Application of soybean GmCDC7 protein and coding gene thereof in regulation and control of soybean quality traits
By using CRISPR-Cas9 technology to target and edit the soybean GmCDC7 gene, the problem of insufficient genes regulating soybean quality traits has been solved, resulting in increased protein content and reduced oil content. This provides new germplasm resources and new materials for soybean variety improvement.
Patent Information
- Application Number
- CN202411451494.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2026-04-17
AI Technical Summary
Existing technologies have limited genes regulating soybean quality traits and a weak foundation in molecular research, making it difficult to effectively increase protein and oil content.
By using gene editing technology, especially CRISPR-Cas9 technology, the soybean GmCDC7 gene was targeted for editing, resulting in a significant increase in protein content and a significant decrease in oil content. The GmCDC7 gene was used to negatively regulate the protein content of soybean seeds and affect the oil content of the seeds.
It significantly increased the protein content and decreased the oil content of soybean seeds, revealing the biological function of the GmCDC7 gene in regulating soybean seed quality traits and providing new germplasm resources for genetic breeding.
Smart Images

Figure FT_1 
Figure FT_2
Abstract
Description
Technical Field
[0001] This invention belongs to the field of mutation or genetic engineering, specifically relating to the application of soybean GmCDC7 protein and its encoding gene in regulating soybean quality traits. Background Technology
[0002] Soybeans Glycine max As a staple and oilseed crop, soybeans are an important food ingredient and livestock resource for countries worldwide, holding a significant position in global food consumption. Soybeans are one of China's important food crops, with seeds rich in plant protein and fat, making them one of the most recommended foods by nutritionists among hundreds of natural foods. Soybeans have a wide range of uses; they can be eaten directly or processed into various soy products (such as tofu, soy milk, and dried tofu), extracted for soybean oil, brewed for soy sauce, and used to extract protein. Therefore, the quality of soybeans plays a decisive role in their economic value. Protein and oil content are the main factors determining the nutritional and economic value of soybeans. With the improvement of people's living standards and increased health awareness, the requirements for soybean quality are also becoming increasingly higher.
[0003] In recent years, significant progress has been made in the research of soybean quality traits such as oil and protein. Domestic and international scholars have successfully bred a number of new soybean varieties with high protein and high oil content through genetic analysis, gene mapping, and marker-assisted selection. Furthermore, researchers have successfully cloned several genes related to soybean oil content and verified the functions of these genes through genetic transformation and expression pattern analysis. For example, GmDOF4 (Wang et al., 2007) GmDOF11 (Wang et al., 2007) GmMYB73 Transcription factors such as (Liu et al., 2014) have been reported to increase seed oil content by regulating the expression of key enzyme genes in the fatty acid synthesis pathway; GmMFT Soybean seed traits are regulated by controlling the transport of sugars from the seed coat to the embryo and downstream fat synthesis, which in turn affects oil content (Mukherjee et al., 2023). GmSWEET10 This gene plays a key role in controlling soybean seed development and oil accumulation; knocking out or increasing the expression of this gene can significantly affect soybean seed weight, oil content and protein content (Wang et al., 2020). POWR1Genes regulate protein and oil content, influencing grain weight and field yield (Goettel et al., 2022). However, few genes are currently known to regulate soybean quality, and the molecular research foundation is weak. The molecular genetic basis and regulatory network of soybean quality remain unclear. Therefore, in-depth research on soybean quality traits, especially oil and protein content, and the discovery of new genes regulating soybean protein and oil content, will not only provide new genetic resources for high-quality soybean breeding but also have significant research implications for improving soybean quality and nutritional value. Summary of the Invention
[0004] The technical problem this application aims to solve is how to regulate the quality of plant seeds, especially soybeans.
[0005] To address the above problems, the present invention provides applications of biomaterials, which may be the application of the biomaterials in regulating plant grain traits and / or preparing products that regulate plant grain traits, or the application of the biomaterials in plant breeding and / or preparing plant breeding products.
[0006] The indicators for plant breeding include the grain traits. The purpose of plant breeding includes regulating the grain traits of plants.
[0007] The biological material is a protein, a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the content of the protein. The protein is GmCDC7, and is any one of the following: A1) The amino acid sequence is that of the protein shown in sequence 2. A2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in A1), which has more than 80% identity with the protein shown in A1) and can regulate plant seed weight and / or seed yield. A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0008] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0009] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0010] In the aforementioned proteins, the 80% or more identity can be at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0011] The amino acid sequence of the above protein is sequence 2 in the sequence listing, consisting of 943 amino acid residues, and it is named GmCDC7 protein or protein GmCDC7. Its encoding gene is... GmCDC7 Gene. Sequence 2 (SEQ ID No. 2) is as follows: MAESEFEPNRVHDLEEKSWHLLALLFRIGHAVYPQRLAAQCRLFAASPDFVCYVSTLPGSPLSVTDNGLVTPSVSAVFALGSFFSLRFSPPQTHRFRKRKLLFDSAEDGRERKRLAIRHGLREFSFQSFADAAEALMRSNFPVIKFESQNIGSGNFVFLLRIDKNEECSGCPMSNFEHRGANNDASTTMSNGEVSKSIIEVLTKKISIIKTSYLNCPKLVDKNRFMECNLFVVDPPCKEGIVNNLGIGKKIDYFDTFTHDCAEQNSIHHVDEDGIGKSNTCKDQPREPNEDDEVESGSKKGLIDSGTNRVKEDVAQRVNAALCGEALTNGLEQKNHVHAMNLEKESERNTGTKSTNKISNSSSTPKRPLKSSSILKGGQKNDLHPKSQILKESLVSNKFGNVPKNVDQRKNEQNLTARKQNHKENMAGNIATTTKVEKRAYPSFEAFTIEEEEGSGGYGTVYRAQRTTDGKRVAIKCPHTNAHKNHVNNERSMLERFGGKNYIIRYEGSFKNGNSDCFVLEHVHHDRPEVLKKEIDIVQLQWYGYCMFRALYCLHKEGVVHRDIKPGNFLFSRKLSKGYLIDFNLAMDLKQKHNIGSKSKPSHDAASNIVSFSSGSAPLVRDKNLGGSKSLTSNKRALADYKNYSELNRHVKQKDCTGPLKNCPDKAGGSFLRAQGTDGSGVTSAKDPSTRTASAERLREPLPSHGRKELISFVNTMKCANNSSTIGPSSQRKRVTAPSSKVDGKIFNITPMPLHSSTVGGGLMRSKGDGKKKEGSCVGTKGFRAPEVLLRSQHQGHKIDIWSAGVTLLYMVIGKTPFTGDPEQNIKEIVKLRGSEEFWEVAKLHDRELSFPVELLDDRYLQSWDLEGWCKIHTKRPEFLEQIPKSLFDLIDKCLTVNPRNRLSAEDVLRHEFFDSLHESLRKQRMLHRHRALRSDAAASRAI。
[0012] The above protein can be derived from soybeans.
[0013] In the above applications, the substance may be any of the following: C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein. C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) Recombinant microorganisms containing the gene described in C2), or recombinant microorganisms containing the expression cassette described in C3), or recombinant microorganisms containing the recombinant vector described in C4). C6) A transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4). C7) Transgenic plant tissue containing the gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4). C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).
[0014] The transgenic plant is a plant obtained through biological methods such as recombinant DNA technology in genetic engineering.
[0015] C1) The nucleic acid molecule is the target sequence 5'-CCCTCCGTCAGCGCCGTCTTCGC-3' that targets the protein-coding gene mentioned above. It is the 422nd to 444th bases of sequence 1 in the sequence listing and the 214th to 236th bases of sequence 3 in the sequence listing.
[0016] Furthermore, in the biological material, the recombinant microorganism (C5) can specifically be yeast, bacteria, algae, and fungi.
[0017] Furthermore, the recombinant microorganism may be Agrobacterium. Specifically, Agrobacterium is EHA105.
[0018] Furthermore, in the biological material, the plant tissue described in C7) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and / or anthers.
[0019] Furthermore, in the biological material, the transgenic plant organs described in C8) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.
[0020] In the above applications, the plant is any one of the following: D1) a dicotyledonous plant, D2) a Rosales plant, D3) a legume, D4) a soybean, D5) soybean.
[0021] The present invention also provides a method for regulating plant seed traits, the method including regulating the target plant seed traits by gene knockout.
[0022] The present invention also provides a method for cultivating plants with altered seed traits, comprising obtaining plants with altered seed traits by gene knockout, wherein the seed protein content of the plants with altered seed traits is significantly higher than that of the target plant, and the oil content is lower than that of the target plant; wherein the target plant contains the gene encoding the aforementioned protein.
