Gene variants specific to pruritus hirsutus and compositions comprising same

By providing specific nucleic acid sequences and recombinant host cells, the lack of woolly mammoth tissues and cell lines was addressed, enabling gene editing and regeneration of endangered species and supporting anti-extinction and conservation research.

CN121889502APending Publication Date: 2026-04-17COLOSSAL BIOSCIENCES INC
View PDF 8 Cites 0 Cited by

Patent Information

Application Number
CN202480034465.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-04-06
Filing Date
2024-04-05
Publication Date
2026-04-17

AI Technical Summary

Technical Problem

The current lack of tissues and cell lines for extinct animals such as woolly mammoths limits the biological tools available for anti-extinction processes and the preservation and research of endangered species.

Method used

It provides isolated nucleic acid sequences and recombinant host cells containing specific nucleotide sequences for constructing recombinant host cells and transgenic animals, particularly woolly mammoth gene variants, to achieve cell and tissue preservation and regeneration through gene editing technology.

Benefits of technology

It enabled the construction of woolly mammoth gene variants, supporting the preservation and regeneration of endangered species and providing biological tools for research and conservation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121889502A_ABST
    Figure CN121889502A_ABST
Patent Text Reader

Abstract

Provided herein are isolated nucleic acids, vectors, recombinant cells, and transgenic animal tremor longimanus capable of expressing at least one or more tremor longimanus genes. Also provided are recombinant cells and transgenic animals comprising one or more abrupt hair gene-specific deletions in the regulatory region upstream of the identified transcription initiation site.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 494,762, filed April 6, 2023, the disclosure of which is incorporated herein by reference in its entirety. Invention Field

[0003] This disclosure generally relates to mammalian cells that have undergone gene editing and / or reprogramming, and their uses.

[0004] Submitting references to the sequence list electronically

[0005] This application includes a sequence list submitted electronically. The contents of the electronic sequence list (069296.9WO1 SequenceListing.xml; size: 1,857,418 bytes; and creation date: March 29, 2024) are incorporated herein by reference in their entirety. Background of the Invention

[0007] Currently, there is an unmet need for developing elephant tissue culture, non-human cell genome editing, and biological tools to aid animal conservation and anti-extinction efforts. Synthetic biology and gene editing can improve the treatment of wildlife diseases and correct ecological imbalances caused by climate change, pollution, human consumption, hunting, human disturbance, resource depletion, deforestation, and extinction events. The establishment and biobanking of tissues and cell lines from endangered and extinct species can preserve them for future research and can help repopulate endangered and extinct species. However, tissues and cell lines for anti-extinction processes in extinct animals are currently lacking.

[0008] Brief overview of the invention

[0009] This article provides isolated nucleic acid sequences containing nucleotide sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-associated protein 5 (NCKAP5) (SEQ ID NO: 7), laminin β4 subunit (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 9), adhesion-like G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 1). NO: 10), Ninjurin 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated helper subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like protein 4 (PCNXL4) (SEQ ID NO: 14), Nuclear membrane protein 2 containing spectrin repeat sequence (SYNE2) (SEQ ID NO: 15), NLR family protein 12 containing pyrin domain (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat domain 90 (WDR90) (SEQ ID NO: 18), Breast cancer 2 (BRCA2) (SEQ ID NO: 19), Protein kinase, DNA activation catalytic subunit (PRKDC) (SEQ ID NO: 20), Vacuole sorting 13 homolog B (VPS13B) (SEQ ID NO: 21), Sphingolipid activator progenitourinone (PSAP) (SEQ ID NO: 10). SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), keratin 28 (KRT28) (SEQ ID NO: 24), keratin 35 (KRT35) (SEQ ID NO: 25), keratin 40 (KRT40) (SEQ ID NO: 26), myosin heavy chain 4 (MYH4) (SEQ ID NO: 27), TRP phosphoinositol interaction regulator (PIRT) (SEQ ID NO: 28), polycystin 1-like protein 2 (PKD1L2) (SEQ ID NO: 28)NO: 29), Retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid hormone receptor-associated protein 3 (THRAP3) (SEQ ID NO: 34), Centromere protein C1 (CENPC1) (SEQ ID NO: 35), Dentin formation and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), Fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), Cation channel sperm-associated helper subunit γ (CATSPERG) (SEQ ID NO: 38), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 29). NO: 41) and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0010] In some embodiments, the nucleotide sequence comprises at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 19), BRCA2 ... NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0011] An isolated vector containing the isolated nucleic acid sequence described herein is also provided.

[0012] Recombinant host cells are also provided, comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), ... SYNE2 (SEQ ID NO: 17), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO:35), DSPP (SEQ ID NO:36), FGF5 (SEQ ID NO:37), CATSPERG (SEQ ID NO:38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).In some embodiments, the recombinant host cell comprises a nucleotide sequence having at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 ( NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0013] A recombinant host cell comprising at least one of the isolated nucleic acid sequences described herein is also provided. In some embodiments, the recombinant host cell comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acids described herein.

[0014] This article also provides recombinant host cells containing LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, and LOC126080. 367, LOC126080369, LOC126080369, LOC126080733, without distal homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC126058 227. Deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein: (a) the nucleic acid sequence deleted upstream of LOC126071805 contains SEQ ID NO. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k)LOC126080369 The upstream missing nucleic acid sequence contains SEQ ID NO: 53,(1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 NO: 63, (v) LOC126058390 upstream missing nucleic acid sequence contains SEQ ID NO: 64, (w) LOC126058396 upstream missing nucleic acid sequence contains SEQ ID NO: 65, (x) FOXH1 upstream missing nucleic acid sequence contains SEQ ID NO: 66, (y) LOC126060018 upstream missing nucleic acid sequence contains SEQ ID NO: 67, (z) LOC126060570 upstream missing nucleic acid sequence contains SEQ ID NO: 68, (aa) CCDC15 upstream missing nucleic acid sequence contains SEQ ID NO: 69, (bb) INO80B upstream missing nucleic acid sequence contains SEQ ID NO: 70, (cc) LOC126062579 upstream missing nucleic acid sequence contains SEQ ID NO: 71, (dd) LOC126063153 upstream missing nucleic acid sequence contains SEQ ID NO: 69. The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO: 73, the upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO: 74, the upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75, the upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0015] In some embodiments, the recombinant host cell containing the isolated nucleic acids described herein also contains LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC1 The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein: (a) the nucleic acid sequence deleted upstream of LOC126071805 contains SEQ ID NO. 1. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 53, (l) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,(o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 63, (v) The upstream missing nucleic acid sequence of LOC126058390 contains SEQ ID NO: 64, (w) The upstream missing nucleic acid sequence of LOC126058396 contains SEQ ID NO: 65, (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 57. NO: 66, (y)LOC126060018 upstream missing nucleic acid sequence contains SEQ ID NO: 67, (z)LOC126060570 upstream missing nucleic acid sequence contains SEQ ID NO: 68, (aa)CCDC15 upstream missing nucleic acid sequence contains SEQ ID NO: 69, (bb)INO80B upstream missing nucleic acid sequence contains SEQ ID NO: 70, (cc)LOC126062579 upstream missing nucleic acid sequence contains SEQ ID NO: 71, (dd)LOC126063153 upstream missing nucleic acid sequence contains SEQ ID NO: 72, (ee)LOC126063990 upstream missing nucleic acid sequence contains SEQ ID NO: 73, (ff)LOC126063991 upstream missing nucleic acid sequence contains SEQ ID NO: 74, (gg)LOC126066513 upstream missing nucleic acid sequence contains SEQ ID NO: 68. The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0016] In some embodiments, the recombinant host cell is a stem cell. Stem cells may be selected, for example, from induced blastocysts, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs). In some embodiments, the recombinant host cell is a reprogrammed cell. In some embodiments, the recombinant host cell is a fibroblast or mesenchymal cell. In some embodiments, the recombinant host cell is selected from nerve cells, chondrocytes, osteocytes, myocytes, adipocytes, and epidermal cells.

[0017] In some implementations, the recombinant host cells do not express at least one endogenous homolog of GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, IHRAP3, CENPC1, DSPP, FGF5, CAISPERG, MYH1, MYH13, ATRIP, and TGM3. Recombinant host cells may, for example, not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1 The following are endogenous homologs: L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3, specifically the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, 30th, 31st, 32nd, 33rd, 34th, 35th, 36th, 37th, 38th, 39th, 40th, 41st, or 42nd homologs.

[0018] In some implementations, the recombinant host cell is an elephant cell. Elephant cells can be selected, for example, from Asian elephant (Elephas maximus) cells, African elephant (Loxodonta africana) cells, African forest elephant (Loxodontacyclotis) cells, and Bornean elephant (Elephas maximus borneensis) cells.

[0019] Transgenic animals containing the recombinant host cells described herein are also provided. In some embodiments, the transgenic animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), or a Bornean elephant (Elephas maximus borneensis).

[0020] It also provides genetically modified animals containing at least one woolly mammoth (Mammuthus primigenius) gene variant. At least one woolly mammoth (true mammoth) gene variant may be selected, for example, from GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 1), etc. NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0021] In some implementations, the transgenic animals also include LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, and LOC12608629. 3. Deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein: (a) the nucleic acid sequence deleted upstream of LOC126071805 contains SEQ ID NO. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 53, (1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,(o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 63, (v) The upstream missing nucleic acid sequence of LOC126058390 contains SEQ ID NO: 64, (w) The upstream missing nucleic acid sequence of LOC126058396 contains SEQ ID NO: 65, (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 57. NO: 66, (y)LOC126060018 upstream missing nucleic acid sequence contains SEQ ID NO: 67, (z)LOC126060570 upstream missing nucleic acid sequence contains SEQ ID NO: 68, (aa)CCDC15 upstream missing nucleic acid sequence contains SEQ ID NO: 69, (bb)INO80B upstream missing nucleic acid sequence contains SEQ ID NO: 70, (cc)LOC126062579 upstream missing nucleic acid sequence contains SEQ ID NO: 71, (dd)LOC126063153 upstream missing nucleic acid sequence contains SEQ ID NO: 72, (ee)LOC126063990 upstream missing nucleic acid sequence contains SEQ ID NO: 73, (ff)LOC126063991 upstream missing nucleic acid sequence contains SEQ ID NO: 74, (gg)LOC126066513 upstream missing nucleic acid sequence contains SEQ ID NO: 68. The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0022] In some implementations, the genetically modified animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), or a Bornean elephant (Elephas maximus borneensis). Brief description of the attached diagram

[0024] The foregoing overview and the following detailed description of preferred embodiments of this application will be better understood when read in conjunction with the accompanying drawings. However, it should be understood that this application is not limited to the precise embodiments shown in the drawings.

[0025] Figure 1A-1D The results of gene editing experiments with NCKAP5 and NINJ1 substitutions are shown. Figure 1A This is a graph illustrating the first enrichment of NCKAP5 and NINJ1 substitutions. Figure 1B This is the first enriched table replaced by NCKAP5 and NINJ1. Figure 1C This is a graph illustrating the second enrichment of NCKAP5 and NINJ1 substitutions. Figure 1D This is a table of the second enrichment of NCKAP5 and NINJ1 substitutes. ICE score is the target knockout score and KI is the knock-in efficiency of the correct mammoth variant. Invention Details

[0027] Various published materials, articles, and patents have been cited or described in the background and throughout the specification, each of which is incorporated herein by reference in its entirety. Discussions of documents, bills, materials, devices, articles, etc., included in this specification are for the purpose of providing context for the invention. These discussions are not an admission that any or all of these matters constitute prior art with respect to any disclosed or claimed invention.

[0028] For clarity of disclosure and not as a limitation, the detailed description of the invention is divided into subsections that describe or illustrate certain features, embodiments, or applications of the invention.

[0029] definition

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Otherwise, certain terms used herein have the meanings shown in the specification.

[0031] It must be noted that, unless the context clearly specifies otherwise, the singular forms “a”, “an”, and “the” used herein and in the appended claims include plural references.

[0032] Unless otherwise stated, any numerical value (e.g., concentrations or concentration ranges described herein) should be understood to be modified by the term "about" in all cases. Therefore, numerical values ​​generally include ±10% of the stated value. For example, a concentration of 1 mg / mL includes 0.9 mg / mL to 1.1 mg / mL. Similarly, a concentration range of 1% to 10% (w / v) includes 0.9% (w / v) to 11% (w / v). As used herein, unless the context clearly specifies otherwise, the use of numerical ranges explicitly includes all possible subranges, all individual numerical values ​​within that range (including integers and fractions of numerical values ​​within the range).

[0033] Unless otherwise specified, the term "at least" preceding a series of elements should be understood to refer to each element in the series. Those skilled in the art will recognize or be able to determine numerous equivalents of specific embodiments of the invention described herein using only conventional testing. Such equivalents are intended to be included within the scope of this invention.

[0034] As used herein, the terms “comprises,” “comprising,” “includes,” “including,” “has,” “having,” “contains,” or “containing,” or any other variations thereof, shall be understood to imply inclusion of the whole or group thereof without excluding any other whole or group thereof, and are intended to be non-exclusive or open-ended. For example, a composition, mixture, process, method, article, or apparatus comprising a list of elements is not necessarily limited to those elements, but may include other elements not expressly listed therein or inherent in such compositions, mixtures, processes, methods, articles, or apparatus. Furthermore, unless expressly stated to the contrary, “or” means inclusive or / and, not exclusive or. For example, condition A or B is satisfied by any of the following: A is true (or exists) and B is false (or does not exist), A is false (or does not exist) and B is true (or exists), and both A and B are true (or exist).

