Streptomyces gilvosporeus engineering strain with high yield of natamycin as well as construction method and application of streptomyces gilvosporeus engineering strain
By simultaneously overexpressing the extracellular transporter gene pimA and the pathway-specific regulatory gene pimR in the natamycin-producing Streptomyces chassis strain, a high-yield natamycin-producing engineered strain was constructed, solving the problems of low yield and high cost in existing technologies and achieving efficient production of natamycin.
Patent Information
- Application Number
- CN202610059776.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-04-24
AI Technical Summary
Existing natamycin-producing strains suffer from low yield, long fermentation cycle, and high production cost. How to further improve the production level of natamycin through genetic engineering modification remains a key technical challenge.
Based on the natamycin-producing Streptomyces chassis strain, a high-natamycin-producing Streptomyces engineered strain was constructed by simultaneously overexpressing the extracellular transport protein gene pimA and the pathway-specific regulatory gene pimR, and then modified using the overexpression vector plasmid pIMEP.
It significantly improved the yield and production efficiency of natamycin, reduced production costs, and provided an excellent strain for the industrial production of natamycin.
Smart Images

Figure CN121914947A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, and constructs a gene for overexpressing extracellular transporter proteins. pimA and pathway-specific regulatory genes pimR Streptomyces chrysogenum ( Streptomyces gilvosporeus The strain was used to produce natamycin through fermentation. Background Technology
[0002] Natamycin, also known as pimozide, is mainly produced by Streptomyces natalum ( Streptomyces natalensis ), Streptomyces thallus ( Streptomyces gilvosporeus Streptomyces chatanuga ( Streptomyces chattanoogensis Natamycin is produced by Streptomyces, etc. As an important antifungal natural product, natamycin is widely used in food preservation and pharmaceuticals. Due to its inhibitory effects on various fungi and yeasts, natamycin shows great market potential in preventing food spoilage and controlling human fungal infections.
[0003] Traditional natamycin-producing strains suffer from low yields, long fermentation cycles, and high production costs. This invention aims to design and construct a high-yield *Streptomyces chrysosporium* strain for natamycin production, thereby improving natamycin production efficiency, reducing production costs, and meeting the growing market demand.
[0004] The search revealed the following published documents related to this invention's patent application: 1. A high-natamycin-producing *Streptomyces chrysogenum* strain and its construction method (CN120924463A). *Streptomyces chrysogenum* Z1403 was screened, exhibiting high natamycin yield and good passage stability. Based on this strain, through genetic engineering, co-expression... epwhiG and dasR The gene further increased the yield of natamycin. In a 5L fermenter, the yield of natamycin reached 13.5 g / L, showing good potential for industrial application.
[0005] 2. Construction and application of a strain of *Streptomyces chrysogenum* with highly efficient extracellular transport of natamycin (CN114806997A) Two copies of the strain were introduced using genetic engineering technology. sgnA / B The gene enhances the strain's natamycin transport capacity, enabling more product to be transported from intracellular to extracellular space, thus increasing natamycin accumulation. After 120 hours of shake-flask fermentation, the total natamycin yield reached 7.38 g / L, a 12.5% increase compared to F607's 6.56 g / L.
[0006] 3. Recombinant Expression Plasmid and Engineered Strains of *Streptomyces chrysosporium* and Their Application (CN105907778A) The expression vector pIMEP::pimE::pimM::vgb was constructed, and engineered strains were successfully obtained through a transfer experiment involving *Escherichia coli* ETZ and *Streptomyces chrysosporium*. Engineered strains ( S. gilvosporeus After culturing in a 5L fermenter for 120 hours, the natamycin yield reached a maximum of 10.136 g / L, which is higher than that of the wild-type strain ( S. gilvosporeu S139) increased by 15.6%.
[0007] Although there are reports of using genetic engineering technology to modify natamycin-producing strains, the overexpression effect of some genes is not ideal. Therefore, how to further improve the natamycin production level of strains through genetic engineering modification remains a key technical problem that urgently needs to be solved.
