Pharmaceutical composition for preventing or treating cancer comprising nucleic acid construct-encoding p53 protein
By designing non-natural 5'UTR and 3'UTR sequences and combining them with a cap structure, the stability and translation efficiency of mRNA were improved, solving the problem of low efficiency of existing mRNA therapies in cancer treatment, and achieving effective p53 protein expression and cancer treatment.
Patent Information
- Application Number
- CN202480060370.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-03-29
- Filing Date
- 2024-09-27
- Publication Date
- 2026-04-17
AI Technical Summary
Existing mRNA therapies lack tissue specificity in cancer treatment and rely on inefficient natural UTR sequences, leading to unstable p53 protein synthesis and making it difficult to effectively prevent or treat cancer.
Design and combine non-natural 5'UTR and 3'UTR sequences to operatively link them to nucleotide sequences encoding p53 or its functional fragments, forming a 5'UTR that does not form a secondary structure and a 3'UTR with a specific secondary structure, and combine cap structures to improve mRNA stability and translation efficiency.
By optimizing the UTR sequence design, the transcription and translation efficiency of mRNA was improved, and the expression of p53 protein was enhanced, thus achieving effective prevention and treatment of cancer.
Smart Images

Figure CN121889174A_ABST
Abstract
Description
Technical Field
[0001] This disclosure relates to a nucleic acid construct encoding the p53 protein and its applications. Background Technology
[0002] In cancer immunotherapy and stem cell-based biomedical research, ribonucleic acid (RNA) (e.g., messenger RNA) is frequently used as a gene delivery molecule as an alternative to deoxyribonucleic acid (DNA). As a direct source of gene products, mRNA has several advantages, including not needing to enter the nucleus, which would pose a significant barrier to DNA delivery, particularly in non-dividing cells. Furthermore, by avoiding oncogene expression induced by aberrant transcription and insertional mutagenesis, mRNA is less likely to integrate into the host genome.
[0003] For a given gene, the UTR, including both the 5' untranslated region (UTR) and the 3' UTR, is the region involved in regulating expression. The 5' UTR is a DNA regulatory region located at the 5' end of a protein-coding sequence and is transcribed into mRNA but not translated into protein. The 5' UTR can include various regulatory elements, such as 5'-cap structures, G-quadruplex structures (G4), stem-loop structures, and internal ribosome entry sites (IRES), and these regulatory elements play an important role in controlling translation initiation. The 3' UTR, located downstream of the protein-coding sequence, is known to participate in numerous regulatory processes, including transcript cleavage, stability and polyadenylation, translation, and mRNA localization. The 3' UTR serves as a binding site for many regulatory proteins to small non-coding RNAs (e.g., microRNAs).
[0004] p53 is a tumor suppressor protein encoded by the TP53 gene in the human body. As a tumor suppressor, p53 plays a crucial role in cancer prevention during the cell cycle of multicellular organisms.
[0005] In general, current mRNA therapies are neither tissue-specific nor dependent on native or standard UTR sequences that provide low levels of protein expression. In this regard, there is a need for novel UTRs and combinations thereof that can stabilize mRNA therapies and increase p53 protein synthesis. Summary of the Invention
[0006] Technical issues
[0007] One embodiment provides an isolated mRNA comprising a nucleotide sequence encoding a non-natural 5' untranslated region (5'UTR), a nucleotide sequence encoding p53 or a functional fragment thereof, and a nucleotide sequence encoding a 3'UTR, each of which is operatively linked to each other.
[0008] Another embodiment provides a method for obtaining p53 or a functional fragment thereof, the method comprising translating mRNA.
[0009] Another embodiment provides a composition containing mRNA as an active ingredient.
[0010] Another embodiment provides a composition for the prevention or treatment of cancer in a subject, the composition comprising mRNA as an active ingredient.
[0011] Another embodiment provides a method for utilizing mRNA, the method comprising introducing mRNA into a host cell.
[0012] Another embodiment provides DNA that encodes mRNA.
[0013] Another embodiment provides a method for obtaining RNA, the method comprising transcribing RNA using DNA as a template.
[0014] Technical solutions
[0015] The “5' untranslated region (5'-UTR)” used in this specification refers to the mRNA region that does not encode a polypeptide and is located directly upstream (i.e., 5') of the first codon (i.e., the start codon) of the mRNA transcript to be translated by the ribosome.
[0016] The “3' untranslated region (3'-UTR)” used in this specification refers to the mRNA region that does not encode a polypeptide and is located directly downstream (i.e., 3') of the stop codon (i.e., the termination codon) of the mRNA transcript that signals the termination of translation.
[0017] As used in this specification, "open reading frame (ORF)" or "sequence encoding a polypeptide" refers to a contiguous region of DNA that begins with a start codon (e.g., the methionine codon (ATG)) and ends with a stop codon (e.g., TAA, TAG, or TGA) and encodes a polypeptide.
[0018] As used in this specification, "polyadenylate sequence," "poly(A)," or "poly(A) tail" refers to an mRNA region containing multiple consecutive adenine nucleotides located downstream of the 3'-UTR (e.g., directly downstream of the 3'-UTR, i.e., 3'). A poly(A) tail may include 1,000, 500, 400, or 300 or less adenine nucleotides. For example, a poly(A) tail may include 10 to 300 adenine nucleotides. For example, the poly(A) tail may include 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 nucleotides. The poly(A) tail may include, for example, 50 to 250 adenine nucleotides. In vivo (e.g., in cells or subjects), the poly(A) tail can be used to protect mRNA from attack by enzymes (e.g., cytoplasmic enzymes) and facilitates the termination of transcription, the export of mRNA from the cell nucleus, and translation. The 3' poly(A) tail refers to a region (segment) of adenine nucleotide and is usually added to mRNA transcribed during mRNA processing or to immature mRNA.
[0019] The term "operatively linked" as used in this specification refers to the linking of nucleotide sequences on a single nucleic acid fragment such that one function is influenced by another. For example, when a promoter can influence the expression of a coding sequence (i.e., when transcription of the coding sequence is regulated by the promoter), the promoter is operatively linked to the coding sequence (e.g., an ORF). The coding sequence can be operatively linked to the regulatory sequence in either the sense or antisense direction. Unless otherwise stated in this specification, each nucleic acid sequence included in the claimed mRNA or DNA is operatively linked to each other.
[0020] Unless otherwise specified, the nucleotide sequence used in this specification is from the 5' end to the 3' end or located from the 5' end to the 3' end.