[0035] As used herein, the connecting term "and / or" between multiple elements is understood to include both individual and combined options. For example, when two elements are connected by "and / or", the first option refers to the application of the first element without the second element. The second option refers to the application of the second element without the first element. The third option refers to the simultaneous application of both the first and second elements. Any of these options is understood to fall within this meaning and therefore satisfies the requirement of the term "and / or" as used herein. The simultaneous application of more than one option is also understood to fall within this meaning and therefore satisfies the requirement of the term "and / or".

[0036] As used herein, the term “consistsof” or variations thereof, such as “consist of” or “consisting of”, as used throughout the specification and claims, indicates that any said whole or group of wholes is included, but no additional whole or group of wholes may be added to a particular method, structure or composition.

[0037] As used herein, the term "consists essentially of" or variations thereof, such as "consist essentially of" or "consisting essentially of," as used throughout the specification and claims, indicates that any said whole or group of wholes is included, and optionally includes any said whole or group of wholes that does not substantially alter the fundamental or novel properties of the particular method, structure, or composition. See MPEP § 2111.03.

[0038] The terms "right," "left," "down," and "up" indicate the reference directions in the attached diagram.

[0039] It should also be understood that the terms “about,” “approximately,” “generally,” “substantially,” and similar terms used herein, when referring to the size or feature of a component of the preferred invention, indicate that the size / feature is not a strict limit or parameter and does not exclude minor variations from those that are functionally identical or similar, as would be understood by one of ordinary skill in the art. At a minimum, such references including numerical parameters will include variations that will not change the least significant figure using mathematical and industrial principles accepted in the art (e.g., rounding, measurement or other systematic errors, manufacturing tolerances, etc.).

[0040] The term “identical” or “identity” percentage, in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that are identical or have a specific percentage of the same amino acid residues or nucleotides when performing maximum correspondence comparisons and alignments, such as using one of the following sequence comparison algorithms or by visual inspection.

[0041] For sequence comparisons, typically one sequence is used as a reference sequence, and the test sequence is compared to it. When using a sequence comparison algorithm, the test and reference sequences are input into the computer, the coordinates of the subsequences are specified (if necessary), and the sequence comparison algorithm program parameters are specified. The sequence comparison algorithm then calculates the percentage of sequence identity between the test sequence and the reference sequence based on the specified program parameters.

[0042] Optimized alignments of sequences for comparison can be performed, for example, by the following: local homology algorithms of Smith and Waterman, Adv. Appl. Math. 2: 482 (1981); homology alignment algorithms of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970); and similarity retrieval methods of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85: 2444 (1988), computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) or visual inspection (see generally Current Protocols in Molecular Biology, edited by FMAusubel et al., Current Protocols, Greene Publishing Associates, Inc. and John...). A joint venture between Wiley & Sons, Inc. (1995 Supplement (Ausubel)).

[0043] Examples of algorithms suitable for determining sequence identity percentages and sequence similarity are the BLAST and BLAST 2.0 algorithms, described in Altschul et al., (1990) J.Mol.Biol.215:403-410 and Altschul et al., (1997) Nucleic Acids Res.25:3389-3402, respectively. Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information. The algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short characters of length W in the query sequence. These short characters of length W match or satisfy a positive threshold score T when compared to characters of the same length in a database sequence. T is called the neighborhood character score threshold (Altschul et al., ibid.). These initial neighborhood character hits serve as seeds to initiate a search for longer HSPs containing them. Then, character hits are extended in both directions along each sequence as long as the cumulative alignment score can increase.

[0044] For nucleotide sequences, a cumulative score is calculated using parameter M (reward score for matching residue pairs; always > 0) and parameter N (penalty score for non-matching residues; always < 0). For amino acid sequences, a score matrix is ​​used to calculate the cumulative score. Character hit extension in each direction stops when: the cumulative alignment score decreases by an amount of X from its maximum realized value; the cumulative score becomes zero or lower due to the accumulation of one or more negative score residue alignments; or the end of either sequence is reached. The parameters W, T, and X of the BLAST algorithm determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a word length of 11 (W), an expected value of 10 (E), M = 5, N = -4, and two-strand comparisons as default values. For amino acid sequences, the BLASTP program uses a word length of 3 (W), an expected value of 10 (E), and a BLOSUM62 score matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) as default values.

[0045] In addition to calculating the percentage of sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin and Altschul, Proc. Nar'l. Acad. Sci. USA 90: 5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the minimum sum probability (P(N)), which provides an indication of the probability that a match will occur by chance between two nucleotide or amino acid sequences. For example, if the minimum sum probability of the test nucleic acid compared to the reference nucleic acid is less than about 0.1, more preferably less than 0.01, and most preferably less than 0.001, the nucleic acid is considered similar to the reference sequence.

[0046] As described below, another indication that two nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid hybridizes with the polypeptide encoded by the second nucleic acid. Therefore, the polypeptide is usually substantially identical to the second polypeptide; for example, the two polypeptides may be distinguished only by conserved substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize with each other under stringent conditions.

[0047] As used herein, the term "polynucleotide," synonymously referred to as "nucleic acid molecule," "nucleotide," or "nucleic acid," means any polynucleotide or polydeoxynucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotide" includes, but is not limited to, single-stranded and double-stranded DNA, DNA of a mixture of single-stranded and double-stranded regions, single-stranded and double-stranded RNA, and RNA of a mixture of single-stranded and double-stranded regions, and hybrid molecules comprising DNA and RNA, which may be single-stranded or, more generally, double-stranded or a mixture of single-stranded and double-stranded regions. Additionally, "polynucleotide" refers to a triple-stranded region comprising RNA or DNA, or RNA and DNA. The term polynucleotide also includes DNA or RNA containing one or more modified bases, and DNA or RNA whose backbone is modified for stability or other reasons. "Modified" bases include, for example, triphenylmethylated bases and unusual bases (such as inosine). DNA and RNA can be modified in a variety of ways; therefore, "polynucleotides" include polynucleotides in chemical, enzymatic, or metabolically modified forms commonly found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotides" also include relatively short nucleic acid chains, often called oligonucleotides.

[0048] As used herein, the term "vector" is a replicon in which another nucleic acid segment can be operatively inserted to cause replication or expression of said segment.

[0049] As used herein, the term "host cell" refers to a cell containing nucleic acid molecules of the present disclosure (such as, for example, an isolated vector containing isolated nucleic acids of the present invention). A "host cell" can be any type of cell, such as a primary cell, a cultured cell, or a cell line. In one embodiment, a "host cell" is a cell transfected with the nucleic acid molecules of the present invention. In another embodiment, a "host cell" is a progeny or potential progeny of such a transfected cell. The progeny of the cell may be the same as or different from the parent cell, for example, due to mutations or environmental influences that may occur in subsequent generations, or due to the integration of nucleic acid molecules into the host cell genome. A host cell can be, for example, any type of prokaryotic cell, eukaryotic cell, or archaea cell. In some cases, the host cell is a bacterial cell. In some cases, the host cell is a mammalian cell.

[0050] As used herein, the term "expression" refers to the biosynthesis of a gene product. This term includes the transcription of a gene into RNA. It also includes the translation of RNA into one or more polypeptides, and encompasses all naturally occurring post-transcriptional and post-translational modifications.

[0051] As used herein, the terms “peptide,” “polypeptide,” or “protein” can refer to a molecule composed of amino acids and can be recognized by those skilled in the art as a protein. Conventional single-letter or three-letter codes for amino acid residues are used herein. The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to refer to polymers of amino acids of any length. Such polymers can be linear or branched, may include modified amino acids, and may be interrupted by non-amino acid components. The term also includes amino acid polymers that have been naturally or artificially modified (e.g., forming disulfide bonds, glycosylation, esterification, acetylation, phosphorylation, or any other operation or modification, such as binding to a labeled component). This definition also includes, for example, polypeptides containing one or more amino acid analogs (including, for example, non-natural amino acids) and other modifications known in the art.

[0052] The peptide sequences described herein are written according to common convention, with the N-terminal region of the peptide on the left and the C-terminal region on the right. Although amino acid isomers are known, the L-form of the amino acid is indicated unless otherwise explicitly stated.

[0053] The terms "heterologous nucleic acid" or "heterologous polypeptide" refer to a nucleic acid or polypeptide whose sequence differs from that of another nucleic acid or polypeptide naturally found in the same host cell or in the same host. As used herein, "heterologous nucleic acid" or "heterologous polypeptide" can be heterologous to bacterial cells and / or mammalian hosts.

[0054] As used herein, the term "transformation" refers to the transfer of a nucleic acid fragment into a host cell (e.g., a host bacterial cell) resulting in genetically stable inheritance. A host cell containing the transformed nucleic acid fragment is referred to as a "recombinant," "transgenic," or "transformed" organism.

[0055] As used herein, the term "isolated" means that a biological component (e.g., nucleic acid, peptide, or protein) has been substantially isolated, produced, or purified from other biological components (i.e., other chromosomes, extrachromosomal DNA and RNA, and proteins) of the organism in which the component is naturally present. Therefore, "isolated" nucleic acids, peptides, and proteins include nucleic acids and proteins purified using standard purification methods. "Isolated" nucleic acids, peptides, or proteins can be part of a composition and can still be isolated if the composition is not part of the native environment of the nucleic acid, peptide, or protein. The term also includes nucleic acids, peptides, or proteins prepared through recombinant expression in host cells and chemically synthesized nucleic acids.

[0056] As used herein, “gene” refers to a nucleic acid containing an open reading frame encoding a polypeptide, which includes exons and (optionally) intron sequences.

[0057] As used herein, a “promoter” is an example of a transcriptional regulatory sequence and specifically describes a nucleic acid sequence located in the proximal region of a gene at the 5′ end of the start codon. Transcription of adjacent nucleic acid segments is initiated in the promoter region. The transcription rate of a repressible promoter decreases in response to a repressor. The transcription rate of an inducible promoter increases in response to an inducer. The transcription rate of a constitutive promoter is not specifically regulated, although it can vary under the influence of general metabolic conditions.

[0058] As used herein, the term "gene product" refers to any product encoded by a nucleic acid sequence. Therefore, a gene product can be, for example, a primary transcript, a mature transcript, a processed transcript, or a protein or peptide encoded by a transcript. Examples of gene products include mRNA, rRNA, hairpin RNA (e.g., microRNA, shRNA, siRNA, tRNA), and peptides and proteins (e.g., reporter proteins and therapeutic proteins).

[0059] As used herein, the term "stem cell" refers to a cell capable of self-renewal and differentiation into at least one highly differentiated or poorly developed phenotype. The term "stem cell" includes stem cell lines, induced stem cells, non-human embryonic stem cells, pluripotent stem cells, multipotent stem cells, amniotic stem cells, placental stem cells, or adult stem cells. "Induced stem cells" are cells derived from non-pluripotent cells induced to develop into poorly differentiated or highly developed phenotypes through the introduction of one or more reprogramming factors or genes. As used herein, induced stem cells do not need to be pluripotent, but rather possess the capacity to differentiate into more than one highly differentiated phenotype under appropriate conditions. It should be understood that this capacity does not exist prior to the introduction of the reprogramming factor. Induced stem cells will express at least one stem cell marker that the parental cells do not express prior to the introduction of the reprogramming factor. In this context, stem cell markers do not include factors introduced by reprogramming. Induced pluripotent stem cells or iPS cells, under appropriate conditions, possess the inducible capacity to differentiate into cell phenotypes derived from each of the endoderm, mesoderm, and ectoderm.

[0060] As used herein, the term "marker" is used to describe the characteristics and / or phenotype of a cell. Markers can be used to select cells that contain a desired characteristic and can vary from cell to cell. A marker is...

[0061] A marker is a characteristic or molecule expressed by a cell type, regardless of the morphological, structural, functional, or biochemical (enzymatic) characteristics of the cell for a particular cell type. In one embodiment, such a marker is a protein. This protein may have an epitope of an antibody or other binding molecule available in the art. However, a marker can consist of any molecule found within or on a cell, including but not limited to proteins (peptides and polypeptides), lipids, polysaccharides, nucleic acids, and steroids. Examples of morphological characteristics or traits include, but are not limited to, shape, size, and nucleocytoplasmic ratio. Examples of functional characteristics or traits include, but are not limited to, the ability to bind specific substances, the ability to incorporate or exclude specific dyes, the ability to migrate under specific conditions, and the ability to differentiate along a specific lineage. A marker can be detected by any method available to those skilled in the art. A marker may also lack morphological characteristics or be lacking proteins, lipids, etc. A marker may be a combination of a unique set of characteristics present and / or lacking polypeptides and other morphological or structural features. In one embodiment, the marker is a cell surface marker.

[0062] The term "exogenous" refers to a substance present in cells that is introduced by hand. When used herein, the term "exogenous" can refer to the introduction of nucleic acids (e.g., nucleic acids encoding polypeptides) or polypeptides into a biological system (e.g., cells or organisms in which they are not naturally present) through a process involving human hand. Alternatively, "exogenous" can refer to the introduction of nucleic acids or polypeptides into a biological system (e.g., cells or organisms in which low amounts are present or in which it is desirable to increase the amount of nucleic acids or polypeptides in the cells or organisms (e.g., to produce ectopic expression or levels)).