[0008] By comparison, the present invention patent application is fundamentally different from the aforementioned patent publications. . Summary of the Invention
[0009] The purpose of this invention is to overcome the shortcomings of the prior art by simultaneously overexpressing a gene affecting the extracellular transport protein of natamycin in a natamycin-producing Streptomyces chassis strain. pimA Pathway-specific regulatory genes pimR We obtained a high-yield natamycin-producing Streptomyces strain and used the high-yield strain for fermentation to produce natamycin.
[0010] The technical solution adopted by this invention to solve the technical problem is: The engineered Streptomyces strain provided by this invention uses natamycin-producing Streptomyces as the chassis strain and is modified as follows: Simultaneously overexpressing genes of extracellular transport proteins pimA and pathway-specific regulatory genes pimR .
[0011] The chassis strain can be a natamycin-producing Streptomyces strain, including Streptomyces natalatum ( Streptomyces natalensis Streptomyces chatanuga ( Streptomyces chattanoogensis ), Streptomyces thallus ( Streptomyces gilvosporeus ) , A more preferred chassis strain is *Streptomyces fulvicina*. Streptomyces gilvosporeus TUST01. Among them, Streptomyces gilvosporeus TUST01 has been deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 31467, on July 26, 2024, at the Institute of Microbiology, Chinese Academy of Sciences.
[0012] This invention does not impose any particular restrictions on the method of obtaining the gene; it can be obtained through PCR amplification technology or direct synthesis technology.
[0013] In some specific embodiments, chassis strains are used. Streptomyces gilvosporeus TUST01 simultaneously overexpresses genes of endogenous extracellular transport proteins. pimA and pathway-specific regulatory genes pimR High-yield engineered strain named S. gilvosporeus pimA-pimR.
[0014] Furthermore, the overexpression vector plasmid used to construct the high-yield engineered strain was pIMEP.
[0015] Furthermore, the genes of overexpressed extracellular transport proteins pimA The nucleotide sequence is shown in SEQ ID No. 1.
[0016] Furthermore, the overexpression of the erythromycin strong promoter The gene nucleotide sequence is shown in SEQ ID No. 2.
[0017] Furthermore, overexpression of pathway-specific regulatory genes pimR The nucleotide sequence is shown in SEQ ID No. 3.
[0018] Furthermore, in some specific embodiments, the steps for constructing high-natamycin-producing engineered strains are as follows: (1) Obtaining the target gene fragment: Extracted using kits or conventional methods S. gilvosporeus Using the genome of TUST01 (accession number CGMCC No. 31467) as a template, based on the genes of extracellular transport proteins... pimA Design upstream and downstream primers pimA-F and pimA-R (primer sequences are shown in Table 1), and PCR amplify the sample containing homologous arms. pimA The gene is 1845 bp in length and has no homologous arms. pimA The gene nucleotide sequence (1809 bp) is shown in SEQ ID No. 1.
[0019] Using pIMEP plasmids extracted by kits or conventional methods as templates, upstream and downstream primers ermE-F and ermE-R were designed (primer sequences are shown in Table 1). The promoter with homologous arms was amplified by PCR. The gene is 243 bp in length and has no homologous arms. The gene nucleotide sequence (210 bp) is shown in SEQ ID No. 2.
[0020] Extracted using kits or conventional methods S. gilvosporeus Using the TUST01 genome (accession number CGMCC No. 31467) as a template, pathway-specific regulatory genes were analyzed. pimR Design upstream and downstream primers pimR-F and pimR-R (primer sequences are shown in Table 1), and PCR amplify the sample containing homologous arms. pimR The gene is 3587 bp in length and has no homologous arms. pimR The gene nucleotide sequence (3555 bp) is shown in SEQ ID No. 3.