[0021] The terms "vector" or "nucleic acid construct" as used in this specification refer to any nucleic acid capable of carrying genes, ORFs, or DNA fragments into a cell. A vector can be, for example, a vector that can replicate within a cell. Vectors can be viruses, bacteriophages, proviruses, plasmids, phage particles, transposons, or artificial chromosomes (e.g., yeast artificial chromosome (YAC), bacterial artificial chromosome (BAC), plant artificial chromosome (PLAC)).
[0022] The first embodiment provides an mRNA comprising a non-natural 5' untranslated region (5'UTR), a sequence encoding a polypeptide, and a non-natural 3' untranslated region (3'UTR).
[0023] The 5'UTR does not form a secondary structure.
[0024] The sequence encoding the polypeptide is a sequence that encodes p53 or a functional fragment of p53, and
[0025] 3'UTR has a second-level structure represented by the following dot-bracket notation:
[0026] .(((((...........(((...(((((.(((....))).)))))...)))..(((((((..((((....((((((.(((((.......)))))..))).)))))))...))))))).......(((....)))............(((.........(((....))))))..)))));or
[0027] The following dot-bracket notation represents a second-level structure: ((((((((((((((...((((.((........((((((((((.........))))))))))))))))))))))).....(((...)))))))))))))))..((((((((((((....)))))))))))))))).....(((((((...)))))))))))...........
[0029] In the dot-bracket notation, a dot represents an unpaired base in the sequence, and parentheses and brackets "()" represent paired bases in the sequence. The term "secondary structure" as used in this specification refers to the combination of paired bases.
[0030] mRNAs including non-natural 5'UTRs may have a sequence of Formula 1:
[0031] Formula 1: AGN a GCCACC
[0032] Where N is A, U, G or C, each N is either identical or different from the others, and a represents multiple N and is 42 or 62.
[0033] mRNAs including the 3'UTR can have a mean free energy for RNA folding of -0.1 kcal / mol to -0.3 kcal / mol.
[0034] (a) The secondary structure of the mRNA including the 3'UTR, represented by .(((((...........(((((((((((.((.......) ...
[0035] (b) The secondary structure of mRNA including the 3'UTR, represented by ((((((((((((...((((........((((((((.........)))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).....((((((((...) ...
[0036] The 5'UTR may include a sequence identification number (SEQ ID NO): the nucleotide sequence of any one of 1 to 9.
[0037] In addition, the 3'UTR may include the nucleotide sequence of any of sequence identification numbers 10 to 17. A 3'UTR having the secondary structure shown in (a) may include the nucleotide sequence of any of sequence identification numbers 10 to 14. A 3'UTR having the secondary structure shown in (b) may include the nucleotide sequence of any of sequence identification numbers 15 to 17.
[0038] The sequence that encodes p53 or its functional segments can be operatively linked to the 5'UTR and 3'UTR, and thus can be translated into p53 or its functional segments.
[0039] p53 or its functional fragments may possess cancer-preventive or therapeutic activities. p53 or its functional fragments may also exhibit activity as tumor suppressors. For example, tumor suppressors participate in regulating the cell cycle of cancer cells and thus possess anti-cancer activity. Furthermore, p53 or its functional fragments with anti-cancer activity can inhibit the proliferation of cancer cells. p53 or its functional fragments may be recombinant p53 or its functional fragments containing fusion proteins.
[0040] p53 plays a crucial role in several processes, including cell cycle regulation and apoptosis control. p53 mutations frequently occur in tumor cells and are associated with cancer progression and the development of resistance to chemotherapy and radiotherapy. In vitro and in vivo preclinical studies have shown that restoration of wild-type p53 function can induce apoptosis in cancer cells. In animal models containing wild-type p53 constructs with retroviruses or adenoviruses, intratumoral injection resulted in tumor regression in various tumor tissues, including non-small cell lung cancer (NSCLC), leukemia, glioblastoma, breast cancer, liver cancer, ovarian cancer, colon cancer, and kidney cancer.
[0041] The sequence encoding the polypeptide can be codon-optimized by encoding p53 or a functional fragment thereof. Codon optimization can vary depending on the host cell into which the sequence is introduced. Furthermore, the sequence can encode the polypeptide and may include degenerate sequences.
[0042] The nucleotide sequence encoding the p53 polypeptide may include a sequence encoding an amino acid sequence of sequence identification number 25, such as the nucleotide sequence of sequence identification number 22.
[0043] RNA yield can be synergistically increased when the 3'UTR is combined with the 5'UTR. RNA yield can also be synergistically increased when the 3'UTR is combined with a sequence encoding a polypeptide and a 5'UTR. In mRNA, to enhance the expression of p53 or its functional fragments, the 5'UTR of a nucleotide sequence with sequence identification numbers 1 to 9 can be combined with the 3'UTR of a nucleotide sequence with sequence identification numbers 10 to 17. For example, the combinations of 5'UTR and 3'UTR can be as follows: 5'UTR of sequence identification number 1 with the 3'UTR of any of sequence identification numbers 10 to 17; 5'UTR of sequence identification number 2 with the 3'UTR of any of sequence identification numbers 10 to 17; 5'UTR of sequence identification number 3 with the 3'UTR of any of sequence identification numbers 10 to 17; 5'UTR of sequence identification number 4 with the 3'UTR of any of sequence identification numbers 10 to 17; 5'UTR of sequence identification number 5... The 5' UTR of sequence number 6 and the 3' UTR of sequence number 10 to 17; the 5' UTR of sequence number 6 and the 3' UTR of sequence number 10 to 17; the 5' UTR of sequence number 7 and the 3' UTR of sequence number 10 to 17; the 5' UTR of sequence number 8 and the 3' UTR of sequence number 10 to 17; and the 5' UTR of sequence number 9 and the 3' UTR of sequence number 10 to 17. Compared to mRNAs including the C3 3' UTR or P450 2E1 3' UTR of sequence number 18 or 19, the mRNA showed increased transcription or translation efficiency. Compared to mRNAs including the C3 5' UTR of sequence number 26, the mRNA showed increased transcription or translation efficiency.
[0044] mRNA may also include expression regulatory sequences. These sequences may be involved in translation regulation or mRNA stability. Expression regulatory sequences may be Kozak or A-sequence sequences.
[0045] Nucleotide sequences encoding the 5'UTR, sequences encoding peptides, nucleotide sequences encoding the 3'UTR, and expression regulatory sequences can be transcribed in vitro or in vivo and can form shared transcripts.
[0046] Nucleotide sequences encoding the 5'UTR, sequences encoding peptides, nucleotide sequences encoding the 3'UTR, and expression regulatory sequences can be linked together in an operable manner.
[0047] Compared to the use of natural 5'UTR and / or natural 3'UTR, 5'UTR or 3'UTR may have the activity of improving translation yield, RNA stability, or a combination thereof.
[0048] In embodiments, the mRNA may include a “5’-cap,” such as Cap 0 (Cap 0), Cap 1 (Cap 1), or Cap 2 (Cap 2). The term “5’-cap” refers to a cap structure found at the 5’ end of the mRNA molecule. The 5’-cap is typically a 7-methylguanine ribonucleotide linked to the mRNA via a 5’ triphosphate at the 5’ position of the first nucleotide in the 5’ to 3’ strands. In Cap 0, the ribose at both the first and second cap-proximal nucleotides of the mRNA may include a 2’-hydroxyl group. In Cap 1, the ribose at both the first and second cap-proximal nucleotides of the mRNA may include a 2’-methoxy group and a 2’-hydroxyl group, respectively. In Cap 2, the ribose at both the first and second cap-proximal nucleotides of the mRNA may include a 2’-methoxy group. The 7-methylguanine ribonucleotide may be further modified. For example, in a modified 7-methylguanine ribonucleotide, the 7-methylguanine 3'-methoxy (7mG(3'OMe)) or the 2'-hydroxyl and 3'-hydroxyl groups can each be independently substituted with sulfonyl groups selected from the group consisting of mesyl, esyl, triflyl, tresyl, tosyl, brosyl, nosyl, and dansyl groups. The modified 7-methylguanine ribonucleotide substituted with sulfonyl groups can be, for example, 7-methylguanine 3'-methoxy (7mG(3'OMs)). Most endogenous mRNAs in higher eukaryotes, including mammalian mRNAs (e.g., human mRNAs), may have a cap 1 or a cap 2. Cap 0 and other cap structures different from cap 1 and cap 2 may be immune in mammals (e.g., humans).
[0049] This type of cap can be introduced co-transcriptionally. For example, a 5'-cap or a 5'-cap analogue can be introduced into RNA at the start of transcription while the DNA template is transcribed in vitro in the presence of the 5'-cap or 5'-cap analogue. Furthermore, this type of cap can be introduced post-transcriptionally. A 5'-cap or a 5'-cap analogue can be introduced into RNA post-transcriptionally using a capping enzyme (e.g., a capping enzyme from vaccinia virus). The resulting 5'-terminal sequence with a 5'-terminal cap structure may include, for example, 7mG(5')ppp(5')ApG, m7G(3'OMe)(5')ppp(5')ApG, m7G(3'OMe)(5')ppp(5')(2'OMeA)pG, m7G(3'OMs)(5')ppp(5')(2'OMeA)pG, or m7G(5')ppp(5')(2'OMeA)pG.
[0050] In embodiments, the mRNA may include modified nucleotides. In embodiments, the mRNA may have at least one U substituted with N1-methyl-pseudouridine. In the mRNA, the resulting 5'-terminal sequence with a 5'-terminal cap may have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG. In the mRNA, all Us may be substituted with N1-methyl-pseudouridine. In the mRNA, all Us may be substituted with N1-methyl-pseudouridine, and the resulting 5'-terminal sequence with a 5'-terminal cap may have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG.
[0051] The mRNA may include the nucleotide sequence of the 5' UR of any of sequence identification numbers 1 to 9, the nucleotide sequence encoding p53 (e.g., the nucleotide sequence encoding the amino acid sequence of sequence identification number 25), and the nucleotide sequence of the 3' UR of any of sequence identification numbers 10 to 17. The mRNA may include at least one U substituted with N1-methyl-pseudouridine in the sequence. In the mRNA, the 5'-terminal sequence may have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG. In the mRNA, all Us may be substituted with N1-methyl-pseudouridine. In mRNA, all U values can be substituted with N1-methyl-pseuuridine, and the 5'-terminal sequence can have a cap structure of m7(3'OMeG)(5')ppp(5')(2'OMeA)pG or m7(3'OMsG)(5')ppp(5')(2'OMeA)pG. However, the 5'-cap structure of mRNA is not limited to this structure and can be substituted with a natural 5'-cap structure or a 5'-cap analogue known in the art.
[0052] The second embodiment provides a method for obtaining p53 or a functional fragment thereof, the method comprising translating mRNA.
[0053] The method may include generating p53 or a functional fragment thereof by culturing cells containing the mRNA.
[0054] The third embodiment provides a composition containing mRNA as an active ingredient.
[0055] The composition can be used to deliver mRNA or p53 or a functional fragment thereof expressed by mRNA to a subject. Delivery can be used to prevent or treat cancer in the subject.
[0056] The fourth embodiment provides a composition for the prevention or treatment of cancer in a subject, the composition comprising mRNA as an active ingredient.
[0057] Cancer may include p53 mutations. Cancer can be caused by mutated p53. The cancer may be a cancer and / or its metastases that can be treated, alleviated, suppressed, improved, and / or prevented by supplementing wild-type p53 or functional fragments thereof.
[0058] The composition may be used to treat, alleviate, inhibit, improve, and / or prevent cancer and / or its metastases in a subject. Subjects may be mammals, including humans.
[0059] The composition can be administered to a subject, and then the RNA (e.g., mRNA) can be translated in vivo to produce a therapeutic peptide (i.e., p53 or a functional fragment thereof).
[0060] The components can deliver an "effective amount" of mRNA to cells, tissues, or subjects.
[0061] The effective dose can be determined based on the target tissue, target cells, administration method, physical properties of the RNA (e.g., RNA size and amount of modified nucleosides), and other components of the composition.
[0062] The composition can be administered via intramuscular, subcutaneous, intradermal, intranasal, or pulmonary administration.
[0063] The composition may include at least one pharmaceutically acceptable carrier or excipient. In the composition, RNA may be formulated together with or in combination with the carrier or excipient. The carrier or excipient may be those known in the art.
[0064] The relative amounts of the active ingredient, pharmaceutically acceptable carrier, excipients, and / or other additional components contained in the composition may vary depending on the identity, size and / or condition of the person to be treated, and / or route of administration. For example, the composition may contain 0.1% to 100%, such as 0.5% to 50%, 1.0% to 30%, 5.0% to 80%, or 80% (w / w) or more of the active ingredient.
[0065] The composition may be formulated as nanoparticles. The nanoparticles may be nanoparticles known in the art for delivering polynucleotides (e.g., mRNA) into cells. For example, the nanoparticles may be nanoparticles known to be used in RNA vaccines. The nanoparticles may be lipid nanoparticles (LNPs). The composition may be formulated as or bound to lipid nanoparticles (LNPs). Binding may include binding to or to the surface of an LNP. For example, the composition may be formulated within or bound to a lipid polycation complex. Lipid polycation complexes are also referred to as cationic lipid nanoparticles. Polycations may include MC3, Lipid 319, C12-200, 5A2-SC8, 306Oi10, Moderna Lipid 5, Acuitas A9, SM-102, ALC-0315, Arcturus Lipid 2,2 (8,8) 4C CH3, Genevant CL1, or cationic peptides (e.g., polylysine, polyguanine, and / or polyarginine). In addition, the composition may be formulated together with or bound to an LNP, said LNP including 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dipalmitoylphosphatidylcholine (DPPC), sterols (e.g., cholesterol), or non-cationic lipids (e.g., dioleoylphosphatidylethanolamine (DOPE)). In addition, the composition may be formulated together with or incorporated into the LNP including polyethylene glycol (PEG) lipids (e.g., 1,2-dimyristic-rac-glycerol-3-methoxy polyethylene glycol-2000 (PEG2000-DMG), 2-[(polyethylene glycol)-2000]-N,N-bistetradecylacetamide (ALC-0159) and polyethylene glycol dimethacrylate (PEG-DMA)).
[0066] LNP formulations may include cationic lipids, phospholipids, sterols (e.g., cholesterol), PEG-lipids, or combinations thereof. LNP formulations may include, for example, cationic lipids, phospholipids, sterols (e.g., cholesterol), and PEG-lipids. Furthermore, LNPs may include PEG-modified lipids, non-cationic lipids, sterols, ionizable lipids, or combinations thereof. LNPs may include 0.5 mol% to 15 mol% of PEG-modified lipids, 5 mol% to 25 mol% of non-cationic lipids, 25 mol% to 55 mol% of sterols, and 20 mol% to 60 mol% of ionizable lipids. PEG-modified lipids may be PEG2000-DMG, non-cationic lipids may be DSPC, sterols may be cholesterol, and ionizable cationic lipids may be compounds having the following structure:
[0067]
[0068] (Compound 1).
[0069] PEG-modified lipids can be compound 2 (ALC-0159) with the following structure, non-cationic lipids can be DSPC, sterols can be cholesterol, and ionizable cationic lipids can be compound 3 (ALC-0315) with the following structure:
[0070]
[0071] (Compound 2); and
[0072]
[0073] (Compound 3).
[0074] The composition may be a composition used to prevent or treat cancer in subjects, including mRNA and lipid nanoparticles (LNPs) as active ingredients.
[0075] The fifth embodiment provides a method for using mRNA, the method comprising introducing mRNA into a host cell.
[0076] In this method, the host cell can be any cell derived from the subject. The subject can be a mammal, including humans. The cell can be, for example, any cancer cell.
[0077] The method may include administering mRNA to a subject. Administering may be parenteral or oral. Administering may be intramuscular, subcutaneous, intradermal, intranasal, or pulmonary. The subject may be a mammal, including humans.
[0078] The method described herein can be used to induce prevention or treatment of cancer in a subject. The cancer is the same as that described above.
[0079] In the method described, the application can be intramuscular, subcutaneous, intradermal, intranasal, or pulmonary.
[0080] It can be administered in an "effective amount" for the prevention or treatment of cancer.
[0081] The sixth embodiment provides DNA encoding mRNA.
[0082] The DNA may also include a sequence for introducing a transcribed nucleotide sequence. The sequence for introducing the transcribed nucleotide sequence may be operatively linked to the 3'UTR upstream of the nucleotide encoding the 3'UTR. The sequence for introducing the transcribed nucleotide sequence may be a cloning site. The cloning site may be a multiple cloning site. The cloning site may include a restriction enzyme recognition site, a cleavage site, or a combination thereof.
[0083] DNA may also include a promoter sequence. The promoter can be operatively linked to the 5'UTR upstream of the nucleotide encoding the 5'UTR.
[0084] When transcription occurs in vitro or in vivo, the promoter, the nucleotide sequence encoding the 5'-UTR, the sequence encoding the polypeptide or the nucleotide sequence used to introduce transcribed nucleotides, and the nucleotide sequence encoding the 3'-UTR can link together to form a shared transcript.
[0085] DNA can be used as a nucleic acid construct or vector. DNA can be used as an expression vector or a cloning vector.
[0086] The seventh embodiment provides a method for obtaining RNA, the method comprising transing RNA using DNA as a template. Transcription may include in vitro transcription, ex vivo transcription, or in vivo transcription. In vivo transcription may include transcription occurring in a subject.
[0087] The term "in vitro transcription" or "RNA in vitro transcription" refers to the process of synthesizing RNA, including mRNA, in a non-cellular system, i.e., in vitro. Cloning vector DNA, including plasso DNA vectors, can be used as templates for producing RNA transcripts. Generally, these cloning vectors are also called transcription vectors. RNA can be obtained through DNA-dependent in vitro transcription using a suitable DNA template. The DNA template can be a linearized plasso DNA template. The promoter controlling RNA in vitro transcription can be any promoter of a DNA-dependent RNA polymerase. DNA-dependent RNA polymerases can be T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, or combinations thereof. The DNA template for RNA in vitro transcription can be obtained by cloning nucleic acids and introducing them into a vector for RNA in vitro transcription. The DNA can include complementary DNA (cDNA) corresponding to each RNA to be transcribed in vitro. The vector for RNA in vitro transcription can be circular plasso DNA. cDNA can be obtained through reverse transcription of mRNA or through chemical synthesis.
[0088] Transcription vectors may include a promoter, a nucleotide sequence encoding the 5'-UTR, a sequence encoding a polypeptide (e.g., an open reading frame (ORF)), a nucleotide sequence encoding the 3'-UTR, and a poly(A) tail. Transcription vectors may also include an origin of replication (e.g., the *E. coli* origin of replication ColE1 ori), a selection marker gene, or a combination thereof. The promoter may be a T7 promoter. The selection marker may be an antibiotic resistance enzyme (e.g., kanamycin resistance enzyme).
[0089] In vitro transcription may include obtaining transformed host cells by introducing a transcription vector into host cells (e.g., *E. coli*) and proliferating the host cells by culturing them, wherein the host cells include plasso DNA that serves as a template for mRNA. In vitro transcription may include isolating plasso DNA from self-proliferating host cells (e.g., *E. coli*). Isolation of plasso DNA may include isolating cell layers from culture and isolating plasso DNA from cell layers. Isolation of cell layers may be performed by centrifugation, separation, precipitation, or a combination thereof. Isolation of plasso DNA from cells may be performed by methods known in the art, such as alkaline extraction, affinity chromatography, high-performance liquid chromatography (HPLC), electrophoresis, or a combination thereof.
[0090] RNA can be obtained by culturing cells containing DNA to produce RNA transcripts of DNA.