[0063] As used herein, the term "reprogramming gene" or "reprogramming factor" refers to an agent or nucleic acid molecule that can induce a reprogramming process in somatic cells to re-express a poorly differentiated, more stem cell-like phenotype. Reprogramming factors can be nucleic acids, peptides, or small molecules that promote a reprogrammed phenotype when introduced into cells. Non-limiting examples of reprogramming factors include Oct4 (octamer-binding transcription factor 4), SOX2 (sex-determining region Y) box 2, Klf4 (Kruppel-like factor 4), and c-Myc. These are the so-called "classic" or "standard" set of reprogramming factors used for derivation (e.g., induced pluripotent stem cells). When introducing reprogrammed cells into a poorly differentiated or stem cell phenotype, additional factors that can be considered as reprogramming factors include LIN28+Nanog, Esrrb, Pax5 shRNA, C / EBPa, p53 siRNA, UTF1, DNMT shRNA, Wnt3a, SV40 LT(T), hTERT, and small molecule chemical reagents, including but not limited to BIX-01294, BayK8644, RG108, AZA, dexamethasone, VPA, TSA, SAHA, PD0325901+CHIR99021(2i), and A-83-01. In some embodiments, the reprogramming gene or reprogramming factor is Oct4, Klf4, SOX2, and c-Myc.

[0064] As used herein, the terms “dedifferentiation,” “retrodifferentiation,” or “reprogramming” refer to the process of generating cells that re-express a less differentiated phenotype than the cells from which they originated and / or express at least one stem cell marker not expressed prior to the process. For example, terminally differentiated cells can dedifferentiate into pluripotent cells. That is, dedifferentiation causes cells to regress along the differentiation spectrum from pluripotent to fully differentiated cells. Typically, reversal of cell differentiation phenotype requires artificial manipulation of the cells, for example, by introducing or expressing exogenous peptide factors. Reprogramming is generally not observed under natural conditions, either in vivo or in vitro.

[0065] As used herein, a “reprogrammed cell” is a cell that has been exposed to one or more reprogramming factors and expresses a phenotype that is less differentiated than that of the cells from which it originated. Reprogrammed cells may also possess the ability to self-renew and will express at least one stem cell marker that is not delivered to the cell as a reprogramming factor. Furthermore, reprogrammed cells will have the ability to differentiate into highly differentiated somatic cell types according to the differentiation protocols provided herein or described in the art.

[0066] As used herein, the term "somatic cell" refers to any cell other than germ cells, cells present in or derived from a preimplantation embryo, or cells produced by the in vitro proliferation of such cells. In other words, a somatic cell is any cell that forms the body of an organism, excluding germ cells. Every cell type in a mammalian body (except sperm and eggs and the cells they form (gametocytes)) is a somatic cell: viscera, skin, bones, blood, and connective tissue are essentially composed of somatic cells. In some embodiments, a somatic cell is a "non-embryonic somatic cell," which means a somatic cell that is not present in or derived from an embryo, and is not produced by the in vitro proliferation of such cells. In some embodiments, a somatic cell is an "adult somatic cell," which means a cell present in or derived from an organism other than an embryo or fetus, or cells produced by the in vitro proliferation of such cells.

[0067] Nucleic acids, vectors, recombinant cells, and transgenic animals expressing woolly mammoth-specific variants

[0068] Woolly mammoths (true mammoths) were the cold-hardy members of the elephant family, once roaming the vast mammoth plains of the Northern Hemisphere during the Last Glacial Period, and becoming extinct in most of their range approximately 10,000 years ago. Whether through prehistoric art or frozen remains found in Siberia and Alaska, woolly mammoths are among the most authentically characteristic prehistoric animals. These well-preserved specimens offer a rare opportunity to functionally characterize adaptive evolution in extinct animals. Inhabiting extreme environments, such as the cold regions of the North Latitude, requires a range of evolutionary adaptations. Genetic and morphological analyses of woolly mammoth specimens have revealed a variety of physiological adaptations to cold, including dense, long hair, increased adipose tissue, smaller ears and tails, and polymorphism in hemoglobin structure. Studies of other cold-hardy mammals have identified numerous convergent adaptations in the same genes and pathways, as well as unique adaptations to shared environmental stressors.

[0069] The isolated nucleic acids, vectors, recombinant cells, and transgenic animals described herein are partly based on the discovery that cells (e.g., Asian elephant cells and African elephant cells) can be modified to contain and express alleles or homologs from woolly mammoths (e.g., true mammoths). Specifically, live cells can be gene-edited, either by transfection, transduction, or modification of existing elephant homologs to mimic mammoth variants or alleles of elephant genes. In some embodiments, endogenous homologs of mammoth genes are deleted or inactivated. Similar modifications to introduce woolly mammoth genes can be made to live cells from other non-human relatives of elephants. Mammoth variants or alleles can alter the phenotype of gene-edited cells. The isolated nucleic acids, vectors, recombinant cells, and transgenic animals described herein provide synthetic alternatives to wildlife products and new tools for understanding the genetic diversity and cell biology of endangered and extinct wildlife species.

[0070] On the one hand, this paper describes at least one exogenous nucleic acid sequence encoding woolly mammoth genes or containing modifications of endogenous genes to express woolly mammoth homologs or variants of endogenous genes. Of particular interest are genes common to every sequenced woolly mammoth genome that are not common to any sequenced elephant genome (Asian or African). By selecting genes in this manner, the influence of individual variation within groups of sequenced woolly mammoth genomes and variation in Asian and / or African elephant genomes is minimized to focus on those variant sequences that are entirely mammoth-like. In this context, as used herein, “woolly mammoth gene,” “woolly mammoth gene variant,” or “woolly mammoth homolog” is a gene encoding a polypeptide having a sequence encoded by all sequenced woolly mammoth genomes and differing from homologous polypeptides encoded by all sequenced African and Asian elephant genomes. In this context, “different from” means having at least one amino acid difference relative to homologous polypeptides encoded by African and Asian elephants. A non-coding or regulatory nucleic acid sequence can be considered a "woolly mammoth sequence" if a non-coding motif of at least 20 nucleotides is present in every sequenced woolly mammoth genome and not in any sequenced Asian or African elephant genome. Asian or African elephant genes or sequences modified by human intervention to encode woolly mammoth genes or gene variant sequences are woolly mammoth genes or gene variants, as used herein. In the case that the woolly mammoth gene or gene variant referred to herein is found and encoded only in the woolly mammoth genome, and that the woolly mammoth is extinct, the woolly mammoth gene or gene variant sequence must be exogenous to living cells; that is, the woolly mammoth gene or gene variant sequence encoded in cells, whether by introducing a foreign sequence or by gene editing a foreign sequence, is "exogenous".

[0071] Therefore, this article provides isolated nucleic acid sequences containing woolly mammoth (true mammoth) gene variants. The isolated nucleic acid sequence may, for example, contain a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-associated protein 5 (NCKAP5) (SEQ ID NO: 7), laminin β4 subunit (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 9), adhesion-like G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 9). NO: 10), Nerve injury-inducing protein 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated auxiliary subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like protein 4 (PCNXL4) (SEQ ID NO: 14), Nuclear membrane protein 2 containing spectrin repeat sequence (SYNE2) (SEQ ID NO: 15), NLR family protein 12 containing pyrin domain (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat domain 90 (WDR90) (SEQ ID NO: 18), Breast cancer 2 (BRCA2) (SEQ ID NO: 19), Protein kinase, DNA activation catalytic subunit (PRKDC) (SEQ ID NO: 20), Vacuole sorting 13 homolog B (VPS13B) (SEQ ID NO: 21), Sphingolipid activator progenitourinone (PSAP) (SEQ ID NO: 10). NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), keratin 28 (KRT28) (SEQ ID NO: 24), keratin 35 (KRT35) (SEQ ID NO: 25), keratin 40 (KRT40) (SEQ ID NO: 26), myosin heavy chain 4 (MYH4) (SEQ ID NO: 27), TRP phosphoinositol interaction regulator (PIRT) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), keratin 28 (KRT28) (SEQ ID NO: 24), keratin 35 (KRT35) (SEQ ID NO: 25), keratin 40 (KRT40) (SEQ ID NO: 26), myosin heavy chain 4 (MYH4) (SEQ ID NO: 27), TRP phosphoNO: 28), Polycystic protein 1-like protein 2 (PKD1L2) (SEQ ID NO: 29), Retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid hormone receptor-associated protein 3 (THRAP3) (SEQ ID NO: 34), Centromere protein C1 (CENPC1) (SEQ ID NO: 35), Dentin formation and dentin sialophospholipid (DSPP) (SEQ ID NO: 36), Fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), Cation channel sperm-associated helper subunit γ (CATSPERG) (SEQ ID NO: 38), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 28), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 29), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 30 ...) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0072] In some embodiments, the nucleotide sequence comprises at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINj1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC ...9), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 19), BRCA2 (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC3 1B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 27) NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0073] In some embodiments, the mammoth (true mammoth) genetic variant comprises a nucleotide sequence having at least 80%, at least 85%, at least 90%, or at least 95% identity with a nucleotide sequence selected from SEQ ID NO: 1-42 and combinations thereof. The mammoth genetic variant may, for example, comprise a nucleotide sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a nucleotide sequence selected from SEQ ID NO: 1-42 and combinations thereof. The mammoth genetic variant may, for example, comprise a nucleotide sequence selected from SEQ ID NO: 1-42 and combinations thereof.

[0074] In some embodiments, the mammoth (true mammoth) gene variant includes at least one alteration in the nucleotide sequence of the gene. The alteration in the nucleotide sequence can be, for example, substitution, insertion, deletion, or a combination thereof. Substitution, insertion, deletion, or a combination thereof can be, for example, in the 5' untranslated region of the gene, introns of the gene, exons of the gene, the 3' untranslated region of the gene, or a combination thereof. Substitution, insertion, deletion, or a combination thereof can be, for example, in the regulatory region of the gene.

[0075] An isolated vector containing the isolated nucleic acid sequence described herein is also provided.

[0076] Recombinant host cells or transgenic animals are also provided, comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), ... SYNE2 (SEQ ID NO: 17), NLRP1 NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPCI (SEQ ID NO:35), DSPP (SEQ ID NO:36), FGF5 (SEQ ID NO:37), CATSPERG (SEQ ID NO:38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).In some embodiments, the recombinant host cell or transgenic animal comprises a nucleotide sequence having at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 18), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), W NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).In some embodiments, the recombinant host cell contains 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acids described herein.

[0077] Recombinant host cells or transgenic animals are also provided, which contain at least one of the isolated nucleic acid sequences described herein. In some embodiments, the recombinant host cells or transgenic animals contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 of the isolated nucleic acid sequences described herein.

[0078] Recombinant host cells or transgenic animals are also provided, containing LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, and LOC126. 080367, LOC126080369, LOC126080369, LOC126080733, No distal homeobox 6 (DLX6), Extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC1260 The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein: (a) the nucleic acid sequence deleted upstream of LOC126071805 contains SEQ ID NO. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k)LOC126080369 The upstream missing nucleic acid sequence contains SEQ ID NO: 53,(1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 NO: 63, (v) LOC126058390 upstream missing nucleic acid sequence contains SEQ ID NO: 64, (w) LOC126058396 upstream missing nucleic acid sequence contains SEQ ID NO: 65, (x) FOXH1 upstream missing nucleic acid sequence contains SEQ ID NO: 66, (y) LOC126060018 upstream missing nucleic acid sequence contains SEQ ID NO: 67, (z) LOC126060570 upstream missing nucleic acid sequence contains SEQ ID NO: 68, (aa) CCDC15 upstream missing nucleic acid sequence contains SEQ ID NO: 69, (bb) INO80B upstream missing nucleic acid sequence contains SEQ ID NO: 70, (cc) LOC126062579 upstream missing nucleic acid sequence contains SEQ ID NO: 71, (dd) LOC126063153 upstream missing nucleic acid sequence contains SEQ ID NO: 69. The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO: 73, the upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO: 74, the upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75, the upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0079] In some embodiments, the recombinant host cell or transgenic animal containing the isolated nucleic acid described herein also contains LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, L The deletion of at least one nucleotide sequence upstream of the transcription start site of OC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein: (a) the nucleic acid sequence deleted upstream of LOC126071805 contains SEQ ID NO. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 53, (1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55,(n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 63, (v) The upstream missing nucleic acid sequence of LOC126058390 contains SEQ ID NO: 64, (w) The upstream missing nucleic acid sequence of LOC126058396 contains SEQ ID NO: 56. NO: 65, (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66, (y) The upstream missing nucleic acid sequence of LOC126060018 contains SEQ ID NO: 67, (z) The upstream missing nucleic acid sequence of LOC126060570 contains SEQ ID NO: 68, (aa) The upstream missing nucleic acid sequence of CCDC15 contains SEQ ID NO: 69, (bb) The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70, (cc) The upstream missing nucleic acid sequence of LOC126062579 contains SEQ ID NO: 71, (dd) The upstream missing nucleic acid sequence of LOC126063153 contains SEQ ID NO: 72, (ee) The upstream missing nucleic acid sequence of LOC126063990 contains SEQ ID NO: 73, (ff) The upstream missing nucleic acid sequence of LOC126063991 contains SEQ ID NO: 68. The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75, the upstream missing nucleic acid sequence of (hhh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0080] In some embodiments, the recombinant host cell or transgenic animal also includes at least one woolly mammoth gene variant as described in Table 1 of WO2022 / 125940 (which is incorporated herein by reference in its entirety). The woolly mammoth gene variants described in WO2022 / 125940 involve a variety of biological processes, including but not limited to, regulation of cold sensitivity, regulation of heat sensitivity, regulation of intracellular pH, regulation of axonogenesis and development, tRNA, metabolic processes, cell adhesion, tissue development and formation, microtubule-based cell movement, negative regulation of biological processes, gene expression, and cellular macromolecular metabolic processes.

