germplasm resource bank of the Rice Research Institute of Nanjing Agricultural University). Ten extreme individuals were selected from the F2 generation of the F375 / Dular population. Genomic DNA was extracted from the leaves of each plant. Linkage analysis was performed on the 10 individual plants using 565 pairs of SSR primers covering the entire rice genome. The pollen wall development-related gene OsBW was located on chromosome 3 between markers C3-26 and C3-27.

[0058] The method for SSR marker analysis described above is as follows:

[0059] 1. Extract total DNA from the selected single plants as a template, using the following method:

[0060] (1) Take about 0.2g of tender rice leaves, place them in an Eppendorf tube, put a steel ball in the tube, freeze the Eppendorf tube containing the sample in liquid nitrogen for 5 minutes, and then crush the sample for 1 minute on a GENO / GRINDER instrument of type 2000.

[0061] (2) Add 660 μL of extraction buffer (a solution containing 100 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, and 0.2 g / ml CTAB), vortex vigorously on a vortex mixer, and incubate on ice for 30 min.

[0062] (3) Add 40 μL of 20% SDS, incubate at 65°C for 10 min, and gently invert the container every 2 min to mix.

[0063] (4) Add 100 μL of 5M NaCl and mix gently;

[0064] (5) Add 100 μL of 10×CTAB, incubate at 65℃ for 10 min, and gently invert the container intermittently to mix.

[0065] (6) Add 900 μL of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 3 min;

[0066] (7) Transfer the supernatant to a 1.5 mL Eppendorf tube, add 600 μL of isopropanol, mix well, and centrifuge at 12000 rpm for 5 min.

[0067] (8) Discard the supernatant, rinse the precipitate once with 70% (v / v) ethanol, and air dry at room temperature;

[0068] (9) Add 100 μL of 1×TE (121 g Tris dissolved in 1 L of water, and the pH was adjusted to 8.0 with hydrochloric acid) to dissolve the DNA;

[0069] (10) Take 2 μL of DNA for electrophoresis to detect DNA quality and use a DU800 spectrophotometer to determine the concentration (Bechman Instrument Inc. USA).

[0070] 2. Dilute the extracted DNA to approximately 20 ng / μL and use it as a template for PCR amplification;

[0071] PCR reaction system (10 μL): DNA 1 μL (20 ng / μL), upstream primer 1 μL (2 pmol / μL), downstream primer 1 μL (2 pmol / μL), 1 μL 10x Buffer (MgCl2 free), 0.2 μL dNTP (10 mM), 0.6 μL MgCl2 (25 mM), 0.1 μL rTaq (5 U / μL), 5.1 μL ddH2O, total 10 μL.

[0072] PCR reaction program: denaturation at 94.0℃ for 5 min; denaturation at 94.0℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 7 min; storage at 10℃. PCR reactions were performed in an MJ Research PTC-225 thermal cycler.

[0073] (3) Detection of SSR-labeled PCR products

[0074] The amplification products were analyzed by 8% non-denaturing polyacrylamide gel electrophoresis. A 50 bp DNA ladder was used as a control to compare the molecular weight of the amplification products, and silver staining was performed for color development.

[0075] 2. Fine mapping of mutated genes

[0076] Based on the preliminary localization results, molecular markers on public maps were searched for near the region where the mutant gene was located, and SSR markers were developed in-house. The results were validated using sterile plants from the F2 population, and more markers were screened in relevant segments of the chromosome to further locate the mutant gene. 566 male-sterile extreme plants were selected from the F2 segregating population derived from F375 / Dular (for fine localization of the mutant gene). The mutant gene was finely localized using molecular markers on public maps and SSR molecular markers developed in-house based on rice genome sequence data. The mutant gene was preliminarily identified based on the localization results. The specific methods are as follows:

[0077] SSR markers from public maps were integrated with rice genome sequences, and BAC / PAC clone sequences near mutation sites were downloaded. Potential SSR sequences (repeat count ≥ 6) in clones were searched using SSR Hunter (Li Qiang et al., Genetics, 2005, 27(5):808-810) or SSRIT software. These SSRs and their adjacent 400–500 bp sequences were compared online with corresponding indica rice sequences using the BLAST program on NCBI. If there was a difference in the number of SSR repeats, it was preliminarily inferred that the PCR product of the SSR primers exhibited polymorphism between indica and japonica rice. SSR primers were then designed using Primer Premier 5.0 software and synthesized by Shanghai Yingjun Biotechnology Co., Ltd. The designed SSR primer pairs were mixed in equal proportions, and their polymorphism between F375 and Dular was detected. Polymorphic primers were used as molecular markers for fine mapping of the OSBW gene. Molecular markers used for fine mapping are shown in Table 2.

[0078] Table 2 Molecular markers used for fine localization

[0079]

[0080]

[0081] Ultimately, the OSBW gene was finely mapped to the area between markers C3-26-9 and C3-26-9.4. These two markers are located on the same BAC clone, OsJNBa0047E24, with a physical distance of approximately 61 kb. Figure 5 ).

[0082] (3) Acquisition of mutant genes

[0083] Sequencing of the 61kb region revealed a single-base mutation in the Osbw gene of F375 compared to that in Ningjing 4. Figure 6 ),

[0084] Primers were designed based on sequences published online, as follows:

[0085] Primer 1: 5'ATGCGGACGGGGAGCATGGTG 3';

[0086] Primer 2: 5'AGATGCATTGGCGTAATCGAA 3'.

[0087] Using Primer 1 and Primer 2 as primers and cDNA from the developing anthers of Ningjing 4 as a template, PCR amplification was performed to obtain the target gene. The amplification reaction was conducted on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 s, 60℃ for 45 s, 72℃ for 10 min, 35 cycles; 72℃ for 5 min. The PCR product was recovered, purified, and ligated into pMD18-T (Takara, Japan), transformed into *E. coli* DH5α competent cells (Tiangen CB101, Beijing), and positive clones were selected for sequencing.

[0088] Sequencing results showed that the fragment obtained by PCR had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 480 amino acid residues (see SEQ ID NO.1 in the sequence listing). The protein shown in SEQ ID NO.1 was named OsBW, and the gene encoding the protein shown in SEQ ID NO.1 was named OsBW (i.e., the OSBW gene described in the gene mapping).

[0089] Example 2: Obtaining and Identifying Transgenic Plants

[0090] I. Construction of Recombinant Expression Vectors

[0091] Using genomic DNA from Ningjing 4 (from the germplasm resource bank of the Rice Research Institute of Nanjing Agricultural University) as a template, the OsBW gene was obtained by PCR amplification. The PCR primer sequences are as follows:

[0092] Primer 3:

[0093] 5'CATGATTACGAATTCGAGCTCGGGCCCTCGTCTGTATACATGC 3'

[0094] Primer 4:

[0095] 5'CGGGCGGCCGCTTTAAGATCTCGTAGACACACGAGAATCCATACGTC 3'

[0096] The primers described above are located 2.5 kb upstream and 1.5 kb downstream of the gene shown in SEQ ID NO.2. The amplification product contains the promoter portion of this gene. The PCR product was recovered and purified. The PCR product was inserted into the SacI and BglII restriction sites of the vector pCAMBIA1305.1 using the INFUSION recombination kit (Takara Corporation, Japan).

[0097] The recombinant reaction system (10 μL) consisted of: 1.0 μL PCR product, 6.0 μL pCAMBIA1305.1, 2.0 μL 5× infusion buffer, and 1 μL infusion enzyme mix. After brief centrifugation, the mixture was incubated at 37°C for 15 min, followed by incubation at 50°C for 15 min. 2.5 μL of the reaction mixture was then used to transform *E. coli* DH5α competent cells (Beijing Tiangen Biotech Co., Ltd.; CB101) using the heat shock method. All transformed cells were evenly spread on LB agar containing 50 mg / L kanamycin. After incubation at 37°C for 16 h, positive clones were picked and sequenced. Sequencing results showed that a recombinant expression vector containing the gene shown in SEQ ID NO.3 was obtained. pCAMBIA1305.1 containing OsBW was named pCAMBIA1305.1-OsBW, and the OsBW gene fragment was located between the SacI and BglII restriction sites of this vector.

[0098] II. Obtaining Recombinant Agrobacterium

[0099] pCAMBIA1305.1-OsBW was transformed into Agrobacterium EHA105 strain (purchased from Ingenium Biotech, USA) using an electroporation method to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strain that was correctly identified by PCR and enzyme digestion was named EH-pCAMBIA1305.1-OsBW.

[0100] III. Obtaining Transgenic Plants

[0101] The EH-pCAMBIA1305.1-OsBW was transformed into the rice male-sterile mutant F375. The specific method was as follows:

[0102] (1) EH-pCAMBIA1305.1-OsBW was cultured at 28℃ for 16h, the bacterial cells were collected, and diluted in N6 liquid medium (Sigma, C1416) to a concentration of OD. 600 ≈0.5, to obtain bacterial culture;

[0103] (2) Mix the F375 rice mature embryo embryonic callus cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0104] (3) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (16 days).

[0105] (4) Select healthy callus and transfer it to N6 solid selection medium containing 100 mg / L hygromycin for a second selection. Subculture every 15 days.

[0106] (5) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for the third selection, and subculture every 15 days.

[0107] (6) Select resistant callus and transfer it to differentiation medium for differentiation;

[0108] T0 generation positive plants that differentiated into seedlings were obtained.

[0109] IV. Identification of Transgenic Plants

[0110] 1. PCR molecular identification

[0111] In this study, dCAPS markers were used to identify transgenic plants. Primer design: Based on the differences between F375 and Ningjing 4 in SEQ ID NO.1, mismatched PCR primers were designed using "dCAPS Finder 2.0" software to create restriction enzyme sites. Simultaneously, a corresponding primer was designed using Primer 5.0 software. The primer sequences are as follows:

[0112] Primer 5:

[0113] 5'CTTGCTCAGCCTCCCAATCCCTG 3'

[0114] Primer 6:

[0115] 5'TGGTATCCTCCAAGATGTCAAGCACCTGG 3'

[0116] PCR reaction system for dCAPS labeling analysis: DNA (20 ng / μL) 2 μL, Primer 5 (10 pmol / μL) 2 μL, Primer 6 (10 pmol / μL) 2 μL, 10x Buffer (MgCl2 free) 2 μL, dNTP (10 mM) 0.4 μL, MgCl2 (25 mM) 1.2 μL, rTaq (5 U / μL) 0.4 μL, ddH2O 10 μL, total volume 20 μL.

[0117] The amplification reaction was performed on a PTC-200 (MJ Research Inc.) PCR instrument: 94℃ for 3 min; 94℃ for 30 s, 55℃ (adjusted according to different primers) for 45 s, 72℃ for 2.5 min, 35 cycles; 72℃ for 5 min.

[0118] The PCR products were purified and recovered according to the kit (Beijing Tiangen) instructions. After overnight digestion with HaeIII (Takara, Japan), the PCR products were detected by 4% agarose gel electrophoresis.

[0119] The results showed that 6 plants were positive for PCR testing. Figure 7 Lane 1 represents the F375 mutant, lane 2 represents Ningjing 4, and lanes 3-8 represent six transgenic pCAMBIA1305.1-OsBW plants obtained through transformation. The F375 band is 120 bp, while the wild-type, due to the introduction of restriction enzyme sites, yields a 100 bp fragment after enzyme digestion. The six transgenic lines, containing both the F375 background fragment and the introduced Ningjing 4 fragment, exhibit heterozygous bands, displaying both 100 bp and 120 bp electrophoretic bands.

[0120] 2. Phenotypic identification

[0121] T0 generation transformed pCAMBIA1305.1-OsBW plants, F375, and Ningjing 4 were planted at the Baima planting base of Nanjing Agricultural University. Ningjing 4 and pCAMBIA1305.1-OsBW plants were harvested separately. Figure 8 (L1, L2, and L3 are three independent transgenic lines) Anthers were observed during the flowering period, and pollen was stained with iodine. The anther morphology and color of the pCAMBIA1305.1-OsBW transgenic plants were restored to wild-type levels. Figure 8 A), and pollen can be normally iodized ( Figure 8 B). Therefore, the mutant phenotype of F375 is caused by the OsBW mutation. pCAMBIA1305.1-OsBW can restore the male fertility of the F375 line to normal levels.

[0122] Example 3: Obtaining and Identifying Osbw CRISPR / Cas9 Transgenic Plants

[0123] I. Construction of Knockout Expression Vectors

[0124] The CRISPR website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR) was used to screen for highly specific exon sequences of the OsBW gene as targets. These target sequences were then cloned into TKC-sgRNA, and the CR-OsBW knockout vector was obtained through sequencing. The process is as follows:

[0125] (1) Primers were synthesized based on the target sequence, the sequence of which is as follows:

[0126] Primer 7:

[0127] 5'GGCACATTGTCTGGAAACCCAGGC 3';

[0128] Primer 8:

[0129] 5'AAACGCCTGGGTTTCCAGACAATG 3'.

[0130] (2) Dissolve the above primer sequences in 1×TE to prepare a 100μM stock solution. Use primer7 and primer8 as the front and back primers respectively, and add 1μL of each to 98μL of 0.5×TE solution to mix and dilute to 1μM.

[0131] (3) Hold at 95℃ for 3 minutes, then move to room temperature to cool and complete the annealing.

[0132] (4) The enzyme digestion and ligation system (Thermo Scientific) is as follows:

[0133]

[0134]

[0135] The reaction program was as follows: incubation at 37℃ for 5 min, followed by incubation at 20℃ for 5 min. These two conditions were maintained for 10 cycles. The amplification reaction was performed using a BIO-RAD T100 thermal cycler. The product was transformed into *E. coli* DH5α competent cells (Beijing Tiangen CB101), and positive clones were selected for sequencing. Sequencing results showed that the obtained fragment was an OsBW knockout vector containing target sequence 4, named pTKC-OsBW.

[0136] 2. Obtaining recombinant Agrobacterium

[0137] The pTKC-OsBW strain was transformed into Agrobacterium tumefaciens strain EHA105 (purchased from Ingenium Biotech, USA) using the freeze-thaw method to obtain a recombinant strain. Plasmids were extracted and identified by PCR and enzyme digestion. The recombinant strains that were correctly identified by PCR and enzyme digestion were named EH-pTKC-OsBW.

[0138] 3. Obtaining transgenic plants

[0139] The EH-pTKC-OsBW strain was transformed into Ningjing No. 4, and the specific method was as follows:

[0140] (1) Incubate EH-pTKC-OsBW strain at 28℃ for 16 hours, collect the bacterial cells, and dilute them in N6 liquid medium (Sigma, C1416) to a concentration of OD200. 600 ≈0.5, to obtain bacterial culture;

[0141] (2) Mix the embryogenic callus of Ningjing No. 4 rice mature embryos cultured for one month with the bacterial solution in step (1) and infect for 30 min. After the bacterial solution is dried with filter paper, transfer it to co-culture medium (N6 solid co-culture medium, Sigma) and co-culture at 24℃ for 3 days.

[0142] (3) The callus from step (2) was inoculated onto N6 solid screening medium containing 100 mg / L hygromycin for the first screening (15 days).

[0143] (4) Select healthy callus and transfer them to N6 solid selection medium containing 100 mg / L hygromycin for a second selection (15 days);

[0144] (5) Select healthy callus and transfer them to N6 solid selection medium containing 50 mg / L hygromycin for a third selection (15 days);

[0145] (6) Select resistant callus and transfer it to differentiation medium for differentiation; obtain T0 generation positive plants that have differentiated into seedlings.

[0146] 4. Identification of transgenic plants

[0147] (1) DNA extraction, the specific method is as follows:

[0148] ① Take about 0.2g of tender rice leaves and place them in an Eppendorf tube. Place a steel ball in the tube and freeze the Eppendorf tube containing the sample in liquid nitrogen for 5 minutes. Then, place the tube on a GENO / GRINDER 2000 instrument to crush the sample for 1 minute.

[0149] ② Add 660 μl of extraction buffer (a solution containing 100 mM Tris-HCl (pH 8.0), 20 mM EDTA (pH 8.0), 1.4 M NaCl, and 0.2 g / ml CTAB), vortex vigorously to mix, and incubate on ice for 30 min.

[0150] ③ Add 40 μl of 20% SDS, incubate at 65°C for 10 min, and gently invert the container every two minutes to mix.

[0151] ④ Add 100 μl of 5M NaCl and mix gently.

[0152] ⑤ Add 100 μl of 10×CTAB, incubate at 65℃ for 10 min, and gently invert intermittently to mix.

[0153] ⑥ Add 900 μl of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 3 min.

[0154] ⑦ Transfer the supernatant to a 1.5 mL Eppendorf tube, add 600 μl of isopropanol, mix well, and centrifuge at 12000 rpm for 5 min.

[0155] ⑧ Discard the supernatant, rinse the precipitate once with 70% (volume percentage) ethanol, and let it air dry at room temperature.

[0156] ⑨ Add 100 μl of 1×TE (a solution obtained by dissolving 121 g of Tris in 1 L of water and adjusting the pH to 8.0 with hydrochloric acid) to dissolve the DNA.

[0157] ⑩ Take 2 μl of DNA for electrophoresis to detect DNA quality, and determine the concentration using a micro spectrophotometer (Thermo).

[0158] (2) PCR molecular identification

[0159] ① Primer design: Primers Primer 9 and Primer 10 were designed using Primer Premier 5.0 software to verify the successful knockout of transgenic plants. The primer sequences are as follows:

[0160] Primer 9:

[0161] 5'CATGCAATTGGTTTTCTCTGGAG 3';

[0162] Primer 10:

[0163] 5'CTAAGATGCATTGGCGTAATCGA 3'.

[0164] ② Dilute the extracted DNA to approximately 20 ng / μL and perform PCR amplification using Primer 9 and Primer 10:

[0165]

[0166]

[0167] PCR reaction conditions: pre-denaturation at 95℃ for 5 min, followed by 35 amplification cycles (denaturation at 95℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s), extension at 72℃ for 5 min, and sample storage at 4℃. The PCR reaction was performed in a BIO-RAD T100 thermal cycler.

[0168] The PCR products were purified and recovered, and the procedure was performed according to the kit (Beijing Tiangen Company). The purified products were sent to a biotechnology company for sequencing verification, and the homozygous mutant lines cr-osbw-1 and cr-osbw-2 with successful knockout were obtained. The genotype change of cr-osbw-1 was a single base T insertion, and the genotype change of cr-osbw-2 was a single base T deletion (see Figure 11).

[0169] 5. Phenotypic identification

[0170] The homozygous mutant line with successful knockout, F375, and Ningjing 4 were planted at the Baima Base of Nanjing Agricultural University. When the rice plants were about to flower, three florets of the same position on the main stem panicle of each plant were examined under a microscope with 1% I2-KI. Fertility was determined based on anther morphology and pollen staining results.

[0171] The pollen of Ningjing No. 4 showed normal iodine staining, while the anthers of the knockout mutant lines cr-osbw-1 and cr-osbw-2 were small and whitish. Figure 10 A), pollen is in a state of decay ( Figure 10 B) exhibits a phenotype similar to F375, further confirming that OsBW is a male sterility gene.

Claims

1. A pollen development related protein OsBW, characterized in that: It is a protein as described in (a) or (b) below: (a) A protein consisting of the amino acid sequence shown in SEQ ID NO.1; (b) A protein derived from SEQ ID NO.1 with one or more amino acid residues substituted and / or deleted and / or added, and which is associated with plant pollen wall development.

2. The gene OsBW encoding the protein of claim 1.

3. The gene OsBW according to claim 2, characterized by: The gene is a DNA molecule as described in 1) or 2) or 3) or 4) below: 1) The DNA molecule shown in SEQ ID NO.2; 2) The DNA molecule shown in SEQ ID NO.3; 3) A DNA molecule that hybridizes to the DNA sequence defined in 1) or 2) under stringent conditions and encodes the protein OsBW; 4) DNA molecules that have more than 90% homology with the DNA sequence defined in 1), 2), or 3) and encode proteins related to plant pollen development.

4. A recombinant expression vector, expression cassette, transgenic cell line, or recombinant bacteria containing the OsBW gene as described in claim 2 or 3.

5. The recombinant expression vector of claim 4, wherein: The recombinant expression vector is a recombinant plasmid obtained by inserting the gene OsBW described in claim 2 or 3 between the BamHI restriction sites of the pCAMBIA1305.1 vector.

6. The use of at least one of the protein of claim 1, the gene of claim 2 or 3, and the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria of claim 4 in plant breeding.

7. The use of at least one of the gene of claim 2 or 3, the recombinant expression vector, expression cassette, transgenic cell line or recombinant bacteria of claim 4 in regulating the development of male gametes in plants.

8. A method for restoring male gamete fertility in a plant, characterized by The gene described in claim 2 or 3 is introduced into a male-sterile plant to obtain a transgenic plant with normal male gametophyte development; the male-sterile plant is a plant with abnormal pollen wall development that does not produce seeds; the transgenic plant with normal male gametophyte development is a transgenic plant with male gametophyte development equivalent to the normal type.

9. The method of claim 8, wherein: The gene of claim 2 or 3 is introduced into male-sterile plants using the recombinant expression vector of claim 4 or 5.

10. A method for cultivating transgenic plants with abnormal male gametophyte development, comprising inhibiting the expression of the gene described in claim 2 or 3 in the target plant to obtain a male-sterile transgenic plant; wherein the target plant is a plant carrying the gene described in claim 2 or 3.

Images