[0091] Beneficial effects
[0092] According to one embodiment, the mRNA is relatively stable and has a high yield, and therefore can be used for efficient transcription and translation of mRNA.
[0093] According to another embodiment of the method for obtaining polypeptides, p53 and its functional fragments can be obtained efficiently.
[0094] According to another embodiment, a composition for delivering mRNA or p53 expressed by mRNA to a subject can be used to deliver mRNA or p53 expressed by mRNA to a subject.
[0095] According to another embodiment, the composition for preventing or treating cancer can be used to efficiently immunize or treat a subject.
[0096] According to another embodiment, the method utilizing RNA can be used to prevent or treat cancer in a subject.
[0097] According to another embodiment, DNA can be used to obtain mRNA.
[0098] According to another embodiment of the method for obtaining RNA, RNA can be obtained efficiently. Attached Figure Description
[0099] Figure 1 This is a graph showing the results confirming the inhibitory effect of p53 mRNA produced in each cancer cell on growth and development.
[0100] Figure 2 This is a graph showing the changes in tumor size and body weight when p53 mRNA anticancer candidate substances are administered to a mouse model of ovarian cancer xenograft.
[0101] Figure 3 This is a graph showing the changes in tumor size and body weight when p53 mRNA anticancer candidate substances are administered to a mouse model of pancreatic cancer xenograft.
[0102] Figure 4 This is a graph showing the changes in tumor size and body weight when p53 mRNA anticancer candidate substances are administered to a lung cancer xenograft mouse model. Detailed Implementation
[0103] The present disclosure will be illustrated in more detail below with examples. However, these examples are intended to illustrate the present disclosure, and the scope of the disclosure is not limited to these examples.
[0104] Example 1: Unconstructed 5'UTR non-natural sequences that increase gene yield
[0105] In this example, a 5'UTR sequence that increases gene yield was selected. The 5'UTR sequence is a non-natural sequence that does not exist in nature and does not form secondary structures. Compared to natural sequences, the 5'UTR sequence has the activity of increasing gene yield.
[0106] First, select random, non-natural sequences with a length of 50 or 70 base pairs (bp) and an average free energy of 0, and select sequences that do not form secondary structures between bases.
[0107] The selected mRNA sequence was designed to begin with “AG” to protect the 5' end for capping optimization and end with “GCCACC” as a cozac sequence for stable gene expression.
[0108] First, sequences with excellent activity in increasing gene yield were selected. Based on these sequences, some base sequences were replaced to improve the activity of increasing gene yield, and thus nine non-natural sequences were ultimately selected (Table 1).
[0109] [Table 1]
[0110]
[0111] Sequence identification number: Each nucleotide in the nucleotide sequence from 1 to 9 may be modified from a naturally occurring nucleotide. For example, at least one U in the sequence may be substituted with N1-methyl-pseudouridine. In the sequence, all Us may be substituted with N1-methyl-pseudouridine.
[0112] Example 2: 3'UTR non-natural sequences of specific structures that increase gene yield
[0113] In this example, a non-natural 3'UTR sequence is selected, which forms a structure similar to the natural 3'UTR structure with excellent activity of increasing gene yield, and has the activity of increasing gene yield compared to the natural 3'UTR structure.
[0114] As the natural 3'UTR, the human complement component 3 (C3) 3'UTR (sequence identification number: 18) or the human cytochrome P450 2E1 3'UTR (sequence identification number: 19) was used, both known to have excellent activity in increasing gene yield. Specifically, random sequences of the same length as the human C3 3'UTR or the human cytochrome P450 2E1 3'UTR were constructed, and sequences with secondary structures similar to those of the human C3 3'UTR or the cytochrome P450 2E1 3'UTR were selected.
[0115] Regarding the selected mRNA sequences, a process was performed to remove potentially AU-rich element (hereinafter referred to as "ARE") sequences that could cause mRNA instability, and then, finally, eight non-natural 3'UTR sequences were selected (Table 3).
[0116] Natural C3 3'UTR sequence (Sequence identification number: 18 - length 178 nucleotides):
[0117] CCACACCCCCAUUCCCCCACUCCAGAUAAAGCUUCAGUUAUAUCUCACGUGUCUGGAGUUCUUUGCCAAGAGGGAGAGGCCAGAAAUCCCCAGCCGCCUCACCUGCAGCUCAGCUCCAUCCUACUUGAAACCUCACCUGUUCCCACCGCAUUUUCUCCUGGCGUUCGCCCGCUAGUGUG
[0118] Secondary structure of the natural C3 3'UTR sequence (represented by dotted bracket notation): .(((((...........((((((((((((.......)))).))))))...)))..(((((((..(((((....(((((((((.......))))))..) ...
[0120] Non-natural sequences (sequence identification numbers: 10 to 14) with structures similar to the natural C3 sequence were designed to have a GC% of 40% to 50% and a mean free energy for RNA folding of -0.1 kcal / mol to -0.3 kcal / mol.
[0121] Natural cytochrome P450 2E1 3' UTR sequence (Sequence identification number: 19 - length 158 nucleotides):
[0122] GUGUGUGGAGGACCUGAACCCCCGCUUUCAAACAAGUUUUCAAAUUGUUUGAGGUCAGGAUUUCUCAAACUGAUUCCUUUCUUUGCAUAUGAGUAUUUGAAAAUAAAUAUUUUCCCAGAAUAUAAAUAAAUCAUCACAUGAUUAUUUUAACUAU
[0123] Secondary structure of the natural cytochrome P450 2E1 3'UTR sequence ((((((((((((((...((((.((........((((((((((.........))))))))))))))))))))))).....(((...)))))))))))))))..((((((((((((....)))))))))))))))).....(((((((...)))))))))))...........
[0125] Non-natural sequences (sequence identification numbers: 15 to 17) with structures similar to the natural human cytochrome P450 2E1 3'UTR sequence were designed to have a GC% of 30% to 40% and a mean free energy for RNA folding of -0.1 kcal / mol to -0.3 kcal / mol.
[0126] [Table 2]
[0127]
[0128] RNA folding energy provides insights into secondary structure and its stability. For example, the minimum free energy can be used to predict the secondary structure and stability of the 3' UTR, which may affect translation yield.
[0129] Example 3: Preparation of template vectors using non-natural 5'-UTR and 3'-UTR sequences
[0130] In this example, the vector was prepared by operatively linking the following sequences: one of the sequences encoding a non-natural 5'UTR nucleotide sequence including a nucleotide sequence of sequence identification numbers 1 to 9 or sequence identification number 26 obtained in Examples 1 and 2; one of the sequences encoding a 3'UTR nucleotide sequence including a nucleotide sequence of sequence identification numbers 10 to 17 or sequence identification numbers 18 or 19 of C3 3'UTR or P450 2E1 3'UTR; and a gene encoding a polypeptide (wild-type p53 protein, sequence identification number 25).
[0131] Specifically, a vector is a vector containing a promoter, a nucleotide sequence encoding the 5'-UTR, an open reading frame (ORF) encoding the polypeptide, a nucleotide sequence encoding the 3'-UTR, and a poly(A) tail.
[0132] The vector may also include the E. coli origin of replication ColE1 ori and a selection marker gene. The promoter may be the T7 promoter. The selection marker may be a conomycin resistance enzyme.
[0133] 3-1. Preparation of template vectors for transcribing natural p53 and p53 mRNA
[0134] A vector for expressing natural p53 mRNA and / or its protein is prepared, comprising one of the nucleotides encoding a designed non-natural 5'UTR sequence, a nucleotide sequence encoding the natural p53 protein as an ORF, one of the nucleotide sequences encoding the non-natural 3'UTR, and poly(A). This vector is introduced into microbial cells, and cloning of the microbial cells is performed to produce a cloning vector. mRNA is generated by in vitro transcription using the generated vector as a template.
[0135] Specifically, since pUC57-Amp R The vector (Addgene) generates the vector pUC57-Kan. R In the pUC57-Kan vector R The antibiotic resistance gene was replaced by the conjugated cytokine resistance gene. The resulting pUC57-Kan antibiotic resistance gene was substituted using restriction enzymes HindIII and EcoRI. RThe vector is processed and cleaved, and then ligated with a ligase to insert a synthetic polynucleotide encoding the native p53 protein, thereby inserting the sequence encoding the native p53 protein. Since the inserted polynucleotide encoding the native p53 protein includes both the nucleotide sequence encoding the 5'UTR and the sequence encoding the native p53 protein, and the restriction enzyme recognition sequence is located at the 3' end of the native p53 nucleotide sequence, the restriction enzyme recognition sequence is cleaved to introduce the nucleotide sequence encoding the designed 3'UTR.
[0136] [Table 3]
[0137]
[0138] Table 3 shows the prepared pUC57-Kan R The vector includes a promoter (Sequence Identification Number: 20), a polynucleotide encoding the 5' UTR (Sequence Identification Number: 21), a polynucleotide encoding the native p53 protein (Sequence Identification Number: 22), a polynucleotide encoding the 3' UTR (Sequence Identification Number: 23), and a poly(A) sequence (Sequence Identification Number: 24). In Table 3, the underlined nucleotides in Sequence Identification Number: 20 represent a portion of the T7 promoter involved in the initiation of mRNA transcription. Furthermore, the bold nucleotides in Sequence Identification Number: 21 represent the 5' UTR sequence derived from the native human C3 5' UTR sequence. Additionally, Sequence Identification Number: 22 is the nucleotide sequence encoding the native p53 protein as a downstream nucleotide sequence of the 5' UTR. The native p53 protein has the amino acid sequence of Sequence Identification Number: 25. Furthermore, Sequence Identification Number: 23 is the native 3' UTR sequence of the human cytochrome P4502E1 gene.
[0139] 3-2. Ligation and cloning of the non-natural 5' UTR sequence with the nucleotide sequence encoding the native p53 protein.
[0140] To replace the 5'UTR sequence of the prepared template vector with a nucleotide sequence encoding a non-natural 5'UTR sequence, a DNA fragment containing a nucleotide sequence encoding the 5'UTR is obtained by polymerase chain reaction (PCR). The PCR reaction uses a primer set consisting of a primer containing a nucleotide sequence encoding the non-natural 5'UTR sequence and a primer containing a sequence containing the XhoI restriction enzyme recognition sequence of the natural p53 protein, and uses the template vector as a template.
[0141] Each of the DNA fragments containing nucleotide sequences encoding the 5'-UTR fixed by PCR and the template vector prepared in Example 3-1 were processed and cleaved using restriction enzymes HindIII and XhoI, and the cleaved sequences were ligated using a ligase. Thus, a vector encoding the native p53 protein was prepared, in which the nucleotide sequence encoding the 5'-UTR was replaced with a nucleotide sequence encoding the non-native 5'-UTR of any of the sequence identification numbers: 1 to 9.
[0142] 3-3. Cloning of non-natural 3'UTR sequences
[0143] In this example, non-natural 3'UTRs with sequence identification numbers 10 to 17 are cloned to improve expression levels and increase sequence stability of genes encoding mRNA. The 3'UTR may include XhoI (CTCGAG) and NheI (GCTAGC) restriction enzyme sequences located at the upstream 5' end and downstream 3' end, respectively, for recombination of nucleic acids (e.g., transcribed nucleic acid sequences or polyadenylated sequences). The transcribed nucleic acid sequence may be an open reading frame (ORF). The 3'UTR sequence may be linked to the 3' end of the ORF via an XhoI restriction enzyme present at the 5' end of the transcribed nucleic acid sequence.
[0144] A recombinant 3'UTR sequence, comprising an XhoI restriction enzyme sequence, a non-natural 3'UTR sequence, and an NheI restriction enzyme sequence, was synthesized using an in vitro nucleic acid synthesis method. The obtained recombinant 3'UTR sequence was DNA. Each component of the recombinant 3'UTR sequence and the template vector were processed and cut using the restriction enzymes XhoI and NheI, and the two cut sequences were ligated using a ligase. The vectors used in Examples 3-1 and 3-2 were used as template vectors.
[0145] Therefore, a vector for p53 expression was prepared, in which the T7 promoter-5'UTR encoded nucleotide sequence-p53 protein-coding sequence-3'UTR encoded nucleotide sequence-poly(A) structure was introduced into pUC57-Kan R Within the skeleton of the carrier.
[0146] Example 4: Generating gene products using non-natural 5'-UTR and 3'-UTR sequences
[0147] The vector prepared in Example 3, having a T7 promoter-5'UTR-p53 protein-coding sequence-3'UTR-poly(A) structure, was introduced into *E. coli*, and the *E. coli* were cultured to proliferate *E. coli* containing plasso DNA as a template for mRNA. The proliferated *E. coli* were isolated from the culture by high-speed centrifugation, and the cell-derived template DNA was fixed using an alkaline extraction method known in the art. The fixed template DNA was linearized using a restriction enzyme recognition sequence located at the end of the poly(A) tail. mRNA with a nucleotide sequence having a 5'UTR-p53 protein-coding sequence-3'UTR-poly(A) structure was generated via in vitro transcription using the linearized cell-derived template DNA. Here, the 5'UTR has a sequence of any one of sequence identification numbers 1 to 9 or a sequence of the natural C3 5'UTR, the 3'UTR has a sequence of any one of sequence identification numbers 10 to 17 or a sequence of the natural C3 3'UTR or the natural CYP 2E1 3'UTR, and the sequence encoding the p53 protein has a sequence identification number 22. The sequence with sequence identification number 22 is one of the nucleotide sequences encoding the p53 protein with sequence identification number 25, and any nucleotide sequence encoding the p53 protein can be used.
[0148] Specifically, 5 μg / μL of T7 RNA polymerase was added to an aqueous solution containing 10 ng / µL linearized plasso DNA, 4 mM / L capping reagent, 5 mM / L adenosine triphosphate (ATP), 5 mM / L cytidine triphosphate (CTP), 5 mM / L guanosine triphosphate (GTP), 5 mM N1-methylpseudouridine-5'-triphosphate, 20 mM magnesium ion salt, 10 mM dithiothreitol (DTT), 0.01 μg / µL pyrophosphatase (PPase), and 1 μg / µL RNase inhibitor. The resulting reaction mixture was then incubated at 37°C for at least one hour for in vitro transcription. The capping analog compound m7G(3'OMs)pppA(2'OMe)pG, as described in Example 8 as set forth in 10-2023-0141482 published on October 10, 2023, was used as the capping agent.
[0149] The capping reagent is used for mRNA transcription and co-transcriptional capping, forming a 5'-cap structure of m7G(3'OMs)pppA(2'OMe)pG. Here, m7G represents 7-methylguanosine, A represents adenosine, G represents guanosine, p is -P(=O)(OH)O-, Ms represents methanesulfonyl, and Me represents methyl. The reaction product was treated with deoxyribonuclease (DNase), and the RNA was purified using the Monarch® RNA Cleanup Kit (New England Biolabs).
[0150] Therefore, a vector for p53 expression was prepared, in which the T7 promoter-5'UTR encoded nucleotide sequence-p53 protein-coding sequence-3'UTR encoded nucleotide sequence-poly(A) structure was introduced into pUC57-Kan R Within the skeleton of the carrier.
[0151] Example 5: Confirming the effect on cell survival in cancer cells with p53 mutations
[0152] The effects of the p53 mRNA prepared in Example 4 on cancer cells with p53 mutations were confirmed. The p53 mRNA used in this study has a 5'UTR (Sequence Identification Number: 6) - p53 protein-coding sequence (Sequence Identification Number: 25) - 3'UTR (Sequence Identification Number: 11) - poly(A) (Sequence Identification Number: 24) structure (Sequence Identification Number: 27). ES-2 (ATCC, #CRL-1978), Mia-PaCa-2 (ATCC, #CRL-1420), H1299 (Korean Cell Line Bank, #KCLB25803), and SNU-1066 (Korean Cell Line, #KCLB01066) were used as cancer cells with p53 mutations. ES-2 is a p53 S241F mutant ovarian cancer cell line exhibiting a fibroblast-like morphology isolated from the ovaries of Black women with clear cell carcinoma. Mia-Paka-2 is a p53R248W mutant pancreatic cancer cell line, an epithelial cell line derived from tumor tissue of the pancreas in Caucasian men. H1299 (NCI-H1299) is a lung cancer cell line with a p53 deletion mutation. H1299 is an epithelial-like cell isolated from a Caucasian male lung cancer patient and may belong to the large cell carcinoma subtype of non-small cell lung cancer. SNU-1066 is p53 514_559del46, a mutant head and neck cancer cell line, and a laryngeal squamous cell carcinoma cell line.
[0153] Specifically, p53 mRNA was delivered to each cancer cell line using Lipofectamine™ MessengerMAX™ Transfection Reagent (Thermo Scientific™, catalog number LMRNA001), and its effect on cell survival was confirmed. In 96-well plates, p53 mRNA was transfected at 3 × 10⁻⁶ cells / well. 3 Cells / 200 μL per well, 6 × 10 3 Cells / 200 μL per well, 5 × 10 3 Cells / 200 μL per well and 10 × 10 3ES-2, Mia-Pac-2, H1299, and SNU-1066 cells were seeded at 200 μL per well. 24 hours post-seeding, mRNA and 0.2 μL of Lipofectamine™ MessengerMAX™ Transfection Reagent were added to each well. p53 mRNA was then tested at eight concentrations (starting at 4 μg / mL and decreasing by 1 / 4).
[0154] Cell viability was measured using the WST-8 cell viability assay kit (BIOMAX, catalog number QM5000). To determine cell growth, the drug treatment date was set to day 0, and the WST-8 reagent was mixed with the culture medium at a 1:10 ratio and reacted for 2 hours in cells seeded individually the previous day. The absorbance was then measured at 450 nm. Drug-treated plates were incubated at 37°C for 3 days. After incubation, the WST-8 reagent was mixed with the cell culture medium at a 1:10 ratio and reacted for 2 hours. The absorbance was measured at 450 nm using a Graphpad prism. TM Software is used to calculate the half maximal growth inhibition concentration (GI). 50 The relative cell growth rate was determined by correcting for the values on day 0 and the blank OD value compared to the negative control group in which p53 mRNA was not treated.
[0155] As a result of confirming the growth-inhibiting ability of p53 mRNA in each cell, it was confirmed that p53 mRNA inhibits the growth of ovarian cancer, pancreatic cancer, lung cancer, and head and neck cancer cell lines with p53 gene defects. Figure 1 ).
[0156] Example 6: Evaluation of the anticancer efficacy of p53 mRNA anticancer candidate in an ovarian cancer xenograft model
[0157] To evaluate the anticancer efficacy of p53 mRNA as disclosed herein, p53 mRNA was administered to a mouse model of ovarian cancer with xenografted ES-2 cells, and changes in tumor size were observed. In the treatment groups, p53 mRNA was administered three times weekly (7.5 μg / head, 15 μg / head, and 30 μg / head) for 4 weeks.
[0158] Specifically, ES-2 cells (ATCC) were subcutaneously injected into the dorsal side of 5-week-old BALB / c nude mice. Tumors were observed visually several days later, and their size was monitored. At the start of administration, six mice with similar tumor sizes were assigned to each group. The administration group received the cells intravenously. During the experimental period, mouse weight and tumor size were measured two to three times per week. Tumor size was measured using digital calipers to determine the longest length and longest width, and then calculated according to the following equation.
[0159] Tumor size (millimeters) 3 ): Width (mm) × Width (mm) × Length (mm) / 2
[0160] Tumor size was observed in each group until day 21 from the start of administration, and tumor size measured in each subsequent experiment was calculated in the same manner.
[0161] When administered to mice with an ovarian cancer xenograft model, the p53 mRNA anticancer therapeutic agent not only showed significant tumor growth inhibition efficacy in the ES-2 xenograft model compared to the control group (administered via empty LNP), but also... Figure 2 (A), and the mice did not lose weight after 3 weeks of continuous mRNA administration, suggesting it is safe in terms of side effects. Figure 2 (B). On day 21 after administration, the tumor inhibition capacity in the 7.5 μg, 15 μg and 30 μg administration groups was calculated to be 54.8%, 62.8% and 78.9%, respectively, confirming that the anticancer efficacy is dose-dependent.
[0162] Example 7: Evaluation of the anticancer efficacy of p53 mRNA anticancer candidate in a pancreatic cancer xenograft model
[0163] To evaluate the anticancer efficacy of p53 mRNA as disclosed herein, p53 mRNA was administered to a mouse model of pancreatic cancer in which Mia-Paka-2 cells were xenografted, and changes in tumor size were observed. In the treatment group, p53 mRNA was administered three times a week (6 times in total, 30 μg / mouse) for 4 weeks.
[0164] Specifically, Mia-Pac-2 cells (ATCC) were subcutaneously injected into the dorsal side of 5-week-old BALB / c nude mice. Tumors were observed macroscopically several days later, and tumor size was monitored. At the start of administration, seven mice with similar tumor sizes were assigned to each group. The administration groups received either intratumoral (IT) administration (6 μg / mouse) or intravenous (IV) administration (30 μg / mouse). Throughout the experimental period, mouse body weight and tumor size were measured two to three times weekly, and tumor size was monitored in each group until day 29 from the start of administration.
[0165] When administered to mice with a pancreatic cancer xenograft model, the p53 mRNA anticancer therapeutic agent not only showed significant tumor growth inhibition efficacy in the Mia-Paka-2 xenograft model compared to the control group (administered via empty LNP), but also... Figure 3 (A), and the mice did not lose weight after 4 weeks of continuous mRNA administration, suggesting it is safe in terms of side effects. Figure 3 (B). On day 21 after administration, the tumor inhibition rates in the intratumoral injection group and the intravenous injection group were calculated to be 63.0% and 50.2%, respectively, confirming that anticancer efficacy was observed regardless of the route of administration.
[0166] Example 8: Evaluation of the anticancer efficacy of p53 mRNA anticancer candidate in a lung cancer xenograft model
[0167] To evaluate the anticancer efficacy of p53 mRNA as disclosed herein, p53 mRNA was administered to a mouse model of lung cancer in which H1299 cells were xenografted, and changes in tumor size were observed. In the treatment group, p53 mRNA was administered three times a week (6 times in total, 45 μg / mouse) for 3 weeks.
[0168] Specifically, H1299 cells (ATCC) were subcutaneously injected into the dorsal side of 5-week-old BALB / c nude mice. Tumors were observed macroscopically several days later, and tumor size was monitored. At the start of administration, six mice with similar tumor sizes were assigned to each group. The administration groups received either intratumoral administration (it, 6 μg / head) or intravenous administration (iv, 45 μg / head). During the experimental period, mouse body weight and tumor size were measured 2 to 3 times per week, and tumor size in each group was monitored until day 15 from the start of administration.
[0169] When administered to a lung cancer xenograft mouse model, the p53 mRNA anticancer therapeutic agent not only showed a significant tumor growth inhibitory effect in the H1299 xenograft model compared to the control group (administered via empty LNP), but also demonstrated significant antitumor effects. Figure 4 (A), and the mice did not lose weight after two weeks of continuous mRNA administration, suggesting it is safe in terms of side effects. Figure 4 (B). On day 13 after administration, the tumor inhibition rates of the intratumoral injection group and the intravenous injection group were calculated to be 74.8% and 32.8%, respectively, confirming that the intratumoral injection group showed a high tumor growth inhibition effect.
Claims
1. An mRNA comprising a non-natural 5' untranslated region (5'UTR), a sequence encoding a polypeptide, and a non-natural 3' untranslated region (3'UTR). The 5' non-translated region does not form a secondary structure. The sequence encoding the polypeptide is a sequence encoding p53 or a functional fragment of p53, and The 3' non-translated region has a second-level structure represented by the following dot-bracket notation: .(((((...........(((...(((((.(((....))).)))))...)))..(((((((..((((....((((((.(((((.......)))))..))).)))))))...))))))).......(((....)))............(((.........(((....))))))..))));or The following dot-bracket notation represents a second-level structure: ((((((((((((...(((((.((........((((((((.........))))))))))))))).....(((...))).....))))))))))))..((((((((((((....))))))...)))))).....((((((...))))))........... wherein, In the dot-bracket notation, a dot represents an unpaired base in the sequence, and "(" and ")" represent paired bases in the sequence.
2. The mRNA of claim 1, wherein the mRNA comprising the non-natural 5' untranslated region has a sequence of formula 1: Formula 1 : AGN a GCCACC Where N is A, U, G or C, each N is either identical or different from the others, and a represents multiple N and is 42 or 62.
3. The mRNA of claim 1, wherein the mRNA comprising the 3' untranslated region has a mean free energy for RNA folding of -0.1 kcal / mol to -0.3 kcal / mol. (a) The secondary structure of the mRNA including the 3' non-translated region, represented by .(((((...........(((((((((((.(((.......) ... (b) The secondary structure of the mRNA including the 3' nontranslated region, represented by ((((((((((((...(((........((((((((.........))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))))).....((((((((...) ...
4. The mRNA according to claim 1, wherein the 5' untranslated region comprises a nucleotide sequence of any one of sequence identification numbers 1 to 9, and The 3' non-translated region includes the nucleotide sequence of any one of sequence identification numbers: 10 to 17.
5. The mRNA according to claim 4, wherein the mRNA further comprises a Kozak sequence or a polyadenylate sequence.
6. The mRNA of claim 1, wherein the mRNA has one or more modified nucleotides.
7. The mRNA according to claim 1, comprising a 5'-cap selected from cap 0, cap 1 and cap 2.
8. A DNA that encodes an mRNA as described in any one of claims 1 to 7.
9. A composition comprising, as an active ingredient, mRNA or DNA encoding it as described in any one of claims 1 to 7.
10. The composition according to claim 9, wherein the composition is a pharmaceutical composition for the prevention or treatment of cancer.
11. The composition of claim 10, wherein the cancer is caused by a p53 mutation.
12. A method for preventing or treating cancer in a subject, the method comprising administering to the subject a therapeutically effective amount of mRNA as described in any one of claims 1 to 7.