[0081] The woolly mammoth gene variants described herein can be used in any combination expressed in any recombinant host cell or transgenic animal as described herein. In some embodiments, at least one isolated nucleic acid contained in the recombinant host cell or transgenic animal encodes GPR98 (SEQ ID NO: 1). In some embodiments, two isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1) and MACF1 (SEQ ID NO: 2). In some embodiments, three isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), and ADARB2 (SEQ ID NO: 3). In some embodiments, four isolated nucleic acids contained in the recombinant host cell or transgenic animal encode GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), and CEP290 (SEQ ID NO: 4). In some implementations, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 isolated nucleic acids contained in the recombinant host cell encode 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 woolly mammoth gene variants described herein.In some embodiments, the recombinant host cell or transgenic animal further comprises, as described herein, LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC1 The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126085059, LOC126085481, LOC126086151, LOC126086152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187 and LOC126069912.

[0082] In some implementations, the recombinant host cell is an Asian elephant (Elephas maximus) cell, an African elephant (Loxodonta africana) cell, an African forest elephant (Loxodonta cyclotis) cell, or a Bornean elephant (Elephas maximus bomeensis) cell.

[0083] In some implementations, the genetically modified animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), or a Bornean elephant (Elephas maximus bomeensis).

[0084] cell

[0085] The woolly mammoth gene variants described herein can be expressed by any living cell capable of receiving exogenous genetic material. The cell can be, for example, a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is a eukaryotic cell. The cell can be a reprogrammed cell, a non-human oocyte, a cell from a non-human embryo, or a cell from a non-human blastocyst. In some embodiments in any aspect, the cell is a fibroblast. In some embodiments, the cell is selected from nerve cells, chondrocytes, osteocytes, myocytes, adipocytes, and epidermal cells. In some embodiments, the cell is a pre-differentiated cell selected from nerve cells, chondrocytes, osteocytes, myocytes, adipocytes, and epidermal cells.

[0086] The scientific literature provides guidance for those skilled in the art to isolate and prepare cells necessary for use with the nucleic acids and vectors isolated herein.

[0087] The cells described herein can be derived from any living, non-human source or organism. Typically, the organism is an animal or vertebrate, such as wild animals, zoo animals, endangered animals, rodents, domesticated animals, or birds. As non-limiting examples, animals may include elephants, hippos, hyraxes, manatees, bears, pandas, feline species (e.g., tigers, lions, cheetahs, lynxes), canine species (e.g., foxes, wolves), avian species (e.g., ostriches, emus, penguins, pigeons), and fish (trout, catfish, and salmon). In some embodiments, the cells described herein are derived from mammals. Non-limiting examples of organisms from which these cells may be obtained include: elephants (e.g., African elephants, Asian elephants, African forest elephants, Bornean elephants); hyraxes (e.g., Dendrohyrax arboreus, Dendrohyrax dorsalis, Heterohyrax brucei, Procaviacapensis); aardvarks (e.g., Oryceteropus afer); shrews (e.g., Suncus etruscus, Blarinabrevicauda, ​​Neomys fodiens); and manatees (Trichechus inunguis, Trichechus manatus, Trichechus manatus latirostris, Trichechus manatus manatus, Trichechussenegalensis).

[0088] In some embodiments, the cells used in the methods and compositions described herein are elephant cells. In some embodiments, the cells are elephant fibroblasts. In some embodiments, the cells are elephant stem cells. In some embodiments, the cells described herein are elephant somatic cells reprogrammed into stem cells or having a stem cell-like morphology and / or expressing at least one stem cell marker described herein.

[0089] The cells described herein can be derived from any tissue isolated from an organism using methods known in the art. For example, placental tissue can be isolated from a given organism (e.g., an elephant) after full-term delivery of a juvenile, and subsequently treated using methods known in the art for cell isolation and / or culture. Additional exemplary cell types that can be used in the compositions and methods described herein include, but are not limited to, fibroblasts, skin cells, blood cells (e.g., leukocytes, monocytes, dendritic cells), stem cells, hematopoietic cells, hepatocytes, vascular cells, muscle cells, pancreatic cells, nerve cells, eye cells or retinal cells, epithelial or endothelial cells, lung cells, heart cells, intestinal cells, diaphragmatic cells, kidney (i.e., kidney) cells, bone marrow cells, or any one or more selected tissues or cells of an organism, contemplated for genetic modification or gene editing to express woolly mammoth genes.

[0090] In some implementations, the isolated nucleic acids and vectors described herein are used for stem cells. Stem cells are cells that retain the ability to self-renew through cell division via mitosis and can differentiate into more specialized cell types. Three broad types of mammalian stem cells include: embryonic stem (ES) cells present in the blastocyst, induced pluripotent stem cells (iPSCs) reprogrammed from somatic cells, and adult stem cells present in adult tissues. Other sources of stem cells may include, for example, amniotic or placental stem cells. Pluripotent stem cells can differentiate into cells derived from any of the three germ layers.

[0091] In some embodiments, the recombinant host cell is a stem cell. Stem cells may be selected, for example, from induced blastocysts, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs). In some embodiments, the recombinant host cell is a reprogrammed cell. In some embodiments, the recombinant host cell is a fibroblast or mesenchymal cell. In some embodiments, the recombinant host cell is selected from nerve cells, chondrocytes, osteocytes, myocytes, adipocytes, and epidermal cells.

[0092] In some implementations, the recombinant host cells do not express at least one endogenous homolog of GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3. For example, recombinant host cells may not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP The 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, 30th, 31st, 32nd, 33rd, 34th, 35th, 36th, 37th, 38th, 39th, 40th, 41st, or 42nd endogenous homologs of L1, CXof58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

[0093] In some implementations, the recombinant host cell is an elephant cell, which may be selected, for example, from Asian elephant (Elephas maximus) cells, African elephant (Loxodonta africana) cells, African forest elephant (Loxodontacyclotis) cells, and Bornean elephant (Elephas maximus borneensis) cells.

[0094] Transgenic animals containing the recombinant host cells described herein are also provided. In some embodiments, the transgenic animals are Asian elephants (Elephas maximus), African elephants (Loxodonta africana), African forest elephants (Loxodonta cyclotis), and Bornean elephants (Elephas maximus borneensis).

[0095] Genetically modified animals

[0096] It also provides transgenic animals containing at least one woolly mammoth (true mammoth) gene variant. At least one woolly mammoth (true mammoth) gene variant may be selected, for example, from GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 1), etc. NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0097] In some implementations, the transgenic animals contain 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 mammoth gene variants.

[0098] In some implementations, the transgenic animals do not express GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 18). NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41) and TGM3 (SEQ IDThe endogenous homologs in NO:42 are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42.

[0099] In some implementations, the transgenic animals also contain LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, LOC126086152, and LOC12608629. 3. Deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein (a) the deleted nucleic acid sequence upstream of LOC126071805 contains SEQ ID NO. (a) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44, (b) The missing nucleic acid sequence upstream of LOC126075532 contains SEQ ID NO: 45, (d) The missing nucleic acid sequence upstream of LOC126075533 contains SEQ ID NO: 46, (e) The missing nucleic acid sequence upstream of AFP contains SEQ ID NO: 47, (f) The missing nucleic acid sequence upstream of LOC126079103 contains SEQ ID NO: 48, (g) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 49, (h) The missing nucleic acid sequence upstream of LOC126079327 contains SEQ ID NO: 50, (i) The missing nucleic acid sequence upstream of LOC126080333 contains SEQ ID NO: 51, (j) The missing nucleic acid sequence upstream of LOC126080367 contains SEQ ID NO: 43. NO: 52, (k) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 53, (l) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54, (m) The upstream missing nucleic acid sequence of LOC126080733 contains SEQ ID NO: 55, (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,(o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57, (p) The upstream missing nucleic acid sequence of LOC126085059 contains SEQ ID NO: 58, (q) The upstream missing nucleic acid sequence of LOC126085481 contains SEQ ID NO: 59, (r) The upstream missing nucleic acid sequence of LOC126086151 contains SEQ ID NO: 60, (s) The upstream missing nucleic acid sequence of LOC126086152 contains SEQ ID NO: 61, (t) The upstream missing nucleic acid sequence of LOC126086293 contains SEQ ID NO: 62, (u) LOC126058227 contains SEQ ID NO: 63, (v) The upstream missing nucleic acid sequence of LOC126058390 contains SEQ ID NO: 64, (w) The upstream missing nucleic acid sequence of LOC126058396 contains SEQ ID NO: 65, (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 57. NO: 66, (y)LOC126060018 upstream missing nucleic acid sequence contains SEQ ID NO: 67, (z)LOC126060570 upstream missing nucleic acid sequence contains SEQ ID NO: 68, (aa)CCDC15 upstream missing nucleic acid sequence contains SEQ ID NO: 69, (bb)INO80B upstream missing nucleic acid sequence contains SEQ ID NO: 70, (cc)LOC126062579 upstream missing nucleic acid sequence contains SEQ ID NO: 71, (dd)LOC126063153 upstream missing nucleic acid sequence contains SEQ ID NO: 72, (ee)LOC126063990 upstream missing nucleic acid sequence contains SEQ ID NO: 73, (ff)LOC126063991 upstream missing nucleic acid sequence contains SEQ ID NO: 74, (gg)LOC126066513 upstream missing nucleic acid sequence contains SEQ ID NO: 68. The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76, the upstream missing nucleic acid sequence of (ii)AWAT1 contains SEQ ID NO: 77, the upstream missing nucleic acid sequence of (jj)TMEM187 contains SEQ ID NO: 78, and the upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0100] In some implementations, the genetically modified animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), or a Bornean elephant (Elephas maximus borneensis).

[0101] Methods of introducing woolly mammoth gene variants or deletions of regulatory elements into cells

[0102] In some embodiments in any aspect, the cellular composition described herein expresses a polypeptide encoded by at least one isolated nucleic acid sequence having a woolly mammoth gene variant nucleotide sequence (including, but not limited to, exogenous woolly mammoth gene variants as described above and in Table 1 of WO2022 / 125940, which is incorporated herein by reference in its entirety).

[0103] The cells described herein can be transfected with the exogenous woolly mammoth gene encoded by the isolated nucleic acid described herein, or the cells described herein can be contacted with the exogenous woolly mammoth gene encoded by the isolated nucleic acid described herein, or the exogenous woolly mammoth gene encoded by the isolated nucleic acid described herein can be applied to the cells described herein, using methods known in the art.

[0104] In some implementations, at least one nucleic acid sequence encoding woolly mammoth genes is delivered via a vector.

[0105] A vector is a nucleic acid construct designed for delivery to host cells or for the transfer of genetic material between different host cells. As used herein, a vector can be viral or non-viral. The term "vector" includes any genetic element that, when bound to suitable control elements, is capable of replicating and transferring genetic material into cells. Vectors can include, but are not limited to, cloning vectors, expression vectors, plasmids, bacteriophages, transposons, granules, artificial chromosomes, viruses, viral particles, etc.

[0106] In some implementations of any aspect, the vector is selected from plasmids, granules, and viral vectors.

[0107] An expression vector is a vector that directs the expression of RNA or polypeptide (e.g., woolly mammoth polypeptide) from a nucleic acid sequence linked to a transcriptional regulatory sequence contained on the vector. The expressed sequence will usually, but not necessarily, be heterologous to the cell; the woolly mammoth gene introduced into a living cell is heterologous to the cell. Expression vectors may contain additional elements; for example, an expression vector may have two replication systems, thus allowing it to be maintained in two organisms (e.g., in the animal cell used for expression and in the prokaryotic host used for cloning and amplification). “Expression” refers to the cellular processes involved in the production of RNA and proteins, and, where appropriate, the secretion of proteins, including, where applicable, including but not limited to, transcription, transcript processing, translation, and protein folding, modification, and processing. “Expression products” include RNA transcribed from a gene and polypeptides obtained by translating mRNA transcribed from a gene.

[0108] In some implementations, the vector is capable of driving the expression of one or more sequences in mammalian cells; that is, the vector is a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329:840) and pMT2PC (Kaufman et al., 1987. EMBO J. 6:187-195). When used in mammalian cells, the control function of the expression vector is typically provided by one or more regulatory elements. For example, commonly used promoters are derived from polyomaviruses, adenovirus type 2, cytomegaloviruses, simian virus 40, and other viruses disclosed herein and known in the art. For other suitable expression systems for prokaryotic and eukaryotic cells, see, for example, Chapters 16 and 17 of Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0109] Methods to suppress or edit endogenous gene expression

[0110] In some embodiments of any aspect, the cells described herein do not express an endogenous homolog of at least one woolly mammoth gene variant described herein. In another embodiment of any aspect, the cells are edited to suppress the expression of an endogenous homolog of at least one woolly mammoth gene variant. In yet another embodiment of any aspect, the cells are edited to alter regulatory and / or coding regions to incorporate substitutions such that the endogenous homolog is similar to at least one woolly mammoth gene variant.

[0111] In another implementation of any aspect, the non-woolly mammoth homolog of the exogenous nucleic acid sequence has been deleted or inactivated.

[0112] This paper considers that when delivering one or more woolly mammoth gene variants to host cells, it may be advantageous to modify one or more genes with endogenous non-woolly mammoth homologs to render one or more endogenous genes nonfunctional. This paper also considers that if two or more woolly mammoth genes are delivered to host cells, one or two endogenous host cell genes will be altered. Therefore, in this context, the host cell may contain at least one nonfunctional endogenous homolog of the corresponding woolly mammoth gene.

[0113] In the context of elephant cells, elephant homologs of one or more woolly mammoth genes to be expressed are altered, deleted, or repressed, so that only one or more woolly mammoth genes are expressed by the cell. This can be achieved, for example, through standard gene editing of target sequences. It is also considered that, in addition to simply inactivating endogenous genes, large-scale substitution of endogenous genes can be performed, for example via homologous recombination or via selective editing of non-mammoth homologous genes to encode and express mammoth variant gene sequences.

[0114] The target sequence can be determined by methods known in the art. For example, sequence alignment tools can be used to compare nucleic acid sequences from woolly mammoths with those from host organisms, such as the NCBI Basic Local Sequence Alignment Tool (BLAST), OrthoMaM, Ensembl, and / or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning the sequences, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared.

[0115] Methods for inhibiting gene function in host cells are known in the art. Non-limiting examples of gene knockdown, inhibition, and alteration include, for example, gene editing enzymes, transcription activator-like effector nucleases (TALENs), repressive nucleic acids, etc. Non-limiting embodiments of the types of repressive nucleic acids may include, for example, siRNA, shRNA, miRNA, and / or miRNA, which are known in the art. Those skilled in the art can design and test inhibitors targeting endogenous homologs of the thylacine gene variants described herein.

[0116] Methods for preparing and delivering gene editing systems are described in, for example, WO2015 / 013583 A2; U.S. Patent No. 10,640,789 B2; U.S. Publication No. US2019 / 0367948 A1; U.S. Publication No. 2017 / 0266320 A1; U.S. Publication No. 2018 / 0171361 A1; U.S. Publication No. 2016 / 0175462 A1; and U.S. Publication No. 2018 / 0195089 A1, the contents of each of which are incorporated herein by reference in their entirety.

[0117] Implementation Plan

[0118] The present invention also provides the following non-limiting embodiments.

[0119] Implementation scheme 1 is an isolated nucleic acid sequence comprising a nucleotide sequence encoding an amino acid sequence, having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-associated protein 5 (NCKAP5) (SEQ ID NO: 7), laminin β4 subunit (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 8). NO: 9), adhesion-like G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), nerve injury-inducing protein 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), cation channel sperm-associated helper subunit β (CATSPERB) (SEQ ID NO: 13), pecanex-like protein 4 (PCNXL4) (SEQ ID NO: 14), nuclear membrane protein 2 containing spectrin repeat sequence (SYNE2) (SEQ ID NO: 15), NLR family protein 12 containing pyrin domain (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat domain 90 (WDR90) (SEQ ID NO: 18), breast cancer 2 (BRCA2) (SEQ ID NO: 19), protein kinase, DNA activation catalytic subunit (PRKDC) (SEQ ID NO: 20), vacuole sorting 13 homolog B (VPS13B) (SEQ ID NO: 9). SEQ ID NO: 21), Sphingolipid-activated proteinogen (PSAP) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin Heavy Chain 4 (MYH4) (SEQ ID NO: 27), Phosphoinositol Interaction Regulator of TRP (PIRT) (SEQ ID NO: 28), Polycystin 1-like Protein 2 (PKD1L2) (SEQ ID NO: 28)NO: 29), Retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid hormone receptor-associated protein 3 (THRAP3) (SEQ ID NO: 34), Centromere protein C1 (CENPC1) (SEQ ID NO: 35), Dentin formation and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), Fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), Cation channel sperm-associated helper subunit γ (CATSPERG) (SEQ ID NO: 38), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 29). NO: 41) and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

[0120] Implementation Scheme 2 is the isolated nucleic acid sequence of Implementation Scheme 1, wherein the nucleotide sequence encodes at least one of the following amino acids: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 18), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC12608676 NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYHl (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0121] Implementation scheme 3 is an isolated vector containing the isolated nucleic acid sequence described in implementation scheme 1 or 2.

[0122] Implementation scheme 4 is a recombinant host cell containing at least one isolated nucleic acid sequence as described in implementation scheme 1 or 2.

[0123] Implementation scheme 5 is a recombinant host cell comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), ... and NLRP12 (SEQ ID NO: 17). NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO:35), DSPP (SEQ ID NO:36), FGF5 (SEQ ID NO:37), CATSPERG (SEQ ID NO:38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0124] Implementation Scheme 6 is the recombinant host cell described in Implementation Scheme 5, wherein the host cell comprises a nucleotide sequence having at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC12608 ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 23) NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0125] Implementation scheme 7 is a recombinant host cell according to any one of implementation schemes 4 to 6, wherein the recombinant host cell comprises the isolated nucleic acid according to claim 1 or 2 of claim 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42.

[0126] Implementation scheme 8 is a recombinant host cell containing LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, distal homeobox-free 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, and LOC1260 The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein:

[0127] (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43,

[0128] (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44.

[0129] (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO: 45.

[0130] (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO: 46.

[0131] (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47,

[0132] (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO: 48.

[0133] (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 49.

[0134] (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 50.

[0135] (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51,

[0136] (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO: 52.

[0137] (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO: 53.

[0138] (1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54,

[0139] The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO: 55.

[0140] (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,

[0141] (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57,

[0142] (p)LOC126085059 contains the upstream missing nucleic acid sequence of SEQ ID NO: 58.

[0143] (q)LOC126085481 contains the upstream missing nucleic acid sequence including SEQ ID NO: 59.

[0144] (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO: 60.

[0145] The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO: 61.

[0146] The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO: 62.

[0147] (u)LOC126058227 contains SEQ ID NO: 63,

[0148] (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO: 64.

[0149] The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO: 65.

[0150] (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66,

[0151] The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO: 67.

[0152] (z)LOC126060570 contains the upstream missing nucleic acid sequence of SEQ ID NO: 68.

[0153] (aa) The upstream missing nucleic acid sequence of CCDC15 contains SEQ ID NO: 69,

[0154] (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70,

[0155] The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO: 71.

[0156] The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO: 72.

[0157] The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO: 73.

[0158] The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO: 74.

[0159] The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75.

[0160] The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76.

[0161] (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77,

[0162] The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and

[0163] The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0164] Implementation scheme 9 is the recombinant host cell described in implementation scheme 7, which further includes LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, and LOC12 The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein:

[0165] (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43,

[0166] (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44.

[0167] (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO: 45.

[0168] (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO: 46.

[0169] (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47,

[0170] (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO: 48.

[0171] (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 49.

[0172] (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 50.

[0173] (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51,

[0174] (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO: 52.

[0175] (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO: 53.

[0176] (1) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54,

[0177] The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO: 55.

[0178] (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,

[0179] (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57,

[0180] The upstream missing nucleic acid sequence of (p)LOC1 26085059 contains SEQ ID NO: 58.

[0181] (q)LOC1126085481 contains the upstream missing nucleic acid sequence of SEQ ID NO: 59.

[0182] (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO: 60.

[0183] The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO: 61.

[0184] The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO: 62.

[0185] (u)LOC126058227 contains SEQ ID NO: 63,

[0186] (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO: 64.

[0187] The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO: 65.

[0188] (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66,

[0189] The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO: 67.

[0190] (z)LOC126060570 contains the upstream missing nucleic acid sequence of SEQ ID NO: 68.

[0191] (aa) The upstream missing nucleic acid sequence of CCDC1 5 contains SEQ ID NO: 69,

[0192] (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70,

[0193] The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO: 71.

[0194] The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO: 72.

[0195] The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO: 73.

[0196] The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO: 74.

[0197] The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75.

[0198] The upstream missing nucleic acid sequence of (hh)LOC1 26066877 contains SEQ ID NO: 76.

[0199] (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77,

[0200] The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and

[0201] The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0202] Implementation scheme 10 is the recombinant host cell of any one of implementation schemes 4 to 9, wherein the recombinant host cell is a stem cell.

[0203] Implementation scheme 11 is the recombinant host cell described in implementation scheme 10, wherein the stem cell is selected from induced stem cells, embryonic stem (ES) cells or mesenchymal stem cells (MSC).

[0204] Implementation scheme 12 is a recombinant host cell as described in any one of implementation schemes 4 to 9, wherein the recombinant host cell is a reprogrammed cell.

[0205] Implementation scheme 13 is the recombinant host cell of any one of implementation schemes 4 to 9, wherein the recombinant host cell is a fibroblast or a mesenchymal cell.

[0206] Implementation scheme 14 is the recombinant host cell of any one of implementation schemes 4 to 9, wherein the recombinant host cell is selected from nerve cells, chondrocytes, osteocytes, myocytes, adipocytes, and epidermal cells.

[0207] Implementation scheme 15 is a recombinant host cell as described in any one of implementation schemes 4 to 14, wherein the recombinant host cell does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, or WDR90. The endogenous homolog of at least one of BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPCI, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP and TGM3.

[0208] Implementation Scheme 16 is the recombinant host cell described in Implementation Scheme 15, wherein the recombinant host cell does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, or PIRT. The endogenous homologs of PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3 are 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42.

[0209] Implementation scheme 17 is a recombinant host cell as described in any one of implementation schemes 3 to 16, wherein the recombinant host cell is an elephant cell.

[0210] Implementation scheme 18 is the recombinant host cell described in implementation scheme 17, wherein the elephant cell is selected from Asian elephant (Elephas maximus) cells, African elephant (Loxodonta afrricana) cells, African forest elephant (Loxodontacyclotis) cells, and Bornean elephant (Elephas maximus borneensis) cells.

[0211] Implementation scheme 19 is a transgenic animal containing the recombinant host cell of any one of implementation schemes 3 to 18.

[0212] Implementation scheme 20 is the transgenic animal described in implementation scheme 19, wherein the transgenic animal is the Asian elephant (Elephas maximus), the African elephant (Loxodonta africana), the African forest elephant (Loxodonta cyclotis), and the Bornean elephant (Elephas maximus borneensis).

[0213] Implementation scheme 21 is a transgenic animal containing at least one woolly mammoth (true mammoth) gene variant.

[0214] Implementation Scheme 22 is the transgenic animal described in Implementation Scheme 21, wherein at least one woolly mammoth (true mammoth) gene variant comprises a nucleotide sequence encoding an amino acid sequence that has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), and 5. NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 21), NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 29) NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC1 26069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

[0215] Implementation scheme 23 is the transgenic animal described in implementation scheme 22, wherein the at least one woolly mammoth (true mammoth) gene variant comprises at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 1), ... NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO: 39), MYH13 (SEQ ID NO: 40), ATRIP (SEQ ID NO: 41) and TGM3 (SEQ ID NO: 42).

[0216] Implementation scheme 24 is any one of implementation schemes 21 to 23, wherein the transgenic animal comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 woolly mammoth (true mammoth) gene variants.

[0217] Implementation Scheme 25 is the transgenic animal described in any one of Implementation Schemes 21 to 24, wherein the transgenic animal further comprises LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, distal homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, and LOC12608 6152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, Forkhead Box H1 (FOXH1), LOC126060018, LOC126060570, Protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC12606 The deletion of at least one nucleotide sequence upstream of the transcription start site of 2579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein:

[0218] (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43,

[0219] (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO: 44.

[0220] (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO: 45.

[0221] (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO: 46.

[0222] (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47,

[0223] (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO: 48.

[0224] (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 49.

[0225] (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO: 50.

[0226] (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51,

[0227] (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO: 52.

[0228] (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO: 53.

[0229] (l) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO: 54.

[0230] The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO: 55.

[0231] (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56,

[0232] (o) The upstream missing nucleic acid sequence of ECM2 contains SEQ ID NO: 57,

[0233] (p)LOC126085059 contains the upstream missing nucleic acid sequence of SEQ ID NO: 58.

[0234] (q)LOC126085481 contains the upstream missing nucleic acid sequence including SEQ ID NO: 59.

[0235] (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO: 60.

[0236] The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO: 61.

[0237] The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO: 62.

[0238] (u)LOC126058227 contains SEQ ID NO: 63,

[0239] (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO: 64.

[0240] The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO: 65.

[0241] (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66,

[0242] The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO: 67.

[0243] (z)LOC126060570 contains the upstream missing nucleic acid sequence of SEQ ID NO: 68.

[0244] (aa) The upstream missing nucleic acid sequence of CCDC15 contains SEQ ID NO: 69,

[0245] (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70,

[0246] The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO: 71.

[0247] The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO: 72.

[0248] The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO: 73.

[0249] The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO: 74.

[0250] The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO: 75.

[0251] The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO: 76.

[0252] (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77,

[0253] The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and

[0254] The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO: 79.

[0255] Implementation Scheme 26 is the transgenic animal described in any one of Implementation Schemes 21 to 25, wherein the transgenic animal does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, An endogenous homolog of at least one of BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

[0256] Implementation Scheme 27 is the transgenic animal described in Implementation Scheme 26, wherein the transgenic animal does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, Endogenous homologs 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 of PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP and TGM3.

[0257] Implementation scheme 28 is the transgenic animal described in any one of implementation schemes 21 to 27, wherein the transgenic animal is an elephant.

[0258] Implementation scheme 29 is the transgenic animal described in implementation scheme 28, wherein the elephant is selected from Asian elephant (Elephas maximus), African elephant (Loxodonta africana), African forest elephant (Loxodonta cyclotis) and Bornean elephant (Elephas maximus borneensis). Example

[0259] Example 1: Identification of woolly mammoth variants

[0260] Variants from 46 woolly mammoths, 12 Asian elephants, and 27 African elephants were identified using the mEleMax1 reference genome. Reads were pruned using AdapterRemoval1 or fastp to remove low-quality (qual < 25) ends and reads < 35 bp. Contaminants were detected using the Kraken pre-compiled database (minikraken2_v2_8GB_201904) with a confidence level of 0.8. Unclassified pruned reads were aligned to the reference genome using BWA Aln (seed 16,500, maximum edit distance 0.01, and maximum gap open 2). Optional tagging of duplicate reads was performed using PaleoMIX2 (mammoth samples) and PicardMarkDuplicates (elephant samples). Binary alignment maps (BAMs) from the same samples generated by multiple runs were merged using samtools3. Alignment quality was assessed using QualiMap4, DamageProfiler5, and MultiQC6. Germplasm variation was detected using the following tools: Samtools / Bcftools3 and GATK47. Genotyping of GVCF files was determined using GLnexus8. Variation effects were determined using SNPEff9. Variations were filtered if they were observed in both Asian and African elephant samples, as well as in both repeat regions and CpG island regions in Asian elephants.

[0261] The mammoth fixed variant was identified, and it was determined that the mammoth fixed variant must be (i) homozygous in all woolly mammoths with a so-called genotype with a read depth >5; (ii) not observed in Asian and African elephants; and (iii) not in repeat regions or CpG island regions.

[0262] A mEleMax1 siftDB was created. Missense variants were annotated using the siftDB to predict effects. Genes were sorted based on the sum of Sift scores for missense variants found in at least five mammoths.

[0263] Paired whole-genome alignments were generated between the Asian elephant reference genome mEleMax1 from UCSC and the human reference genome Hg38 using SegAlign10. Using these paired alignments, CrossMap regions were used to transform the genomic coordinates of several publicly available datasets. TF clusters, including an ENCODE 3 regulatory track (a transcription factor Chip-Seq cluster of 340 TFs across 129 cell types), from Hg38 were downloaded from UCSC12-14. Data on functional elements and ENCODE cCREs (candidate cis-regulatory elements) from NCBI RefSeq were also downloaded from UCSC14,15 For the mouse genome Mm10, these steps were repeated. The results are a dataset of putative regulatory elements in the Asian elephant genome derived from experimental data in humans and mice. BEDTools was then used for intersection analysis to identify putative regulatory regions overlapping with fixed mammoth gene variants16. Next, BEDTools closest was used to identify the nearest mEleMax1 gene 16 for each putative regulatory region. These regulatory regions were then filtered within 2kb of the nearest neighboring gene.

[0264] Based on data analysis, a series of protein-coding gene variants were identified in the woolly mammoth genome that are not present in the comparative elephant genome. Table 1 provides a list of woolly mammoth gene variants encoding these proteins.

[0265] Table 1: Gene variants encoding proteins

[0266]

[0267] In addition, a set of regulatory element variants (i.e. deletions) not present in the comparative elephant genome were identified in the woolly mammoth genome. Regulatory target variants are provided in Table 2.

[0268] Table 2: Variations of Control Elements

[0269]

[0270] Example 2: Targeted Editing of FGF5

[0271] FGF5 encodes proteins in the FGF family that are involved in embryonic development, cell growth and tissue repair, as well as other biological functions. This gene is closely associated with the inhibition of hair elongation by promoting movement from the anagen to catagen phases during the hair follicle cycle.

[0272] FGF5 is closely involved in hair development, particularly in the anagen-catagen cycle of the hair follicle. Mutations in truncated variants of this protein, resulting from single nucleotide deletions and subsequent premature stop codon formation, are associated with non-characteristic long hair phenotypes in multiple species. This appears to primarily affect only certain hair types (i.e., downy fur in rabbits and facial hair in humans). This truncated protein is not specifically associated with detrimental developmental phenotypes.

[0273] CRISPR (such as, for example, CRISPR-Cas9 or CRISPR-Cas12) can be used to knock out FGF5 in cells to be edited. A CRISPR (such as, for example, CRISPR-Cas9 or CRISPR-Cas12) system can contain a targeting guide sequence having the following sequence: TGAGGAAAGAAGCAGGAGGG (SEQ ID NO: 80). Editing Asian elephant (Elephas maximus) cells to incorporate an insertion / deletion into FGF5.

[0274] Disruption of FGF5 involves multiple biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. This gene has been identified as an oncogene, conferring transformative potential upon transfection into mammalian cells. Targeted disruption of homologs of this gene in mice results in an abnormally long hair phenotype, suggesting its function as an inhibitor of hair elongation. Variants of the alternative splicing transcript encoding different isotypes have been identified. Gene editing via knockout-based mechanisms such as CRISPR (e.g., CRISPR-Cas9 or CRISPR-Cas12) at SNP sites observed in comparisons of mammoth and elephant genomes is expected to result in truncated variants of FGF5. Due to a reduced systemic capacity to promote the movement of hair follicles from the anagen to catagen phases, a phenotypic response to this disrupted gene is expected to be organisms with significantly elongated hair.

[0275] Example 3: Substitution of NINJ1 and NCKAP5 genes and integration efficiency of attB site tested via RNP and ssODN

[0276] Transfection reagent

[0277] Thaw the following reagents on ice as needed: (a) Editor Alt-RTM SpCas9 nuclease V3 protein (1 mg / ml), Alt-RTMA.s.Cas12a (1 mg / ml) or plasmid editor; (b) gRNA: 100 μM sgRNA dissolved in 15 μl of nuclease-free water (Synthego; Redwood City, CA); (c) Donor: Homologous directed repair (HDR) donor plasmid or linear dsDNA (PCR purified); (d) Alt-RTM HDR-enhancer V2; (e) Pifithrin-α (P53 inhibitor). Determine the location of the RNP buffer and transfection cuvettes, and the RNP buffer and transfection cuvettes shall include the following: (a) P3 primary cell Nucleofector™ M solution (LONZA™ P3 primary cell 4D-NUCLEOFECTOR™ X kit L (Lonza kit; Lonza; Basel, Switzerland)); (b) replenishment buffer 1 (Lonza); and (c) 100 μl Nucleofector™ (Lonza).

[0278] Prepared transfection reagent

[0279] Editing proteins were hybridized with sgRNA to form Cas9 ribonuclease (RNP) by combining equal volumes of Alt-RTM SpCas9 nuclease V3 protein (1 mg / ml), 100 μM sgRNA, and nuclease-free water for at least ten minutes. Because the editing proteins have different affinities for different sgRNA sequences, each sgRNA or crRNA hybridized independently.

[0280] Use 2.5 μl of each reagent as a standard volume, except for NCKAP5, with 3.33 μl and 1.67 μl used for each RNP to compensate for efficiency differences between RNPs. Prepare P3 / S1 buffer (82% P3, 18% S1). This buffer is used to directly resuspend cells before transfection. Use 2.5 μg of mid-prepped HDR donor plasmid. Prepare P3 / S1 buffer (82% P3, 18% S1). This buffer is used to directly resuspend cells before transfection. 100 μl of P3 / S1 buffer is used for a single reaction.

[0281] Plasmid-based editing response

[0282] The equation for calculating the volume of plasmid added to the editing reaction is as follows: Plasmid volume (μl) = Required amount of plasmid (ng) / Plasmid concentration (ng / μl). Plasmid-based editing reaction reagents do not require incubation, and the donor is mixed with the editor and gRNA before being added to cells.

[0283] Transfection reaction

[0284] Prior to transfection, the cells are healthy, growing, and nearly confluent. Use at least 500,000 cells, ideally 1,000,000 or more, for each transfection reaction. Enrich with alternative cells using FACS.

[0285] To prepare cells for transfection, culture medium was aspirated from the cells using a 2 ml serum pipette connected to a vacuum pressure and a sterile nonfiltered tip. Cells were washed in 1X PBS, agitated to ensure complete coverage. The 1X PBS was then aspirated from the cells, followed by washing again in 1X PBS. 0.25% trypsin was added directly to the cells, agitated to ensure complete coverage. Cells were incubated in trypsin for 2–3 minutes with agitation at 37°C and 5% CO2, and complete release was checked using a microscope. An equal volume of 1:1 culture medium was added to the cells to neutralize the trypsin, and cells were aliquoted into tubes for centrifugation. Cells were centrifuged at 300Xg for 10 min. T25 culture flasks were prepared by adding 5 ml of 1:1 culture medium, 1 μl of pifithrin-α, and 7.14 μl of Alt-RTM HDR-enhancer V2. Remove the supernatant from the centrifuged cells and resuspend the cells in 1 ml of 1:1 medium. For each sample, add 10 μl of the resuspended cells to 10 μl of trypan blue and count the cells by adding 10 μl to a cell counter. Centrifuge the remaining cells at 300Xg for 10 min, remove the supernatant, and resuspend the cells in P3 / S1 buffer. Add the premix of guide sequence / editor / water and HDR donor to the P3 / S1 resuspended cells to a total volume of 100 μl. Add 100 μl to a 100 μl cuvette and transfect the cells using a Lonza nucleofector. Transfer the transfected cells to a T25 culture flask and add another 100 μl of 1:1 medium from the flask to the cuvette, then transfer the remaining cells to the flask. Incubate the flasks for 24 h, changing the medium only with 1:1 medium.

[0286] Preparation of 1:1 standard growth medium

[0287] Combine the following substances and filter sterilize to obtain 1 liter of "1:1 culture medium": 300 ml Ham's F12 (ThermoFisher Scientific, Waltham, MA), 200 ml HI FBS (Thermo Fisher), 5 ml 2 mM GlutaMAX (Thermo Fisher), 5 ml 100X NEAA (Thermo Fisher), 5 ml 100X Anti / Anti (Thermo Fisher), 50 μl 100 ng / μl bFGF (StemCell Technologies, Vancouver, BC, Canada), 50 μl 100 μg / μl EGF (StemCell Technologies), 1 ml 55 mM BME (Thermo Fisher Scientific, Waltham, MA), 1 ml ... Fisher), 5 μl of 50 mg / ml ascorbic acid (Sigma-Aldrich, Burlington, MA), 500 ml of EGM-2 Bullet Kit medium (Lonza, Walkersville, MD), and EGM-2 Bullet Kit supplement (Lonza).

[0288] Cell populations enriched by FACS

[0289] Perform FACS to enrich cell populations expressing stable fluorescent proteins (e.g., GFP). Transient expression is typically completed 7 days post-transfection, and fluorescent protein expression beyond 8 days post-transfection usually represents stable integrase. For FACS enrichment, plates are prepared to receive sorted cell samples by adding a 1:1 mixture of medium and filtered FBS. Cell clumps are generated as described below. Samples are sorted on ice and transported directly to the FACS facility along with tissue culture plates. Cells are sorted into plates. Sorted plates are directly transferred back to the incubator for culture. Cells are examined on the second day to confirm population adhesion and expansion. Pass rate and the filter used are recorded. For 96-well and 384-well plates, medium replacement is not required for the first 5 days post-transfection. On day 5, and every 2 to 3 days until cell passage or well filling, 1:1 medium is added directly to the wells without medium replacement to give cells more time in PBS-rich medium before detachment.

[0290] Sequence verification

[0291] Following the cell precipitation steps described above, a cell pellet of less than 1,000,000 to more than 20,000 cells is used for optimal cell lysis. The supernatant is removed, and the cells are frozen at -20°C for further lysis / DNA extraction.

[0292] For lysis and DNA extraction, lysis stock buffers were prepared by combining a protein degrader (Life Sciences, Gene ArtGenomic Cleavage Kit) and a Quick Extract DNA Extraction Solution at a ratio of 1 μl / 25 μl, respectively. The lysis buffer was added to a tube containing dried and thawed cell clumps. The cell clumps were vortexed for 10–15 seconds. The contents were transferred to a tube and placed on a 65°C heating block or thermal cycler for 6 minutes. The tube was vortexed for 10–15 seconds and then transferred to a 98°C heating block for 2 minutes. The sample was lysed, and 5 μl or less of the lysate was used in subsequent PCR reactions.

[0293] Replace PCR genotyping

[0294] Primers used for the first round of PCR were designed with one primer on the outer side of the homologous arm and a second primer binding to the genome / donor locus before the reporter gene insertion site. Primers were designed for nested PCR at each end to allow all variants and cleavage sites to be used for PCR reactions and Sanger sequencing in the case of the second round of PCR. Q5 polymerase is recommended to improve sequence quality and for improved long-range PCR amplification. High concentrations and high-quality DNA are preferred. For the PCR1 reaction mixture, 20 μl of the reaction mixture containing the following: (a) 10 μl High-fidelity DNA polymerase (2X); 0.2 μl of forward primer and 0.2 μl of reverse primer (10 μM); (c) 1 μl of each cell lysate; (d) bring the volume to 20 μl with nuclease-free water. A positive control was prepared for each uniquely edited amplicon. A negative control without cell lysates was also prepared. For PCR1 reactions, the following conditions were used in a thermal cycler: 105°C hot-top temperature; 20 μl volume: 1X 98°C for 2 min; 20X: 98°C for 10 s, primer-specific annealing for 30 s, 72°C for approximately 30 s / kbps DNA; 1X 72°C for 30 s / kbps; 4°C indefinitely. PCR products were then visualized on a gel.

[0295] For the PCR2 reaction mixture, mix 30 μl of the reaction mixture containing the following substances: (a) 15 μl High-fidelity DNA polymerase (2X); 0.3 μl forward primer and 0.3 μl reverse primer (10 μM); (c) 1 μl of first-round PCR product; (d) Nuclease-free water to a final volume of 30 μl. Positive controls were prepared for each uniquely edited amplicon. Negative controls without template were also prepared, containing first-round PCR product without added DNA. For PCR2 reactions, the following conditions were used in a thermal cycler: 105°C hot-top temperature; 30 μl volume: 1X 98°C for 2 min; 20X: 98°C for 10 s, primer-specific annealing for 15 s, 72°C for approximately 30 s / kbps DNA; 1X 4°C indefinite incubation; PCR products were stored for Sanger sequencing.

[0296] Perform gel validation on PCR products from Round 1 and 10X PCR reactions. Submit samples for Sanger sequencing. Record any samples without more than 50 CRLs or more than 30 QSs. Align sequences with target sequences and visually inspect the files to ensure they align to the expected locations and check for other potential issues in quality or coverage. Perform Synthego ICE analysis according to online-available templates and instructions.

[0297] Cloning and cryopreservation (cryobanking)

[0298] Based on sequence validation, by verifying the presence of the desired edit and the percentage of the population with that edit, it is determined whether further enrichment is needed. For samples that have been verified to have the desired edit and do not require further enrichment, the steps for clonal isolation and enrichment of the population and the genotyping described above are repeated. For samples that have been verified to have the desired edit and do not require further enrichment, the samples are amplified and cryopreserved as modified cell lines.

[0299] Editing checkpoints, clonal growth, and WGS-based on-target / off-target analysis

[0300] Expand the modified cell lines and use them for repeated applications. Once more than 5 valid edits have been performed, allocate at least 1 x 10⁶ cells for WGS analysis to determine on-target / off-target effects. To prepare WGS samples, centrifuge the cells at 300 x g and remove the supernatant. Then, rapidly freeze the cell clumps in liquid nitrogen and store them under liquid nitrogen conditions.

[0301] in conclusion

[0302] Gene substitutions of the NINJ1 and NCKAP5 genes were performed sequentially in the same cell lines, and the first and second enrichment scores of insertion / deletion and knock-in for these cell lines were shown in the results. Figures 1A to 1DThis method successfully produced cell lines that, based on genotyping of the parental lines, exhibited approximately 20% substitution for all expected mammoth-specific substitutions in the NINJ1 and NCKAP5 genes.

[0303] Those skilled in the art will understand that changes can be made to the embodiments without departing from its broad inventive concept. Therefore, it should be understood that the invention is not limited to the specific embodiments disclosed, but is intended to cover modifications within the spirit and scope of the invention as defined in this specification.

[0304] References

[0305] 1. Schubert, M., Lindgreen, S. & Orlando, L. AdapterRemoval v2: rapid adapter trimming, identification, and read merging. BMC Res. Notes 9, 88 (2016).

[0306] 2. Schubert, M. et al. Characterization of ancient and modem genomes by SNP detection and phylogenomic and metagenomic analysis using PALEOMIX. Nat. Protoc. 9, 1056-1082 (2014).

[0307] 3. Li, H. et al. The Sequence Alignment / Map format andSAMtools. Bioinformatics 25, 2078-2079(2009).

[0308] 4. García-Alcalde, F. et al. Qualimap: evaluating next-generation sequencing alignment data. Bioinformatics 28, 2678-2679 (2012).

[0309] 5.J ónsson,H.,Ginolhac,A.,Schubert,M.,Johnson,P.L.F.&Orlando,L.mapDamage2.0:fast approxi mate Bayesian estimates of ancient DNA damageparameters.Bioinformatics 29,1682-1684(2013).

[0310] 6.Ewels,P.,Magnusson,M.,Lundin,S.& M.MultiQC:summarize analysisresults for multiple tools and samples in a single report.Bioinformatics 32,3047-3048(2016).

[0311] 7.McKenna,A.et al.The Genome Analysis Toolkit:a MapReduce frameworkfor analyzing next-generation DNA sequencing data.Genome Res.20,1297-1303(2010).

[0312] 8.Lin,M.F.et al.GLnexus:joint variant calling for large cohortsequencing.http: / / biorxiv.org / lookup / doi / 10.1101 / 343970(2018)doi:10.1101 / 343970.

[0313] 9.Cingolani,P.et al.A program for annotating and predicting theeffects of single nucleotide polymorphisms,SnpEff.Fly(Austin)6,80-92(2012).

[0314] 10.Goenka,S.D.,Turakhia,Y.,Paten,B.&Horowitz,M.SegAlign:A ScalableGPU-Based Whole Genome Aligner.in SC20:International Conference for HighPerformance Computing,Net working,Storage and Analysis 1-13(IEEE,2020).doi:10.1109 / SC41405.2020.00043.

[0315] 11.Zhao,H.et al CrossMap:a versatile tool for coordinate conversionbetween genome assemblies.Bioinformatics 30,1006-1007(2014).

[0316] 12.ENCODE Project Consortium.An integrated encyclopedia of DNAelements in the human genome.Nature 489,57-74(2012).

[0317] 13.Luo,Y.et al.New developments on the Encyclopedia of DNA Elements(ENCODE)data portal.Nucleic Acids Res.48,D882-D889(2020).

[0318] 14.The ENCODE Project Consortium et al.Expanded encyclopaedias of DNAelements in the human and mouse genomes.Nature 583,699-710(2020).

[0319] 15.Pruitt,K.D.et al.RefSeq:an update on mammalian referencesequences.Nucleic Acids Res.42,D756-763(2014).

[0320] 16.Quinlan,A.R.&Hall,I.M.BEDTools:a flexible suite of utilities forcomparing genomic features.Bioinformatics 26,841-842(2010).

Claims

1. An isolated nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-associated protein 5 (NCKAP5) (SEQ ID NO: 7), laminin β4 subunit (LAMB4) (SEQ ID NO: 8), Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 9), adhesion-like G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 9). NO: 10), Nerve injury-inducing protein 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), Cation channel sperm-associated auxiliary subunit β (CATSPERB) (SEQ ID NO: 13), Pecanex-like protein 4 (PCNXL4) (SEQ ID NO: 14), Nuclear membrane protein 2 containing spectrin repeat sequence (SYNE2) (SEQ ID NO: 15), NLR family protein 12 containing pyrin domain (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat domain 90 (WDR90) (SEQ ID NO: 18), Breast cancer 2 (BRCA2) (SEQ ID NO: 19), Protein kinase, DNA activation catalytic subunit (PRKDC) (SEQ ID NO: 20), Vacuole sorting 13 homolog B (VPS13B) (SEQ ID NO: 21), Sphingolipid activator progenitourinone (PSAP) (SEQ ID NO: 10). NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), keratin 28 (KRT28) (SEQ ID NO: 24), keratin 35 (KRT35) (SEQ ID NO: 25), keratin 40 (KRT40) (SEQ ID NO: 26), myosin heavy chain 4 (MYH4) (SEQ ID NO: 27), TRP phosphoinositol interaction regulator (PIRT) (SEQ ID NO: 28), polycystin 1-like protein 2 (PKD1L2) (SEQ ID ...8) (SEQ ID NO: 29) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), keratin 28 (KRT28) (SEQ ID NO: 24), keratin 35 (KRT35) (SEQ ID NO: 25), keratin 40 (KRT40) (SEQ ID NO: 26), myosin heavy chain 4 (MYH4) (SEQ ID NO: 27), TRP phosphoinositol interaction regulator (PIRT) (SEQ ID NO: 28), polycystin 1-like protein 2 (PKD1L2) (SEQ ID NO: 29) (SEQ ID NO: 2NO: 29), Retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid hormone receptor-associated protein 3 (THRAP3) (SEQ ID NO: 34), Centromere protein C1 (CENPC1) (SEQ ID NO: 35), Dentin formation and dentin sialophosphoprotein (DSPP) (SEQ ID NO: 36), Fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), Cation channel sperm-associated helper subunit γ (CATSPERG) (SEQ ID NO: 38), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 29). NO: 41) and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

2. The isolated nucleic acid sequence according to claim 1, wherein the nucleotide sequence comprises at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

3. An isolated vector comprising the isolated nucleic acid sequence as described in claim 1 or 2.

4. A recombinant host cell comprising at least one isolated nucleic acid sequence as described in claim 1 or 2.

5. A recombinant host cell comprising a nucleotide sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), ... NLRP12 (SEQ ID NO: 17), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO:35), DSPP (SEQ ID NO:36), FGF5 (SEQ ID NO:37), CATSPERG (SEQ ID NO:38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

6. The recombinant host cell of claim 5, wherein the host cell comprises a nucleotide sequence having at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 18), BRCA2 (SEQ ID NO: 19), GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), THRAP3 (SEQ ID NO: 33) NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO: 38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

7. The recombinant host cell according to any one of claims 4 to 6, wherein the recombinant host cell comprises the isolated nucleic acid of claim 1 or 2 as described in claim 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42.

8. Recombinant host cells containing LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6 (distal homeobox-free), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, LOC126086152, and LOC126086. The deletion of at least one nucleotide sequence upstream of the transcription start site of LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein: (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43, (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO:

44. (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO:

45. (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO:

46. (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47, (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO:

48. (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

49. (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

50. (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51, (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO:

52. (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO:

53. (l) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO:

54. The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO:

55. (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The missing nucleic acid sequence upstream of ECM2 contains SEQ ID NO: 57, (p)LOC126085059 contains the upstream missing nucleic acid sequence of SEQ ID NO:

58. (q)LOC126085481 contains the upstream missing nucleic acid sequence including SEQ ID NO:

59. (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO:

60. The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO:

61. The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO:

62. (u)LOC126058227 contains SEQ ID NO: 63, (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO:

64. The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO:

65. (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66, The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO:

67. (z)LOC1 26060570 contains the upstream missing nucleic acid sequence of SEQ ID NO:

68. (aa) The upstream missing nucleic acid sequence of CCDC1 5 contains SEQ ID NO: 69, (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70, The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO:

71. The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO:

72. The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO:

73. The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO:

74. The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO:

75. The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO:

76. (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77, The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO:

79.

9. The recombinant host cell of claim 7, further comprising LOC126071805, WASHC4, LOC126075532, LOC126075533, AFP, LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, DLX6, ECM2, LOC126085059, LOC126085481, LOC126086151, and LOC1260 The deletion of at least one nucleotide sequence upstream of the transcription start site of 86152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, FOXH1, LOC126060018, LOC126060570, CCDC15, INO80B, LOC126062579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, AWAT1, TMEM187, and LOC126069912, wherein: (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43, (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO:

44. (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO:

45. (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO:

46. (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47, (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO:

48. (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

49. (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

50. (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51, (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO:

52. (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO:

53. (l) The upstream missing nucleic acid sequence of LOC1 26080369 contains SEQ ID NO: 54, The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO:

55. (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The missing nucleic acid sequence upstream of ECM2 contains SEQ ID NO: 57, (p)LOC126085059 contains the upstream missing nucleic acid sequence of SEQ ID NO:

58. (q)LOC126085481 contains the upstream missing nucleic acid sequence including SEQ ID NO:

59. (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO:

60. The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO:

61. The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO:

62. (u)LOC126058227 contains SEQ ID NO: 63, (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO:

64. The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO:

65. (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66, The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO:

67. (z)LOC126060570 contains the upstream missing nucleic acid sequence of SEQ ID NO:

68. (aa) The upstream missing nucleic acid sequence of CCDC15 contains SEQ ID NO: 69, (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70, The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO:

71. The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO:

72. The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO:

73. The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO:

74. The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO:

75. The upstream missing nucleic acid sequence of (hh)LOC126066877 contains SEQ ID NO:

76. (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77, The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO:

79.

10. The recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is a stem cell.

11. The recombinant host cell of claim 10, wherein the stem cell is selected from induced stem cells, embryonic stem (ES) cells, or mesenchymal stem cells (MSCs).

12. The recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is a reprogrammed cell.

13. The recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is a fibroblast or a mesenchymal cell.

14. The recombinant host cell according to any one of claims 4 to 9, wherein the recombinant host cell is selected from nerve cells, chondrocytes, osteocytes, myocytes, osteoblasts, adipocytes, and epidermal cells.

15. The recombinant host cell according to any one of claims 4 to 14, wherein the recombinant host cell does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, B An endogenous homolog of at least one of the following: RCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

16. The recombinant host cell of claim 15, wherein the recombinant host cell does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, Endogenous homologs 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 or 42 of PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP and TGM3.

17. The recombinant host cell according to any one of claims 3 to 16, wherein the recombinant host cell is an elephant cell.

18. The recombinant host cell of claim 17, wherein the elephant cell is selected from Asian elephant (Elephas maximus) cells, African elephant (Loxodonta africana) cells, African forest elephant (Loxodonta cyclotis) cells, and Bornean elephant (Elephas maximus borneensis) cells.

19. A transgenic animal comprising the recombinant host cell of any one of claims 3 to 18.

20. The transgenic animal as claimed in claim 19, wherein the transgenic animal is an Asian elephant (Elephas maximus), an African elephant (Loxodonta africana), an African forest elephant (Loxodonta cyclotis), and a Bornean elephant (Elephas maximus borneensis).

21. A transgenic animal containing at least one woolly mammoth (Mammuthus primigenius) gene variant.

22. The transgenic animal of claim 21, wherein the at least one woolly mammoth (true mammoth) gene variant comprises a nucleotide sequence encoding an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with at least one of the following: G protein-coupled receptor 98 (GPR98) (SEQ ID NO: 1), microtubule actin crosslinking factor 1 (MACF1) (SEQ ID NO: 2), adenosine deaminase RNA-specific B2 (ADARB2) (SEQ ID NO: 3), centrosome protein 290 (CEP290) (SEQ ID NO: 4), keratin 4 (KRT4) (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCK-associated protein 5 (NCKAP5) (SEQ ID NO: 7), laminin β4 subunit (LAMB4) (SEQ ID NO: 8), and Niemann-Pick C1-like protein 1 (NPC1L1) (SEQ ID NO: 8). NO: 9), adhesion-like G protein-coupled receptor D2 (ADGRD2) (SEQ ID NO: 10), nerve injury-inducing protein 1 (NINJ1) (SEQ ID NO: 11), AHNAK nucleoprotein 2 (AHNAK2) (SEQ ID NO: 12), cation channel sperm-associated helper subunit β (CATSPERB) (SEQ ID NO: 13), pecanex-like protein 4 (PCNXL4) (SEQ ID NO: 14), nuclear membrane protein 2 containing spectrin repeat sequence (SYNE2) (SEQ ID NO: 15), NLR family protein 12 containing pyrin domain (NLRP12) (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WD repeat domain 90 (WDR90) (SEQ ID NO: 18), breast cancer 2 (BRCA2) (SEQ ID NO: 19), protein kinase, DNA activation catalytic subunit (PRKDC) (SEQ ID NO: 20), vacuole sorting 13 homolog B (VPS13B) (SEQ ID NO: 9). SEQ ID NO: 21), Sphingolipid-activated proteinogen (PSAP) (SEQ ID NO: 22), SEC31 homolog B (SEC31B) (SEQ ID NO: 23), Keratin 28 (KRT28) (SEQ ID NO: 24), Keratin 35 (KRT35) (SEQ ID NO: 25), Keratin 40 (KRT40) (SEQ ID NO: 26), Myosin Heavy Chain 4 (MYH4) (SEQ ID NO: 27), Phosphoinositol Interaction Regulator of TRP (PIRT) (SEQ ID NO: 28) (SEQ ID NO: 29)NO: 28), Polycystic protein 1-like protein 2 (PKD1L2) (SEQ ID NO: 29), Retinitis pigmentosa 1-like protein (RP1L1) (SEQ ID NO: 30), X chromosome open reading frame 58 (CXorf58) (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 33), Thyroid hormone receptor-associated protein 3 (THRAP3) (SEQ ID NO: 34), Centromere protein C1 (CENPC1) (SEQ ID NO: 35), Dentin formation and dentin sialophospholipid (DSPP) (SEQ ID NO: 36), Fibroblast growth factor 5 (FGF5) (SEQ ID NO: 37), Cation channel sperm-associated helper subunit γ (CATSPERG) (SEQ ID NO: 38), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 28), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH13) (SEQ ID NO: 29), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 30 ...) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 13 (MYH1) (SEQ ID NO: 39), Myosin heavy chain 1 (MYH1) (SEQ ID NO: 39), Myosin NO: 40), ATR interacting protein (ATRIP) (SEQ ID NO: 41), and transglutaminase 3 (TGM3) (SEQ ID NO: 42).

23. The transgenic animal of claim 22, wherein the at least one woolly mammoth (true mammoth) gene variant comprises at least one of the following: GPR98 (SEQ ID NO: 1), MACF1 (SEQ ID NO: 2), ADARB2 (SEQ ID NO: 3), CEP290 (SEQ ID NO: 4), KRT4 (SEQ ID NO: 5), LOC126076011 (SEQ ID NO: 6), NCKAP5 (SEQ ID NO: 7), LAMB4 (SEQ ID NO: 8), NPC1L1 (SEQ ID NO: 9), ADDRD2 (SEQ ID NO: 10), NINJ1 (SEQ ID NO: 11), AHNAK2 (SEQ ID NO: 12), CATSPERB (SEQ ID NO: 13), PCNXL4 (SEQ ID NO: 14), SYNE2 (SEQ ID NO: 15), NLRP12 (SEQ ID NO: 16), LOC126086768 (SEQ ID NO: 17), WDR90 (SEQ ID NO: 1), ... NO: 18), BRCA2 (SEQ ID NO: 19), PRKDC (SEQ ID NO: 20), VPS13B (SEQ ID NO: 21), PSAP (SEQ ID NO: 22), SEC31B (SEQ ID NO: 23), KRT28 (SEQ ID NO: 24), KRT35 (SEQ ID NO: 25), KRT40 (SEQ ID NO: 26), MYH4 (SEQ ID NO: 27), PIRT (SEQ ID NO: 28), PKD1L2 (SEQ ID NO: 29), RP1L1 (SEQ ID NO: 30), CXorf58 (SEQ ID NO: 31), LOC126068772 (SEQ ID NO: 32), LOC126069872 (SEQ ID NO: 32) NO: 33), THRAP3 (SEQ ID NO: 34), CENPC1 (SEQ ID NO: 35), DSPP (SEQ ID NO: 36), FGF5 (SEQ ID NO: 37), CATSPERG (SEQ ID NO:38), MYH1 (SEQ ID NO:39), MYH13 (SEQ ID NO:40), ATRIP (SEQ ID NO:41) and TGM3 (SEQ ID NO:42).

24. The transgenic animal according to any one of claims 21 to 23, wherein the transgenic animal comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 woolly mammoth (true mammoth) gene variants.

25. The transgenic animal according to any one of claims 21 to 24, wherein the transgenic animal further comprises LOC126071805, WASH complex subunit 4 (WASHC4), LOC126075532, LOC126075533, alpha-fetoprotein (AFP), LOC126079103, LOC126079327, LOC126079327, LOC126080333, LOC126080367, LOC126080369, LOC126080369, LOC126080733, distal homeobox 6 (DLX6), extracellular matrix protein 2 (ECM2), LOC126085059, LOC126085481, LOC126086151, and LOC126086. 152, LOC126086293, LOC126058227, LOC126058390, LOC126058396, Forkhead Box H1 (FOXH1), LOC126060018, LOC126060570, Protein 15 containing coiled-coil domain (CCDC15), INO80 complex subunit B (INO80B), LOC12606 The deletion of at least one nucleotide sequence upstream of the transcription start site of 2579, LOC126063153, LOC126063990, LOC126063991, LOC126066513, LOC126066877, acyl-CoA wax alcohol acyltransferase 1 (AWAT1), transmembrane protein 187 (TMEM187), and LOC126069912, wherein: (a) The upstream missing nucleic acid sequence of LOC126071805 contains SEQ ID NO: 43, (b) The missing nucleic acid sequence upstream of WASHC4 contains SEQ ID NO:

44. (c) The upstream missing nucleic acid sequence of LOC126075532 contains SEQ ID NO:

45. (d) The upstream missing nucleic acid sequence of LOC126075533 contains SEQ ID NO:

46. (e) The upstream missing nucleic acid sequence of AFP contains SEQ ID NO: 47, (f) The upstream missing nucleic acid sequence of LOC126079103 contains SEQ ID NO:

48. (g)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

49. (h)LOC126079327 contains the upstream missing nucleic acid sequence of SEQ ID NO:

50. (i) The upstream missing nucleic acid sequence of LOC126080333 contains SEQ ID NO: 51, (j)LOC126080367 contains the upstream missing nucleic acid sequence of SEQ ID NO:

52. (k)LOC126080369 contains the upstream missing nucleic acid sequence of SEQ ID NO:

53. (l) The upstream missing nucleic acid sequence of LOC126080369 contains SEQ ID NO:

54. The upstream missing nucleic acid sequence of (m)LOC126080733 contains SEQ ID NO:

55. (n) The upstream missing nucleic acid sequence of DLX6 contains SEQ ID NO: 56, (o) The missing nucleic acid sequence upstream of ECM2 contains SEQ ID NO: 57, (p)LOC126085059 contains the upstream missing nucleic acid sequence of SEQ ID NO:

58. (q)LOC126085481 contains the upstream missing nucleic acid sequence including SEQ ID NO:

59. (r)LOC126086151 contains the upstream missing nucleic acid sequence of SEQ ID NO:

60. The upstream missing nucleic acid sequence of (s)LOC126086152 contains SEQ ID NO:

61. The upstream missing nucleic acid sequence of (t)LOC126086293 contains SEQ ID NO:

62. (u)LOC126058227 contains SEQ ID NO: 63, (v)LOC126058390 contains the upstream missing nucleic acid sequence of SEQ ID NO:

64. The upstream missing nucleic acid sequence of (w)LOC126058396 contains SEQ ID NO:

65. (x) The upstream missing nucleic acid sequence of FOXH1 contains SEQ ID NO: 66, The upstream missing nucleic acid sequence of (y)LOC126060018 contains SEQ ID NO:

67. (z)LOC126060570 contains the upstream missing nucleic acid sequence of SEQ ID NO:

68. (aa) The upstream missing nucleic acid sequence of CCDC1 5 contains SEQ ID NO: 69, (bb)The upstream missing nucleic acid sequence of INO80B contains SEQ ID NO: 70, The upstream missing nucleic acid sequence of (cc)LOC126062579 contains SEQ ID NO:

71. The upstream missing nucleic acid sequence of (dd)LOC126063153 contains SEQ ID NO:

72. The upstream missing nucleic acid sequence of (ee)LOC126063990 contains SEQ ID NO:

73. The upstream missing nucleic acid sequence of (ff)LOC126063991 contains SEQ ID NO:

74. The upstream missing nucleic acid sequence of (gg)LOC126066513 contains SEQ ID NO:

75. The upstream missing nucleic acid sequence of (hh)LOC1 26066877 contains SEQ ID NO:

76. (ii) The upstream missing nucleic acid sequence of AWAT1 contains SEQ ID NO: 77, The upstream missing nucleic acid sequence of (jj)TMEM187 includes SEQ ID NO: 78, and The upstream missing nucleic acid sequence of (kk)LOC126069912 contains SEQ ID NO:

79.

26. The transgenic animal according to any one of claims 21 to 25, wherein the transgenic animal does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, B An endogenous homolog of at least one of the following: RCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, PKD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3.

27. The transgenic animal of claim 26, wherein the transgenic animal does not express GPR98, MACF1, ADARB2, CEP290, KRT4, LOC126076011, NCKAP5, LAMB4, NPC1L1, ADDRD2, NINJ1, AHNAK2, CATSPERB, PCNXL4, SYNE2, NLRP12, LOC126086768, WDR90, BRCA2, PRKDC, VPS13B, PSAP, SEC31B, KRT28, KRT35, KRT40, MYH4, PIRT, or P. The following are endogenous homologs: KD1L2, RP1L1, CXorf58, LOC126068772, LOC126069872, THRAP3, CENPC1, DSPP, FGF5, CATSPERG, MYH1, MYH13, ATRIP, and TGM3, specifically the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd, 24th, 25th, 26th, 27th, 28th, 29th, 30th, 31st, 32nd, 33rd, 34th, 35th, 36th, 37th, 38th, 39th, 40th, 41st, or 42nd homologs.

28. The transgenic animal as claimed in any one of claims 21 to 27, wherein the transgenic animal is an elephant.

29. The transgenic animal of claim 28, wherein the elephant is selected from Asian elephant (Elephas maximus), African elephant (Loxodonta africana), African forest elephant (Loxodonta cyclotis), and Bornean elephant (Elephas maximus borneensis).

Citation Information

Patent Citations

  • RNA-guided transcriptional regulation

    US10640789B2

  • Delivery, use and therapeutic applications of the crispr-CAS systems and compositions for targeting disorders and diseases using viral components

    US20160175462A1

  • RNA-Guided Systems for In Vivo Gene Editing

    US20170266320A1

  • Multiplexed Genome Editing

    US20180171361A1

  • CRISPR Oligonucleotides and Gene Editing

    US20180195089A1