[0023] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0024] The gene knockout includes introducing a gene knockout vector into the target plant with nucleotides 422 to 444 of sequence 1 (5'-CCCTCCGTCAGCGCCGTCTTCGC-3') as the target sequence.
[0025] In the above method, the genome of the target plant contains a DNA molecule with a nucleotide sequence that is sequence 3 in the sequence listing, and the gene knockout includes performing any of the following operations on the genome of the target plant: E1) In the target plant, the genomic gene of sequence 1 in the sequence listing has a 3bp TCA deletion from position 429 to 431, which leads to the deletion of valine at position 74 and serine at position 75 in sequence 2 and its replacement with a glycine, thereby achieving gene knockout. E2) The 4bp TCAG bases in the genome of sequence 1 in the target plant sequence are deleted from position 429 to 432, resulting in a frameshift mutation and premature termination of amino acid translation; E3) In the target plant, a 6bp CCGTCA base was deleted from position 426 to 431 of the genomic gene of sequence 1 in the sequence listing, resulting in the deletion of serine at position 73, valine at position 74, and serine at position 75 in sequence 2, which was replaced by a cysteine, thereby achieving gene knockout. E4) A 22bp deletion of the base CGTCAGCGCCGTCTTCGCCCTC was found at positions 427-448 of the genome of sequence 1 in the target plant sequence listing, resulting in a frameshift mutation and premature termination of amino acid translation.
[0026] In the above text, the grain characteristics may refer to the protein content and / or oil content of plant grains.
[0027] The regulation of grain traits can be achieved by increasing the protein content of plant grains or by decreasing the oil content of plant grains.
[0028] The controlled seed traits of the target plant can result in a protein content that is significantly higher than that of the target plant and / or an oil content that is lower than that of the target plant.
[0029] In the above method, the plant is any one of the following: F1) Dicotyledons, F2) Plants of the order Rosales F3) Leguminosae (family legumes) F4) Soybean species, F5) Soybeans.
[0030] This invention utilizes CRISPR-Cas9 technology to target the recipient soybean variety Jack. GmCDC7 Gene editing yielded... GmCDC7 A homozygous mutant of the gene. Compared to the wild type, GmCDC7 The protein content of soybean seeds from the gene-mutated plants was significantly increased, while the oil content was significantly decreased. This indicates... GmCDC7 Genes negatively regulate soybean seed protein content and also affect seed oil content. This invention reveals for the first time that soybeans GmCDC7 The biological functions of genes in controlling soybean grain quality traits provide new germplasm resources for genetic breeding work, offer new materials for soybean variety selection, and play a positive role in improving soybean varieties. Attached Figure Description
[0031] Picture 1 The images show the homozygous and mutant types of the GmCDC7 gene in T1 generation plants. A shows a schematic diagram of the GmCDC7 gene structure and the location of target Target1; B shows the sequencing peaks of the wild-type and mutant sequences.
[0032] Picture 2 The images show soybean seeds from GmCDC7 gene mutant plants; where A represents protein content and B represents oil content. Detailed Implementation
[0033] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0035] The following examples use SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference (please change according to the actual situation).
[0036] Soybean material: Soybean “Jack” was kindly provided by Researcher Wensheng Hou of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is “the soya bean cultivar Jack” in the following literature: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W. CRISPR / Cas9-mediated targeted mutagenesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J. 2018 Jan;16(1):176-185. doi: 10.1111 / pbi.12758. Epub 2017 Jun 20. PMID: 28509421; PMCID:PMC5785355.
[0037] Reference for strain EHA105: Komari T, Halperin W, Nester EW. Physical and functional map of supervirulent Agrobacterium tumefaciens tumor-inducing plasmid pTiBo542. J Bacteriol. 1986 Apr;166(1):88-94. doi: 10.1128 / jb.166.1.88-94.1986. PMID: 3957875; PMCID: PMC214561.
[0038] The pGES201 in the following examples is the third to fourth segment from the bottom of the right column on page 728 of the following literature. Its full sequence can be found in the Supporting information section of that literature. Supplemental Figure 1 The sequence of pGES201 vector: Mengyan Bai1, Juehui Yuan1, Huaqin Kuang, Pingping Gong, SuningLi, Zhihui Zhang, Bo Liu, Jiafeng Sun, Maoxiang Yang, Lan Yang, Dong Wang, ShikuiSong and Yuefeng Guan. Generation of a multiplex mutagenesis population via pooled CRISPR-Cas9 in soya bean. Plant Biotechnol J. doi: 10.1111 / pbi.13239.
[0039] The aforementioned biological materials are available to the public from the Institute of Botany, Chinese Academy of Sciences. These biological materials are intended solely for repeating the relevant experiments of this invention and may not be used for any other purpose.
[0040] Example 1 GmCDC7 Gene knockout 1.1 GmCDC7 Gene knockout vector preparation Using the online CRISPR-2.0 website, the target gene in the soybean variety Jack was analyzed. GmCDC7 Gene editing target design was performed, with the target sequence being 5'- CCC TCCGTCAGCGCCGTCTTCGC-3' (bases 422 to 444 of SEQ ID No. 1, and bases 214 to 236 of SEQ ID No. 3).
[0041] soybeans GmCDC7 The genome sequence (SEQ ID NO.1, 7512bp) is sequence 1 in the sequence listing, as follows:
[0042] Positions 1-208 are 5'UTRs, and positions 7201-7512 are 3'UTRs; positions 209-530, 624-682, 1859-2782, 2919-2979, 3069-3131, 3429-3492, 3582-3675, 4039-4122, 4214-4303, 4394-4421, 4731-5243, 5327-5385, 6211-6320, 6403-6490, and 6928-7200 are exons; the rest are introns.
[0043] soybeans GmCDC7 The amino acid sequence of the protein GmCDC7 encoded by the gene is sequence 2 (SEQ ID NO. 2, 943aa) in the sequence listing, as follows: MAESEFEPNRVHDLEEKSWHLLALLFRIGHAVYPQRLAAQCRLFAASPDFVCYVSTLPGSPLSVTDNGLVTPSVSAVFALGSFFSLRFSPPQTHRFRKRKLLFDSAEDGRERKRLAIRHGLREFSFQSFADAAEALMRSNFPVIKFESQNIGSGNFVFLLRIDKNEECSGCPMSNFEHRGANNDASTTMSNGEVSKSIIEVLTKKISIIKTSYLNCPKLVDKNRFMECNLFVVDPPCKEGIVNNLGIGKKIDYFDTFTHDCAEQNSIHHVDEDGIGKSNTCKDQPREPNEDDEVESGSKKGLIDSGTNRVKEDVAQRVNAALCGEALTNGLEQKNHVHAMNLEKESERNTGTKSTNKISNSSSTPKRPLKSSSILKGGQKNDLHPKSQILKESLVSNKFGNVPKNVDQRKNEQNLTARKQNHKENMAGNIATTTKVEKRAYPSFEAFTIEEEEGSGGYGTVYRAQRTTDGKRVAIKCPHTNAHKNHVNNERSMLERFGGKNYIIRYEGSFKNGNSDCFVLEHVHHDRPEVLKKEIDIVQLQWYGYCMFRALYCLHKEGVVHRDIKPGNFLFSRKLSKGYLIDFNLAMDLKQKHNIGSKSKPSHDAASNIVSFSSGSAPLVRDKNLGGSKSLTSNKRALADYKNYSELNRHVKQKDCTGPLKNCPDKAGGSFLRAQGTDGSGVTSAKDPSTRTASAERLREPLPSHGRKELISFVNTMKCANNSSTIGPSSQRKRVTAPSSKVDGKIFNITPMPLHSSTVGGGLMRSKGDGKKKEGSCVGTKGFRAPEVLLRSQHQGHKIDIWSAGVTLLYMVIGKTPFTGDPEQNIKEIVKLRGSEEFWEVAKLHDRELSFPVELLDDRYLQSWDLEGWCKIHTKRPEFLEQIPKSLFDLIDKCLTVNPRNRLSAEDVLRHEFFDSLHESLRKQRMLHRHRALRSDAAASRAI。
[0044] Soybean GmCDC7The gene coding sequence (CDS) nucleic acid sequence (SEQ ID NO.3, 2832bp) is sequence 3 in the sequence listing, as follows:
[0045] Build as follows GmCDC7 Gene knockout vector: The upstream primer of the target sequence is primer-F: GGAT TGTCCGTCAGCGCCGTCTTCGC-3', downstream primer is primer-R: 5'- AAAC GCGAAGACGGCGCTGACGGACA-3' (The underlined base is used to form a sticky end).
[0046] Primers F and R were annealed to form annealed sgRNA (a double-stranded DNA fragment with sticky ends). pGES201 was digested with BsaI to obtain a linearized vector of pGES201. The sgRNA was then ligated into the linearized vector of pGES201 to obtain sgRNA expressing Cas9 and the target sequence. GmCDC7 Gene knockout vector pCRISPR-Cas9- GmCDC7 pCRISPR-Cas9- GmCDC7 Recombinant Agrobacterium tumefaciens EHA105 was obtained by introducing competent cells of Agrobacterium tumefaciens EHA105 / pCRISPR-Cas9- GmCDC7. 1.2 Agrobacterium-mediated genetic transformation of soybean Using CRISPR-Cas9- GmCDC7 Agrobacterium tumefaciens plasmid EHA105 was used to infect soybean cotyledonary nodes for soybean genetic transformation. The specific procedure included: (1) Soybean seed cleaning and disinfection: Soybean variety Jack was used as the recipient material. Seeds with plump kernels, uniform size and no disease spots were selected, and chlorine gas was released by the reaction of sodium hypochlorite and concentrated hydrochloric acid for overnight disinfection.
[0047] (2) Explant preparation: The treated soybean seeds were placed in a clean conical flask and soaked overnight in sterile water. In a laminar flow hood, the seed coat was cut along the hilum with a scalpel to separate the embryo into two halves. The cotyledon explants were placed in a bacterial suspension with an OD value of 0.6-0.8 and ultrasonically treated for 3 minutes. The conical flask containing the explants was then placed in a vacuum pump and treated for 10 minutes (0.6 Pa). Finally, the flask was placed in a shaker and cultured at 23°C and 110 rpm for 40 minutes.
[0048] (3) Co-culture: After discarding the bacterial culture, spread the explants on clean filter paper, dry them, spread them on the co-culture medium, put them in an incubator, and incubate them in the dark at 23℃ for 3 days. Then, transfer them to a tissue culture room at 23-25℃ with a photoperiod of 16 h light / 8 h dark for 1 day.
[0049] (4) Recovery culture: Cut off part of the hypocotyl of the explant, leaving 3-4 mm, and insert it obliquely into the recovery culture medium and seal it. Place it in the tissue culture room with a photoperiod of 16 h light / 8 h dark for 7 days.
[0050] (5) Bud induction and selection culture: The excessively long hypocotyl was removed and the explants were inserted obliquely into the selection culture medium. They were placed in the tissue culture room with a photoperiod of 16 h light / 8 h dark for 21 days.
[0051] (6) Bud elongation culture: Remove the cotyledons of the explant, retain the clustered buds and base, and make a new wound at the base. Place on bud induction medium in a tissue culture room at 23-25℃ with a photoperiod of 16 h light / 8 h dark for 2-8 weeks. During this period, change the medium or induce root growth according to the growth status of the explant.
[0052] (7) Root induction culture: When the shoots elongate to 3-5 cm, cut the elongated shoots from the base of the tissue, soak the cut in auxin solution for 2 minutes, and then transfer them into the rooting medium. Place them in the tissue culture room for root induction, and they generally grow for about 2 weeks.
[0053] (8) Seedling transplanting: Transplant the seedlings into the soil, cover them with a film and place them in the light. After the plants have grown normally for 3-5 days, remove the film to obtain T0 generation plants. Harvest T0 generation seeds, self-pollinate the T0 generation to obtain T1 generation seeds, and plant the T1 generation seeds to obtain T1 generation seedlings.
[0054] The co-culture medium formula is as follows: B5 medium + 3% sucrose + 0.8% Agar + 3mM MES + 0.25mg / L gibberellin (GA3) + 1.67mg / L benzylaminopurine (6-BA) + 580mg / L cysteine + 154.2mg / L dithiothreitol + 200µM hexanoyl eugenol (AS), pH 5.4.
[0055] The recovery culture medium formula is: MS medium + 3% sucrose + 3mM MES + 0.8% Agar + 1.67mg / L benzylaminopurine (6-BA) + 100mg / L cephalosporin (Cef), pH 5.7.
[0056] The recovery culture medium formula is: MS medium + 3% sucrose + 3mM MES + 0.8% Agar + 1.67mg / L benzylaminopurine (6-BA) + 100mg / L cephalosporin (Cef), pH 5.7.
[0057] The screening medium formulation is as follows: MS medium + 3% sucrose + 3mM MES + 0.8% Agar + 1.67 mg / L benzylaminopurine (6-BA) + 5 mg / L Glufosinate + 100 mg / L cephalosporin (Cef), pH 5.7.
[0058] The bud induction medium formula is as follows: MS medium + 3% sucrose + 3mM MES + 0.8% Agar + 50mg / L asparagine + 50mg / L glutamine + 0.1mg / L indoleacetic acid (IAA) + 0.5mg / L gibberellin (GA3) + 1mg / L zeatin + 5mg / L glutfosinate + 500mg / L termethin (Tim) + 100mg / L cephalosporin (Cef), pH 5.7.
[0059] The rooting medium formula is: MS medium + 3% sucrose + 3mM MES + 0.8% Agar + 1mg / L IBA, pH 5.7.
[0060] 1.3 GmCDC7 Genotyping and phenotypic identification of gene-mutant plants Using the DNA of the obtained transgenic plants as templates, PCR amplification of the plants was performed using upstream identification primer F: 5'-CTCGATCCATGGCAGAGTCC-3' and downstream identification primer R: 5'-GGCTTCTGACTACCTGGAACG-3'. The PCR products were then subjected to Sanger sequencing to identify the mutation status of the target sites in the T1 generation plants.
[0061] Identification using PCR and Sanger sequencing technologies GmCDC7 The CRISPR-T1 generation plants exhibit four editing modes at the target site (CR1-3bp, CR2-4bp, CR3-6bp, CR4-22bp).
[0062] The CR1-3bp and CR3-6bp edit types involve deletions of 3bp or 6bp at the target sites (bases 214 to 236 of SEQ ID No. 3; bases 422 to 444 of SEQ ID No. 1). These two mutation types result in amino acid deletions without causing frameshift mutations that prematurely terminate translation. However, the CR2-4bp and CR4-22bp edits produce deletions of 4bp or 22bp at the target sites, resulting in frameshift mutations and premature termination of amino acid translation.
[0063] Specifically, in CR1 (CR1-3bp), compared to the soybean variety Jack, the genome... GmCDC7The corresponding region of the gene underwent the following changes: A 3bp TCA base deletion occurred between positions 429 and 431 of the sequence shown in SEQ ID NO.1, resulting in the deletion of valine at position 74 and serine at position 75, which were replaced by a glycine residue. GmCDC7 Gene knockout.
[0064] In CR2 (CR2-4bp), compared to the soybean variety Jack, the genome has... GmCDC7 The region corresponding to the gene underwent the following change: 4 bp of TCAG bases were deleted from position 429 to position 432 of the sequence shown in SEQ ID NO.1, resulting in a frameshift mutation and premature termination of amino acid translation.
[0065] In CR3 (CR3-6bp), compared to the soybean variety Jack, the genome has... GmCDC7 The region corresponding to the gene underwent the following changes: A 6bp deletion of the base CCGTCA from position 426 to position 431 of the sequence shown in SEQ ID NO.1 resulted in the deletion of serine at position 73, valine at position 74, and serine at position 75, which were replaced by a cysteine residue. GmCDC7 Gene knockout.
[0066] In CR4 (CR4-22bp), compared to the soybean variety Jack, the genome has... GmCDC7 The region corresponding to the gene underwent the following change: 22 bp of bases CGTCAGCGCCGTCTTCGCCCTC were deleted from position 427 to position 448 of the sequence shown in SEQ ID NO.1, resulting in a frameshift mutation and premature termination of amino acid translation.
[0067] Picture 1 Among the T1 generation plants GmCDC7 Gene homozygosity and mutation types. Picture 1 A in the middle is GmCDC7 The diagram shows the gene structure and the location of Target1, including the wild-type WT (soybean variety Jack) reference sequence and the CR1-3bp, CR2-4bp, CR3-6bp, and CR4-22bp mutant sequences; red indicates the PAM sequence; short dashes indicate base deletions. Picture 1 In Figure B, the sequencing peak diagrams of the wild-type and mutant sequences are shown, with the red areas indicating the locations where mutations occurred.
[0068] Example 2 GmCDC7 Phenotypic identification of soybean seeds from gene-mutant plants Seeds from mature mutant plants CR1, CR2, CR3, and CR4 were harvested and planted together with the wild-type soybean variety Jack in the summer of 2022 at the Molecular Breeding Experimental Base of the Institute of Botany, Chinese Academy of Sciences (116°20′E, 39°99′N). The plants were grown in pots using a substrate of potting soil and vermiculite in a 3:1 ratio. Ten pots were planted for each line, with two plants per pot. Phenotypic analysis was performed after maturity, with at least ten biological replicates for each line.
[0069] 150 soybean seeds from each line were taken and the oil and protein content of mature seeds from wild-type soybean variety Jack and gene mutant plants CR1-CR4 was measured using a near-infrared spectroscopy analyzer (Bruker, MPA Near-infrared Spectrum System, Germany). Picture 2 These are the experimental results. Compared to the wild-type soybean variety Jack, GmCDC7 The protein content of CR1-CR4 in the gene-mutated plants was significantly increased by 5.97%-15.41%. Picture 2 (A), while the oil content decreased by 1.99%-9.96% ( Picture 2 (B) indicates GmCDC7 Genes can also affect the protein and oil content of soybean seeds.
[0070] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Use of a biomaterial, characterized in that, The application is any one of the following: A1) The application of the biomaterials described herein in regulating plant grain traits and / or in preparing products that regulate plant grain traits. A2) The application of the biomaterials described herein in plant breeding and / or the preparation of plant breeding products; The biological material is a protein, a substance that regulates the expression of the gene encoding the protein, or a substance that regulates the content of the protein. The protein is GmCDC7, and is any one of the following: B1) The amino acid sequence of the protein is shown in sequence 2. B2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the protein described in B1), which has more than 80% identity with the protein shown in B1) and can regulate plant seed weight and / or seed yield. B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).
2. The application according to claim 1, characterized in that, The protein is derived from soybeans.
3. The application according to claim 1 or 2, characterized in that, The substance is any one of the following: C1) Nucleic acid molecules that inhibit, reduce, or downregulate the expression of the gene encoding the protein described in claim 1 or 2. C2) expresses the gene encoding the nucleic acid molecule described in C1). C3) contains the expression cassette of the gene described in C2). C4) A recombinant vector containing the gene described in C2), or a recombinant vector containing the expression cassette described in C3). C5) Recombinant microorganisms containing the gene described in C2), or recombinant microorganisms containing the expression cassette described in C3), or recombinant microorganisms containing the recombinant vector described in C4). C6) A transgenic plant cell line containing the gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4). C7) Transgenic plant tissue containing the gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4). C8) A transgenic plant organ containing the gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).
4. The application according to claim 3, characterized in that, C1) The nucleic acid molecule is a target sequence that targets the protein-coding gene described in claim 1.
5. A method for regulating plant seed traits, characterized in that, The method includes regulating the seed traits of a target plant through gene knockout.
6. A method for cultivating plants with altered seed traits, comprising obtaining plants with altered seed traits by gene knockout, wherein the seed protein content of the plants with altered seed traits is significantly higher than that of the target plant, and the oil content is lower than that of the target plant; wherein the target plant contains the gene encoding the protein of claim 1 or 2.
7. The method as described in claim 5 or 6, characterized in that, The gene knockout includes introducing a gene knockout vector into the target plant targeting nucleotides 422-444 of sequence 1 in the sequence listing.
8. The method as described in claim 5 or 6, characterized in that, The genome of the target plant contains a DNA molecule with the nucleotide sequence of sequence 3 in the sequence listing, and the gene knockout includes performing any of the following operations on the genome of the target plant: D1) In the target plant, the genomic gene of sequence 1 in the sequence listing has a 3bp TCA deletion from position 429 to 431. D2) In the target plant, the genomic gene of sequence 1 in the sequence listing has a 4bp deletion of TCAG from position 429 to 432. D3) In the target plant, a 6 bp deletion of CCGTCA from position 426 to 431 of the genomic gene of sequence 1 in the sequence listing is present. D4) In the target plant, 22 bp of CGTCAGCGCCGTCTTCGCCCTC is deleted from position 427 to 448 of the genomic gene of sequence 1 in the sequence listing.
9. The application as described in any one of claims 1-4 or the method as described in any one of claims 5-8, characterized in that, The grain trait being regulated is selected from at least one of the following: E1) Increases the protein content of plant seeds. E2) Reduces the oil content of plant seeds.
10. The application as described in any one of claims 1-4 or the method as described in any one of claims 5-8, characterized in that, The plant is any one of the following: F1) Dicotyledons, F2) Plants of the order Rosales F3) Leguminosae (family legumes) F4) Soybean species, F5) Soybeans.