[0021] The gene sequence and the primer sequences used are as follows: Table 1
[0022] S. gilvosporeus TUST01 endogenous extracellular transporter gene pimA The nucleotide sequence is shown in SEQ ID No. 1; the pIMEP plasmid contains... The gene sequence is shown in SEQ ID No. 2; S. gilvosporeus TUST01 endogenous pathway-specific regulatory gene pimR The nucleotide sequence is shown in SEQ ID No. 3.
[0023] (2) Construction of recombinant plasmids: PCR amplification pimA Gene fragments with strong erythromycin promoters The linear plasmid pIMEP was ligated to obtain the ligation product, recombinant plasmid pIMEP-pimA. The PCR-amplified... pimR Gene fragments and erythromycin strong promoters with homologous arms The fragment was subjected to homologous recombination with the linear recombinant plasmid pIMEP-pimA to obtain the plasmid pIMEP-pimA-pimR. The constructed recombinant plasmid pIMEP-pimA-pimR was transformed into Escherichia coli DH5α competent cells using a chemical method. Escherichia coli DH5α positive transformants were screened by apramycin resistance. Escherichia coli DH5α positive transformants were cultured, and the recombinant plasmid pIMEP-pimA-pimR was extracted from the transformants for later use.
[0024] (3) Construction of engineered strains The recombinant plasmid pIMEP-pimA-pimR was transformed into *E. coli* ET12567 (pUZ8002) and plated on LB agar plates containing 12.5–25 μg / mL kanamycin, 25–50 μg / mL apramycin, and 12.5–25 μg / mL chloramphenicol. Positive transformants of *E. coli* ET12567 (pUZ8002) were selected and cultured in LB liquid medium containing the same concentrations of kanamycin, apramycin, and chloramphenicol at 37 °C with shaking until OD (dose expiratory time). 600 The bacterial cells were collected by centrifugation when the pH reached 0.4-0.6. The cells were then washed with fresh LB liquid medium to remove residual antibiotics and resuspended in LB liquid medium on ice for later use. TES buffer at pH 8.0 was added to the Streptomyces spore plate cultured on MS solid medium. The spores of the Streptomyces spore plate were scraped off and poured into a container containing glass beads. The spore chains were broken by shaking at 180-200 r / min at 30 ℃. The mycelium was filtered out and the spore suspension was collected. The suspension was then heat-shocked in a water bath at 50 ℃ for 10 min. The spore suspension was immediately cooled to room temperature and added to seed medium. The spores were cultured at 37 ℃ with shaking for 2-3 h to allow spore germination. The germinating spores were collected by centrifugation at 5000 r / min for 5 min and resuspended in TES buffer for later use. Equal volumes of the prepared Escherichia coli ET12567 (pUZ8002) positive transformant cells and the germinating Streptomyces spore suspension from the chassis strain were mixed and evenly spread on MS solid medium containing 5 mM MgCl2. After incubation at 30 ℃ for 14-18 h, the plates were covered with 1 ml of sterile water containing 12.5-25 μL of naftidone acid (25 mg / mL) and 12.5-25 μL of apramycin (25 mg / mL). After drying the plates, they were incubated upside down for another 3-5 days. Single positive conjugate clones were selected to obtain the high-natamycin-producing Streptomyces engineered strain.
[0025] Furthermore, each 1 L of MS solid culture medium comprises: 20 g mannitol, 20 g water-soluble soybean meal powder, and 20 g agar were dissolved in deionized water and brought to a final volume of 1 L. The pH was adjusted to 7.0 and the mixture was sterilized at 121 °C for 20 min.
[0026] Furthermore, the composition of each 1 L of seed culture medium is as follows: 10.0 g of water-soluble soybean meal powder, 10.0 g of glucose, 10.0 g of water-soluble starch, 6.0 g of peptone, 6.0 g of corn steep liquor, 2.0 g of NaCl, 1.0 g of MgSO4·7H2O, 0.5 g of KH2PO4, and 5.0 g of CaCO3 were dissolved in deionized water and brought to a final volume of 1 L. The pH was adjusted to 7.0 and the mixture was sterilized at 121 °C for 20 min.
[0027] Furthermore, the composition of each 1 L of fermentation medium is as follows: Fermentation medium: 15.0 g water-soluble soybean meal powder, 40.0 g glucose, 30.0 g water-soluble starch, 10.0 g beef extract, 6.3 g peptone, 0.3 g yeast extract, 2.0 g NaCl, 1.0 g MgSO4·7H2O, dissolved in deionized water and brought to a final volume of 1 L. The pH was adjusted to 7.4 and sterilized at 121 °C for 20 min.
[0028] Furthermore, the present invention also provides the application of the aforementioned high-yield Streptomyces engineered strain in the fermentation production of natamycin, wherein the fermentation production method is as follows: High-yield engineered strains of Streptomyces S. gilvosporeus pimA-pimR was inoculated onto MS solid medium plates and cultured at 28 °C until spores were produced. Then, the spores were inoculated into seed culture medium shake flasks and cultured at 28 °C and 220 r / min for 48 h. The cultured seed culture was then transferred to a fermenter containing fermentation medium for fed-batch fermentation to obtain the fermentation broth containing natamycin.
[0029] The advantages and positive effects of this invention are as follows: This invention focuses on the modification of key genes, specifically by overexpressing extracellular transporter genes. pimA and pathway-specific regulatory genes pimR High-yield natamycin engineered strains were obtained. S. gilvosporeus pimA-pimR, a feed-in fermenter for natamycin production, yields natamycin (g / L) based on the strain from the starting tray. S. gilvosporeus TUST01's yield was 133.12%; its production intensity (g / L·h) was the highest among the starting chassis strains. S. gilvosporeus TUST01's sugar conversion rate was 133.33%; the sugar conversion rate was 133.33% for the starting chassis strain. S. gilvosporeus TUST01's 122.05% significantly reduced production costs and provided an excellent strain for the industrial production of natamycin. Attached Figure Description
[0030] Figure 1This is a flowchart illustrating the construction process of the pIMEP-pimA-pimR recombinant plasmid based on the pIMEP plasmid in this invention.
[0031] Figure 2 The genetically engineered strain in this invention S. gilvosporeus pimA-pimR validation plot; where lane M: 10Kb marker; lane 1: S. gilvosporeus TUST01 pimA - pimR Gene fragment PCR amplification product; Lane 2: High-yield natamycin engineered strain S. gilvosporeus pimA-pimR pimA - pimR Gene fragment PCR amplification products.
[0032] Figure 3 chassis strain S. gilvosporeus TUST01 and high-natamycin-producing engineered strains S. gilvosporeus Comparison of natamycin yields during shake-flask fermentation using pimA-pimR.
[0033] Figure 4 chassis strain S. gilvosporeus TUST01 and high-natamycin-producing engineered strains S. gilvosporeus Comparison of natamycin yield during batch-feed fermentation in a pimA-pimR 5L fermenter.
[0034] Figure 5 chassis strain S. gilvosporeus TUST01 and high-natamycin-producing engineered strains S. gilvosporeus Comparison of conversion rates (%) of natamycin / glucose production in batch fed-batch fermentation in a pimA-pimR 5 L fermenter.
[0035] Figure 6 chassis strain S. gilvosporeus TUST01 and high-natamycin-producing engineered strains S. gilvosporeus Comparison of relative production intensity of natamycin production by batch-fed fermentation in a pimA-pimR 5 L fermenter. Detailed Implementation
[0036] The following embodiments and accompanying drawings are merely illustrative of specific implementation schemes for carrying out the present invention. These schemes and drawings should not be construed as limiting the present invention. Any changes made without departing from the principles and essence of the present invention shall fall within the protection scope of the present invention.
[0037] Unless otherwise specified, all raw materials used in this invention are conventional commercially available products. Unless otherwise specified, all methods used in this invention are conventional methods in the field. All substances used in this invention are of conventional quality.
[0038] Specifically, the relevant preparation and testing methods are as follows: A genetically engineered streptomycin-producing strain S. gilvosporeus pimA-pimR and its construction method. This involves constructing a gene overexpressing an extracellular transporter protein. pimA and pathway-specific regulatory genes pimR The recombinant plasmid pIMEP-pimA-pimR was transferred into the substrate strain S. gilvosporeus In TUST01, a high-yield natamycin-producing genetically engineered strain was obtained. S. gilvosporeus pimA-pimR, the gene for extracellular transport proteins PimA Pathway-specific regulatory genes PimR The gene sequences are SEQ ID No. 1 and SEQ ID No. 3, respectively.
[0039] The chassis strain S. gilvosporeus TUST01 is a strain with the strain preservation number CGMCC No. 31467.
[0040] Since the same amino acid can be determined by several different codons, the same amino acid can correspond to different nucleotide sequences. Therefore, the nucleotide sequences in this application include nucleotide sequences with codon synonymous mutations obtained by substituting one or more nucleotides into the nucleotide sequences shown in SEQ ID NO.1 and SEQ No.3. Those skilled in the art can obtain the nucleotide sequences disclosed in this application using existing molecular biology techniques, such as PCR, gene synthesis, or other suitable methods. pimA and pimR Genes, therefore, encode the above pimA and pimR The nucleotide sequence of a gene is not limited to the nucleotide sequences shown in SEQ No. 1 and SEQ No. 3. If the encoded protein... pimA and pimR Proteins encoded by genes that do not show significant functional differences are also included within the scope of this invention.
[0041] The present invention will be described in more detail below with reference to the embodiments: Example 1: Chassis strain S. gilvosporeus Extraction of TUST01 genomic DNA S was extracted using the TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0. gilvosporeus TUST01's genomic DNA: (1) The chassis strain S. gilvosporeus TUST01 spores were inoculated into seed culture medium and cultured at 28 ℃ with shaking at 220 r / min for 48 h; (2) Collect 1 mL of culture medium in a 1.5 mL centrifuge tube, centrifuge at 12000 r / min for 2 min, and discard the supernatant; add 500 μL of Buffer BS to resuspend the cells, add 50 μL of Lysozyme (20 mg / mL), mix thoroughly by aspiration, and incubate at 37 ℃ for 60 min; centrifuge at 12000 r / min for 5 min, and discard the supernatant; add 180 μL of Buffer GL, 20 μL of Proteinase K (20 mg / mL) and 10 μL of RNase A (10 mg / mL), mix thoroughly by aspiration, and incubate at 56 ℃ for 10 min; add 200 μL of Buffer GB and 200 μL of anhydrous ethanol, and mix thoroughly; install the Spin Column on the Collection Tube, transfer the mixed solution to the Spin Column, centrifuge at 12000 r / min for 2 min, and discard the filtrate; add 500 μL of Buffer WA Add the solution to the Spin Column, centrifuge at 12000 r / min for 1 min, and discard the filtrate. Add 700 μL of Buffer WB to the Spin Column, centrifuge at 12000 r / min for 1 min, discard the filtrate, and repeat the washing with Buffer WB once. Place the Spin Column on a Collection Tube and centrifuge at 12000 r / min for 2 min. Place the Spin Column on a new 1.5 mL centrifuge tube, add 50–200 μL of sterile water or Elution Buffer to the center of the Spin Column membrane, incubate at room temperature for 5 min, centrifuge at 12000 r / min for 2 min to elute and collect the genomic DNA.
[0042] (3) The concentration of the extracted genomic DNA was determined by agarose gel electrophoresis or by measuring absorbance.
[0043] Example 2: Genes co-expressing extracellular transport proteins pimA and pathway-specific regulatory genes pimRCloning and construction of recombinant plasmid pIMEP-pimA-pimR (1) Genes co-expressing extracellular transport proteins pimA and pathway-specific regulatory genes pimR Cloning Based on extracellular transporter protein genes pimA Design upstream and downstream primer sequences pimA-F and pimA-R (primer sequences are shown in Table 1), and add nucleic acid sequences to the 5' end of the pimA-F primer. Bam The H I restriction site and the 15-20 bp complementary nucleotides at the 5' end of the pIMEP primer form a homologous fragment. Adding nucleotides to the 5' end of the pimA-R primer... Bam The HI restriction site and the 5' end of pIMEP are complementary for 15-20 bp, forming a homologous fragment. Genomic DNA extracted in Example 1 was used as a template for PCR to amplify fragments containing homologous arms. pimA The gene is 1845 bp in length. (Details...) pimA The gene sequence is shown in SEQ ID No. 1 in the sequence listing.
[0044] According to the strong promoter of erythromycin Design upstream and downstream primer sequences ermE-F and ermE-R (primer sequences are shown in Table 1), and add nucleic acid sequences to the 5' end of the ermE-F primer. Kpn The restriction enzyme site of I and the 5' end of pIMEP-pimA are complementary to each other by 15-20 bp, forming a homologous fragment. Nucleic acid sequences are added to the 5' end of the ermE-R primer. pimR The 5' ends of the DNA fragments are complementary to each other by 15-20 bp, forming homologous fragments. Genomic DNA extracted in Example 1 was used as a template for PCR to amplify fragments containing homologous arms. The gene is 243 bp in length. (Details...) The gene sequence is shown in the sequence listing SEQ ID No. 2.
[0045] Based on pathway-specific regulatory genes pimR Design upstream and downstream primer sequences pimR-F and pimR-R (primer sequences are shown in Table 1), and add nucleic acid sequences to the 5' end of the pimR-F primer. The 5' ends of the primers are complementary to each other, forming a homologous fragment. Additions are made to the 5' end nucleic acid sequence of the pimR-R primer. Kpn The restriction enzyme site of I and the 5' end of pIMEP are complementary for 15-20 bp, forming a homologous fragment. Genomic DNA extracted in Example 1 was used as a template for PCR to amplify fragments containing homologous arms. pimR The gene is 3587 bp in length. (Details...) pimRThe gene sequence is shown in the sequence listing SEQ ID No. 3.
[0046] PCR reaction system: 2×phanta max buffer 25 µL, dNTP mixture (10 mM) 1 µL, template (20 μg / mL) 1 µL, forward and reverse primers ((10 μM)) 2 µL each, DMSO 2 µL, phanta max×Super-FidelityDNA Polymerase 1 µL, add ultrapure water to 50 µL.
[0047] PCR reaction conditions: 95 ℃ pre-denaturation for 5 min; 95 ℃ denaturation for 15 s, 55~65 ℃ annealing for 15 s, 72 ℃ extension for 30~90 seconds. The reaction was carried out for 25-35 cycles, with a final extension at 72 °C for 5 min, and the reaction was terminated at 4 °C.
[0048] (2) Contains pimA Construction of the recombinant plasmid pIMEP-pimA.
[0049] PCR amplification of homologous arms pimA Genes and Process BamH I single enzyme digestion integrates with a strong promoter, erythromycin promoter. The linear plasmid pIMEP was ligated using homologous recombinase to obtain the ligation product, recombinant plasmid pIMEP-pimA.
[0050] The homologous recombination system consisted of: linearized vector pIMEP 50-200 ng, inserted... pimA Gene fragment 50~200ng, 5×CE Ⅱ Buffer 4 µL, Exnase Ⅱ 2 µL, add ultrapure water to 10 µL.
[0051] Homologous recombination conditions: react at 50 ℃ for 15 min, then cool to 4 ℃.
[0052] (2) pimA and pimR Construction of the gene co-expression recombinant plasmid pIMEP-pimA-pimR PCR amplification of homologous arms pimR and Gene fragments and processes Kpn I. Single enzyme digestion and integration with a strong promoter: erythromycin promoter The linear plasmid pIMEP-pimA was ligated using homologous recombinase to obtain the ligation product, recombinant plasmid pIMEP-pimA-pimR.
[0053] The homologous recombination system consisted of: 50–200 ng of linearized vector plasmid, and insertion... pimA and Gene fragment 50~200 ng, 5×CE Ⅱ Buffer 4 µL, Exnase Ⅱ 2 µL, add ultrapure water to 20 µL.
[0054] Homologous recombination conditions: react at 50 ℃ for 15 min, then cool to 4 ℃.
[0055] (3) Transformation and validation of recombinant plasmid pIMEP-pimA-pimR Add 10 µL of the ligation product, recombinant plasmid pIMEP-pimA-pimR, to a centrifuge tube containing 100 µL of *E. coli* DH5α competent cells (placed on ice). Gently tap the tube wall to mix, and incubate on ice for 30 min. Heat shock at 42 °C for 90 s, then immediately incubate on ice for 5 min (do not move the tube during this process). Under aseptic conditions, add 900 µL of LB medium to the centrifuge tube, mix by pipetting, and incubate at 37 °C with shaking at 100–200 r / min for 45–60 min. After incubation, centrifuge at 12000 r / min for 1 min, remove 900 μL of supernatant, and pipette the remaining liquid to mix. Spread the mixture onto LB agar plates containing 25–50 μg / mL apramycin. Incubate LB plates upside down at 37°C overnight until single transformant colonies are clearly visible. Pick single positive transformant colonies and transfer them to LB liquid medium containing 25–50 μg / mL apramycin. Incubate overnight at 37°C with shaking at 180–200 rpm. Extract transformant plasmids using a plasmid extraction kit or conventional alkaline lysis method. Perform... EcoR V. Single enzyme digestion verification was performed, and the correctly verified recombinant plasmid pIMEP-pimA-pimR and E. coli DH5α positive transformants were preserved.
[0056] The construction process of plasmid pIMEP-pimA-pimR is as follows: Figure 1 As shown.
[0057] Example 3 High-yield natamycin S. gilvosporeus Construction of pimA-pimR The recombinant plasmids pIMEP-pimA-pimR were integrated into the substrate strains using a conjugation transfer method. S. gilvosporeus In the TUST01 genome.
[0058] (1) First, Escherichia coli DH5α positive transformants containing pIMEP-pimA-pimR plasmid were cultured overnight at 37°C with shaking in LB liquid medium containing 50 μg / mL apramycin. The pIMEP-pimA-pimR recombinant plasmid was extracted from the Escherichia coli DH5α transformants using a plasmid extraction kit (MiniBEST Plasmid Purification Kit Ver.4.0). The recombinant plasmid was chemically transformed into helper strain Escherichia coli ET12567 (pUZ8002). The transformants were plated on LB plates containing 25 μg / mL kanamycin, 50 μg / mL apramycin and 25 μg / mL chloramphenicol. After incubation at 37°C for 24 h, positive transformants of Escherichia coli ET12567 (pUZ8002) were obtained.
[0059] (2) Select single colonies of positive transformants of Escherichia coli ET12567 (pUZ8002) containing the recombinant plasmid pIMEP-pimA-pimR and culture them in 5 mL LB medium (containing three antibiotics at the same concentration as in the previous step) and shake overnight at 37 °C. Then, transfer them to 50 mL fresh LB liquid medium containing three antibiotics (antibiotic concentration as in the previous step) at an inoculation rate of 1% and culture at 37 °C with shaking at 180 r / min until OD. 600 The concentration reached between 0.4 and 0.6. Centrifuge 40 mL of bacterial culture at 8000 r / min for 5 min, discard the supernatant, and wash the cells 2-3 times with fresh LB liquid medium to remove residual antibiotics. Resuspend in 1 mL of LB liquid medium and store on ice for later use. This yields a suspension of treated *E. coli* ET12567 (pUZ8002) positive transformant cells. S. gilvosporeus Add 10 mL of pH 8.0 TES buffer to a plate with well-grown TUST01 spores. Spores are scraped off using a sterile inoculation loop and poured into a 250 mL Erlenmeyer flask containing glass beads. Incubate at 30 °C with shaking at 180 rpm for 2 h to break the spore chain. Filter the flask through sterile absorbent cotton to remove hyphae. Heat shock the spore suspension at 50 °C for 10 min, then immediately cool to room temperature. Add 10 mL of seed culture medium and incubate at 37 °C with shaking for 2–3 h to allow spore germination. Collect spores by centrifugation at 5000 rpm for 5 min and resuspend the germinated spores in 1 mL of pH 8.0 TES buffer. S. gilvosporeus TUST01 spore suspension is available for use.
[0060] (3) The prepared E. coli ET12567 (pUZ8002) positive transformant cells and germinating cells were... S. gilvosporeusEqual volumes of TUST01 spore suspension were mixed and evenly spread onto MS solid medium containing 5 mM MgCl2. After incubation at 30 ℃ for 14–18 h, the plates were covered with 1 mL of sterile water containing 25–50 μL nalidixic acid (25 mg / mL) and 25–50 μL apramycin (25 mg / mL). After drying the plates, incubation was continued at 30 ℃ for 3–5 days to obtain a high-yielding natamycin-producing engineered strain. S. gilvosporeus pimA-pimR.
[0061] High-yield natamycin-producing engineered strains were amplified by PCR using the universal primers pIMEP-F and pIMEP-R (see Table 1). S. gilvosporeus pimA-pimR and chassis strains S. gilvosporeus TUST01 pimA-pimR Gene (6018 bp), results as follows Figure 2 As shown, Figure 2 The genetically engineered strains in this invention have been verified. S. gilvosporeus Whether pimA-pimR was successfully constructed; where lane M: 10 Kb marker; lane 1: control. S. gilvosporeus There is no corresponding entry in TUST01. pimA-pimR Gene fragment; Lane 2: S. gilvosporeus Integrated in pimA-pimR pimA-pimR Gene fragment amplification diagram; from Figure 2 The high-yield engineered strains constructed can be seen from this. S. gilvosporeus Successfully integrated into pimA-pimR expression pimA-pimR Gene fragments.
[0062] Example 4 S. gilvosporeus Natamycin Production by Shake-Flavor Fermentation of pimA-pimR Strains Using the high-natamycin-producing engineered strain constructed in Example 3 S. gilvosporeus The specific steps for producing natamycin by shake-flask fermentation of pimA-pimR are as follows: Natamycin engineered strains S. gilvosporeus pimA-pimR and chassis strains S. gilvosporeusTUST01 strains were transferred to solid culture plates and cultured at 28 °C for 5–7 days until spores were produced. Then, a loopful of fresh spores was scraped and inoculated into a 500 mL shake flask containing 100 mL of seed culture medium, and cultured at 28 °C with shaking at 220 r / min for 48 h. The seed culture was then inoculated at an 8% (v / v) inoculation rate into a 500 mL shake flask containing 50 mL of fermentation medium, and cultured at 28 °C with shaking at 220 r / min until the natamycin yield reached its maximum. Samples were taken every 24 h to determine the pH, residual sugar, cell dry weight, and natamycin yield of the fermentation broth. A high-natamycin-producing engineered strain was developed. S. gilvosporeus After 120 h of shake-flask fermentation with pimA-pimR, the natamycin yield was 6.28 g / L. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) S. gilvosporeus TUST01 was fermented in shake flasks for 120 h, and the natamycin yield was 4.09 g / L. (See attached table). Figure 3 .
[0063] pH Measurement: After calibrating the pH electrode, rinse it with deionized water and blot away any remaining droplets with filter paper. Immerse the electrode in the fermentation broth to be tested, ensuring the liquid completely covers the glass membrane. