Banana fusarium oxysporum 4 # physiological race rapid detection method based on enzyme-mediated double-index amplification technology

Abstract

The invention discloses a banana fusarium oxysporum 4 # physiological race rapid detection method based on an enzyme-mediated double-index amplification technology. The detection primer group comprises the following components: F4: AAGCTAATACGACTCACATAGGGAAACTGATCCCTCAAACCAGCGG, F6: AAGCTAATACGACACCAGCGG, F7: AAGCTAATACGACACACCAGCGG R1 is CATACTTACAAGCTTATACAAGCGTTT, and R2 is And N1 is FAM-GAAGAGUUAAACAGGAAGUGGUCAGAGA-BHQ1, and N1 is Based on an enzyme-mediated double exponential amplification technology (EmDEA), Foc4 specific gene segments are screened through genome comparison, six pairs of DNA primers and six RNA probes are designed, an optimal combination (F4R1N1) is obtained through cross screening, and a set of high-sensitivity and high-specificity detection system is developed. Experimental results show that amplification of the system is completed within 30 min under the constant temperature condition of 42 DEG C, the lowest detection limit is 0.5 pg / mu L, specificity is high, cross reaction with sibling species is avoided, and efficient technical support is provided for field early warning and port quarantine of banana fusarium wilt.

Description

Technical Field

[0001] This invention belongs to the field of fruit disease and pest control, specifically involving a rapid detection method for physiological race 4 of Fusarium wilt of banana based on enzyme-mediated double exponential amplification technology. Background Technology

[0002] Banana wilt is caused by Fusarium oxysporum cucumeriforme (Fusarium oxysporum cucumeriforme). Fusarium oxysporum f. sp. cubense Foc4, a devastating soil-borne disease caused by the fungus, has broken out in many major banana-producing regions worldwide (Ploetz, 2015). The pathogen infects the roots, leading to systemic necrosis of the vascular bundles and causing plant wilting and death. Based on the host it infects, it can be divided into four physiological races, of which races 1 (Foc1), 2 (Foc2), and 4 (Foc4) infect bananas (Ploetz, 2006). Globally, Foc4 has caused serious damage to almost all currently popular cultivars, becoming a bottleneck restricting the sustainable development of the banana industry. It has since been renamed... F. odoratissimum (Maryani et al., 2019). This pathogen can survive in the soil as chlamydospores for decades, and chemical control is largely ineffective due to the lack of specific and effective agents (Ploetz, 2006; Bubici et al., 2019). Although breeding resistant varieties is considered the most economical and effective control strategy, there is a lack of germplasm resources among existing commercial banana varieties that are completely immune to physiological race 4, and its effective control remains a global challenge (Ploetz, 2015; Pegg et al., 2019). In 2020, the Ministry of Agriculture and Rural Affairs included banana Fusarium wilt race 4 in the "National List of Quarantine Pests of Agricultural Plants" (Ministry of Agriculture and Rural Affairs of the People's Republic of China, 2020) in Announcement No. 351. Against this backdrop, the detection, identification, and monitoring of the pathogen are of great significance for curbing the spread and occurrence of banana Fusarium wilt, and the development and application of rapid detection technologies have become a key link in integrated disease management.

[0003] Different specialized forms and physiological races of *Fusarium oxysporum* are highly similar in morphology, lacking distinguishable morphological differences. Therefore, morphological methods alone are insufficient for effective identification (Recorbet et al., 2003; Fourie et al., 2011). Traditional detection techniques mainly rely on culture characteristic analysis, pathogenicity testing, and trophozoite affinity analysis (Ye Mingzhen, 2006; Chen Jinghua et al., 2008). These methods require a high level of expertise from the identifyers and have long testing cycles, making them unsuitable for rapid and accurate detection. In recent years, molecular detection techniques have been widely used for the identification of this pathogen, leading to the development of various detection technologies, including conventional PCR (Wang Guofen et al., 2007; Cao Yongjun et al., 2010; Dita et al., 2010; Li et al., 2013a; Fraser-Smith et al., 2014; Yang Laying et al., 2016; Carvalhais et al., 2019; Lin Ying et al., 2023; Pu Xiaoming et al., 2024), real-time quantitative PCR (Lin et al., 2013; Aguayo et al., 2017; Matthewset et al., 2020), and droplet digital PCR (Lovera et al., 2024). However, PCR technology relies on thermal cycling equipment and can typically only be performed in laboratories, making it difficult to use in resource-constrained fields or remote areas (Lau & Botella, 2017). The application of loop-mediated isothermal amplification (LAMP) technology provides a rapid on-site detection solution for the early control of banana wilt disease (Li et al., 2013b; Peng et al., 2014; Ordóñez et al., 2019), but false positives are a major challenge for this technology (Rolando et al., 2020). Enzyme-mediated duplex exponential amplification (EmDEA) is a novel detection technology that achieves dual amplification of target nucleic acid and fluorescent signal through multi-enzyme collaboration. The first signal amplification starts with the target DNA template. Under the guidance of primers containing the T7 promoter, a large amount of double-stranded DNA product containing the T7 promoter is generated through isothermal amplification. The T7 polymerase recognizes the T7 promoter in the double-stranded DNA and transcribes it to produce a large amount of RNA product, completing the exponential amplification of the target nucleic acid. The second signal amplification is achieved by the specific binding of the fluorescent probe to the RNA product, which is hydrolyzed under the action of double-stranded specific nuclease, releasing the fluorescent group. After hydrolysis, the probe fragments detach from the RNA, and new fluorescent probes can continue to bind to the RNA and be hydrolyzed, thus achieving cyclic amplification of the fluorescent signal.This technology achieves exponential amplification of target nucleic acids under the guidance of specific primers, and then uses the hydrolysis cycle of fluorescent probes to amplify the product signal a second time, significantly improving the specificity and sensitivity of detection (Yu Zilin et al., 2024; Han Rui et al., 2024). This patent develops a Foc4-specific detection system based on EmDEA technology, aiming to provide efficient technical support for early field warning and port quarantine of banana Fusarium wilt. Summary of the Invention

[0004] The first objective of this invention is to provide a primer set for detecting Fusarium wilt of banana race 4 based on enzyme-mediated double exponential amplification technology, comprising:

[0005] F4: AAGCTAATACGACTCACTATAGGGAAACTCGATCCCTCAAACCAGCGG (SEQ ID NO.1);

[0006] R1: CATACTTTCAAGCTTCATACAAGCGTTT (SEQ ID NO.2);

[0007] N1: FAM-GAAGAGUUAAACAGGAAAGUGGUCAGAGA-BHQ1.

[0008] A second objective of this invention is to provide a detection kit comprising the aforementioned detection primer set.

[0009] Preferably, the kit further includes basic dry powder, activating solution, and nuclease-free water.

[0010] The third objective of this invention is to provide a rapid detection method for physiological race 4 of Fusarium wilt of banana based on enzyme-mediated double exponential amplification technology, which includes the following steps:

[0011] Genomic DNA was extracted from the sample to be tested, and enzyme-mediated double exponential amplification (EmDEA) nucleic acid detection was performed using the above-mentioned detection primer set. The results were analyzed based on the characteristics of the detected fluorescence curve and the fluorescence signal value to determine whether the sample contained Fusarium wilt pathogen race 4.

[0012] Preferably, the enzyme-mediated double exponential amplification (DEA) nucleic acid detection reaction system comprises 20 μL of the following: basic enzyme powder, 1 μL each of upstream and downstream primers (concentration of 10 μmol / L) and RNA probe (concentration of 1 μmol / L), 1 μL of template DNA, 10 μL of activation solution, and 6 μL of DEPC water.

[0013] Preferably, the enzyme-mediated double exponential amplification (DEA) nucleic acid detection reaction procedure is as follows: incubation at 42 °C for 30 min, with real-time acquisition of FAM fluorescence signals in 1-min cycles.

[0014] The fourth objective of this invention is to provide the application of the above-mentioned detection primer set in the detection of physiological race 4 of Fusarium wilt in bananas.

[0015] The fifth objective of this invention is to provide the application of the above-mentioned detection kit in the detection of physiological race 4 of Fusarium wilt in bananas.

[0016] To achieve rapid and highly sensitive field detection of physiological race 4 of Fusarium wilt in bananas, this invention utilizes enzyme-mediated double exponential amplification (EmDEA) technology. By screening for Foc4-specific gene fragments through genome alignment, six pairs of DNA primers and six RNA probes were designed. The optimal combination (F4R1N1) was obtained through cross-selection, resulting in a highly sensitive and specific detection system. Experimental results show that this system completes amplification within 30 minutes at a constant temperature of 42 ℃, with a detection limit of 0.5 pg / μL. It exhibits high specificity and no cross-reactivity with closely related species, providing efficient technical support for early field warning and port quarantine of Fusarium wilt in bananas. Attached Figure Description

[0017] Figure 1 It is the target gene sequence;

[0018] Figure 2 These are the results of primer-probe combination screening tests;

[0019] Figure 3 It is the specific detection of Foc4 by the F4R1N1 primer-probe combination;

[0020] Figure 4 It is a sensitivity detection of the F4R1N1 primer-probe combination;

[0021] Figure 5 This is the standard curve for Foc4 detection sensitivity;

[0022] Figure 6 These are the test results of samples from infected plants. Detailed Implementation

[0023] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0024] Example 1:

[0025] 1. Materials and Methods

[0026] 1.1 Test strains

[0027] The tested strains covered four physiological races of Fusarium oxysporum Cuban Specialty (Foc), as well as other Fusarium oxysporum specialty types: cabbage specialty type ( Fusarium oxysporum f.sp. Conglutinans Foco), watermelon-specific type ( Fusarium oxysporum f.sp. niveum Fon), tomato-specific type ( Fusarium oxysporum f.sp. lycopersici (Fol). In addition, other species of the genus *Fusarium* (such as *Fusarium moniliforme*) are also included. F. moniliforme Fusarium solani F. solani ) and other pathogens, such as the fungus that causes banana black streak leaf spot ( Mycosphaerella fijiensis Banana leaf spot pathogen ( Cercospora sp.) etc.

[0028] Information on the tested strains is shown in Table 1.

[0029] Table 1. Information on tested strains and EmDEA detection results

[0030] Note: a. The strain was isolated from Hainan Province and preserved at Qiongzhou Normal University; b. The strain was kindly provided by the Tropical and Subtropical Fungi Research Laboratory of South China Agricultural University; c. The strain originated from Australia and was kindly provided by Researcher Lü Shun of the Banana and Vegetable Research Institute of Dongguan City, Guangdong Province; d. The strain was kindly provided by Associate Researcher Yang Yuhong of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences; e. The strain was kindly provided by Researcher Kong Lingxiao of the Hebei Academy of Agricultural and Forestry Sciences; f. The strain was kindly provided by the Vegetable Research Center of the Beijing Academy of Agricultural and Forestry Sciences; g. The strain was kindly provided by the relevant research group of the Chinese Academy of Tropical Agricultural Sciences; h. The strain was kindly provided by Researcher Liu Bo of the Fujian Academy of Agricultural Sciences; i. Detection results: + Positive, − Negative.

[0031] 1.2 Mycelial Culture and DNA Extraction

[0032] The refrigerated test strains were inoculated onto potato dextrose agar (PDA) plates and activated at 28°C for 5 days. They were then transferred to potato dextrose liquid medium (PDB) and cultured at 28°C with shaking at 180 rpm for 48 hours. The cells were collected by centrifugation. After grinding in liquid nitrogen, genomic DNA was extracted using the Aidlab DN 41 fungal genomic DNA rapid extraction kit (Aidlab Biotechnology Co., Ltd., Beijing) according to the instructions. The DNA concentration was measured using a Nanodrop ND-2000 ultra-micro nucleic acid and protein analyzer (Thermo Fisher Scientific, USA), and stored at −20°C for later use.

[0033] 1.3 Target screening and primer / probe design

[0034] By comparing with the NCBI database, a specific gene fragment was identified based on the genome sequence of *Fusarium oxysporum* race 4, contig195 (GenBank: AMGQ01000195.1). Figure 1 Primers and probes for the EmDEA system were designed, including 6 pairs of DNA primers (the forward primers contain the T7 promoter) and 6 FAM / BHQ1-labeled RNA probes (Table 2). The DNA primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the RNA probes were synthesized by Suzhou Jingrui Biotechnology Co., Ltd.

[0035] Table 2 Primer and probe sequences used in the experiment

[0036] 1.4 Primer-probe combination screening

[0037] Using the ultraRADAR fluorescence isothermal amplification detection kit (Suzhou Jingrui Biotechnology Co., Ltd.), and with XJZ2 strain DNA as a template, the designed primer and probe combinations were screened. First, DNA primers (F3, F4, R3, R4) located in the middle of the target region were selected for cross-pairing. By comparing the amplification efficiency of six RNA probes under the same DNA primer set, the RNA probe (RNAN) with the lowest Ct value and the highest endpoint fluorescence intensity was selected, determining the initial primer combination (FN-RN). The RNA probe (RNAN) and DNA upstream primer (FN) obtained from the initial screening were fixed, and the amplification efficiency of multiple downstream primers, including the initial primer, was systematically compared. Based on a comprehensive evaluation of Ct value and fluorescence intensity, the DNA downstream primer (RM) with the best performance was selected. Based on the optimized RNA primer (RNAN) and DNA downstream primer (RM), the DNA upstream primer (FX) was further screened. The combination with the lowest CT value and the highest endpoint fluorescence value among all primer and probe combinations was selected as the optimal combination (FX-RM-RNAN).

[0038] The EmDEA reaction system consisted of 20 μL of the following: basic enzyme powder, 1 μL each of forward and reverse primers (10 μmol / L) and RNA probe (1 μmol / L), 1 μL template DNA, 10 μL activation buffer, and 6 μL DEPC water. The reaction program on the BIO-RADCFX96 real-time fluorescence PCR instrument was set as follows: incubation at 42 ℃ for 30 min, with FAM fluorescence signals acquired in real-time at 1-min intervals. DEPC water was used as a blank control, and each group had 3 replicates and 1 blank control.

[0039] 1.5 Specificity test

[0040] Using the DNA of Fusarium wilt pathogen race 4 and its closely related strains, as well as other fungal genera listed in Table 1, as templates, the selected primer and probe combinations were specifically detected. The reaction system and procedure were the same as in 1.4. DEPC water was used as a blank control, and each group had 3 replicates and 1 blank control.

[0041] 1.6 Sensitivity Test

[0042] The DNA from *Fusarium oxysporum* strain XJZ2 (Cuba specialized type 4) listed in Table 1 was serially diluted to 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, and 1 pg / μL. One μL of each diluted solution was used as a template to test the sensitivity of the selected primer and probe combinations. The reaction system and procedure were the same as in 1.4. DEPC water was used as a blank control, and each group had three replicates and one blank control. A standard curve was established using the logarithm of the template amount versus the obtained cycle threshold (Cq).

[0043] 1.7 Detection of diseased plant samples

[0044] In September 2025, samples of Fusarium wilt diseased banana plants were collected from banana orchards in Dongcheng Town, Danzhou City, Hainan Province, and the pathogen was isolated and purified. Three purified strain samples, corresponding frozen samples of diseased banana plants, and samples from healthy banana plants were selected, and DNA was extracted for EmDEA detection. The reaction system and procedure were the same as in 1.4. Using XJZ2 strain genomic DNA as a positive control and DEPC water as a blank control, the effectiveness of the selected primer and probe combinations in detecting the diseased plant samples was determined. Each group had three replicates and one blank control.

[0045] 2. Results and Analysis

[0046] 2.1 Primer-probe combination screening

[0047] In the first round of screening, 24 combinations were obtained by pairing four primer combinations (F3R3, F3R4, F4R3, and F4R4) with six RNA probes (N1, N2, N3, N4, N5, and N6). Four combinations showed good amplification results. Figure 2 A), and then test these four combinations again ( Figure 2 B), the results showed that the F4R3N1 combination had the best amplification efficiency (the lowest CT value among all combinations, and the relatively high endpoint fluorescence value, the same below); the second round of screening tested F4N1 in combination with 5 downstream primers (R3, R1, R2, R5, R6) respectively. Figure 2 C), the results showed that the combination F4R1N1 was the most efficient; the third round of screening tested R1N1 in combination with five upstream primers (F4, F1, F2, F5, F6). Figure 2(D) The results showed that the F4R1N1 combination had the best amplification efficiency. After multiple rounds of screening, the primer-probe set F4R1N1 was finally determined to have the best amplification efficiency for Foc4, and was therefore the optimal combination.

[0048] F4: AAGCTAATACGACTCACTATAGGGAAACTCGATCCCTCAAACCAGCGG;

[0049] R1: CATACTTTCAAGCTTCATACAAGCGTTT;

[0050] N1: FAM-GAAGAGUUAAACAGGAAAGUGGUCAGAGA-BHQ1.

[0051] 2.2 Specificity Validation

[0052] EmDEA analysis was performed on DNA from four physiological races of Fusarium wilt of banana and its closely related species (Table 1) using the F4R1N1 primer-probe combination. The results showed that the F4R1N1 primer-probe combination was effective against DNA from the tested four strains. Fusarium oxysporum f.sp. cubense (Foc4) The target strain showed specific positive amplification with a significant increase in fluorescence signal, while no fluorescence signal amplification was detected in the non-target strain and the blank control, showing a negative result (Table 1). Figure 3 It is clear that the F4R1N1 primer-probe pair... Fusarium oxysporum f.sp. cubense (Foc4) Highly specific.

[0053] 2.3 Sensitivity Analysis

[0054] EmDEA detection was performed on different dilutions of genomic DNA template from strain XJZ2 using the F4R1N1 primer-probe combination. Results showed that genomic DNA at concentrations of 100 ng, 10 ng, 1 ng, 100 pg, and 10 pg all exhibited significant fluorescent signals, indicating positive amplification. Figure 4 This indicates that the detection limit of the F4R1N1 primer-probe combination is 10 pg per reaction (20 μL system), i.e., the detection sensitivity is 0.5 pg / μL. A standard curve was plotted based on the sensitivity results; the equation of the standard curve is y = −1.973x + 19.541, R² = 0.986. Figure 5 ).

[0055] 2.4 Detection of diseased plant samples

[0056] In the testing of samples from infected plants, the DNA of the infected banana sample and the purified strain isolated from the same sample were both positive. No fluorescence amplification was detected in the DNA of healthy tissue and the blank control, indicating negative results. Figure 6 This indicates that the method can be applied to the direct detection of Foc4 in banana plant samples.

[0057] 3. Discussion and Conclusion

[0058] Fusarium wilt race 4 (Foc4) of banana is a devastating threat to the global banana industry. The core of its control strategy lies in monitoring early symptoms, eradicating infected plants, and isolating affected areas to reduce pathogen transmission. However, this pathogen can survive in the soil for extended periods and exhibits a long incubation period after infecting plants. During this time, plants show no visible symptoms, and the pathogen load is extremely low, making early detection and field identification exceptionally difficult. This significantly increases the risk of long-distance transmission of the pathogen through contaminated seedlings, soil, and water (Ploetz, 2015; Dita et al., 2018). Once the disease manifests in the field, the pathogen has usually already multiplied and spread extensively in the soil and among the plants, making eradication extremely difficult. Therefore, developing rapid detection technologies that are highly sensitive, highly specific, and applicable in the field is a crucial prerequisite for blocking disease transmission and reducing its severity.

[0059] Fusarium oxysporum ( Fusarium oxysporum The fungus *Fusarium wilt* (Foc) is a complex group of species with a complex genetic background, containing a large number of pathogenic and non-pathogenic strains, and exhibiting high genetic similarity among different species (Recorbet et al., 2003; Fourie et al., 2011). This makes the accurate identification of *Fusarium wilt* a major challenge and a hot research topic. In early phylogenetic analyses based on conserved gene sequences, ribosomal DNA (rDNA) markers such as ITS and IGS, which are relatively conserved within species but exhibit some variation between species, were applied for identification at the genus or species level (Wang Guofen, 2007; O'Donnell et al., 2009; Cao Yongjun, 2010). However, these markers have limited resolution and insufficient specificity when distinguishing between different Foc species that are genetically very closely related (Recorbet et al., 2003; Lin Fei, 2010; Li et al., 2013a). EF-1α and β-tubulin Housekeeping genes, which encode core cell functions, are used as supplementary markers due to their moderate evolutionary rate, or through multi-gene joint analysis (such as...). EF-1α(+IGS) improves the reliability of phylogenetic analysis (Peng Jun, 2008; O'Donnell et al., 2009; Dita, 2010). The study by Li (2013a) et al. confirmed the potential application of specific pathogenic genes in Foc4 identification. With the deepening research into the pathogenic mechanism of Foc, SIX Key virulence factors with significant race-specificity, such as the (Secreted in Xylem) gene family, have been successively discovered, becoming important molecular markers for distinguishing Foc4 from other physiological races (Fraser-Smith et al., 2014; Yang Laying et al., 2016). With the rapid development of high-throughput sequencing technology, genomics research has not only provided an unprecedentedly detailed perspective for in-depth analysis of the pathogenic mechanisms and genetic diversity of Foc4 (McTaggart et al., 2021; Fokkens & Rep, 2023), but also provided a wealth of candidate targets for the development of next-generation diagnostic tools. This patent identifies Foc4-specific gene fragments through genome alignment, designs primers and probes based on these fragments, and successfully establishes a novel detection system with high sensitivity and high specificity after systematic optimization.

[0060] The rapid detection method for EmDEA, the physiological race 4 of Fusarium wilt of banana, developed in this patent, demonstrates significant comprehensive advantages in the detection of Foc4, reflecting a highly efficient balance of sensitivity, specificity, and field applicability. In terms of sensitivity, the detection limit of this method reaches 0.5 pg / μL (5 × 10⁻⁶ pg / μL). −4 The concentration of 5.98 ng / μL not only surpasses traditional PCR methods (0.1 ng / μL) (Pu Xiaoming et al., 2024) but also outperforms other isothermal amplification techniques, such as LAMP (1 pg / μL) (Ordóñez et al., 2019), demonstrating the technical advantage of its dual signal amplification mechanism. Although compared to real-time quantitative PCR (5.98 × 10⁻⁶ ng / μL), it is significantly higher. -5 ng / μL (Matthews et al., 2020) and droplet digital PCR (2.5 × 10⁻⁶ ng / μL) -While its sensitivity lags behind technologies like LAMP (3 ng / reaction, 15 μL system) (Lovera et al., 2024), this method achieves key breakthroughs in portability, cost, and operational efficiency. Regarding specificity, this detection method uses primers and probes designed based on the Foc4-specific gene fragment, which have been validated against multiple strains without cross-reactivity, effectively avoiding the false-positive problem common in LAMP technology. Another core advantage of EmDEA technology lies in its field applicability. This technology can complete detection in 20-30 minutes at a constant temperature of 42 ℃, with a closed-tube operation throughout, effectively avoiding aerosol contamination. The reaction can be performed on a conventional quantitative PCR instrument or adapted to portable fluorescence detection devices (such as the uReader 1600 handheld fluorescence detector developed by Suzhou Jingrui Biotechnology Co., Ltd.), requiring less stringent experimental conditions and perfectly meeting the urgent needs of early field warning and rapid customs clearance. Similar technological advantages have been demonstrated in the detection of *Fusarium wilt* (a pathogen of *Fusarium wilt*). Ovulinia azaleae (Yu Zilin et al., 2025), cocoa flower gall pathogen ( Albonectria rigidiuscula (Yu Zilin et al., 2024) and small fire ants ( Wasmannia auropunctata (Han Rui et al., 2024) and other quarantine pests have been verified, indicating that it has good application prospects and promotion potential.

[0061] The Foc4 rapid detection method developed in this patent, through precise target gene screening and dual signal amplification mechanism, significantly improves detection sensitivity while maintaining high specificity. It has multiple advantages such as speed, portability, and closed tube operation, and is especially suitable for the rapid detection of Foc4, which can buy critical time for field isolation of diseased plants and soil disinfection, and has important application and promotion value.

Claims

1. A primer set for detecting Fusarium oxysporum f. sp. cubense Race 4 based on enzyme-mediated double exponential amplification technology, characterized in that, include: F4: AAGCTAATACGACTCACTATAGGGAAACTCGATCCCTCAAACCAGCGG; R1: CATACTTTCAAGCTTCATACAAGCGTTT; N1: FAM-GAAGAGUUAAACAGGAAAGUGGUCAGAGA-BHQ1.

2. A test kit characterized in that, Includes the detection primer set as described in claim 1.

3. The test kit according to claim 2, characterized in that, The kit also includes a basic dry powder, an activating solution, and water.

4. A rapid detection method of Fusarium oxysporum f. sp. cubense race 4 based on enzyme-mediated double exponential amplification technology, characterized in that, Includes the following steps: Genomic DNA was extracted from the sample to be tested, and enzyme-mediated double exponential amplification (EmDEA) nucleic acid detection was performed using the detection primer set described in claim 1. The results were analyzed based on the characteristics of the detected fluorescence curve and the fluorescence signal value to determine whether the sample contained physiological race 4 of Fusarium wilt of banana.

5. The method of claim 4, wherein, The enzyme-mediated double exponential amplification (DEA) nucleic acid detection method comprises a 20 μL reaction system, including basic enzyme powder, 1 μL each of upstream and downstream primers at a concentration of 10 μmol / L and RNA probe at a concentration of 1 μmol / L, 1 μL template DNA, 10 μL activation solution, and 6 μL DEPC water.

6. The method according to claim 4, characterized in that, The enzyme-mediated double exponential amplification (DEA) nucleic acid detection method described herein has the following reaction procedure: incubation at 42 °C for 30 min, with real-time acquisition of FAM fluorescence signals in 1-min cycles.

7. The application of the detection primer set according to claim 1 in the detection of physiological race 4 of Fusarium wilt of banana.

8. The application of the detection kit according to claim 2 or 3 in the detection of physiological race 4 of Fusarium wilt in bananas.

Images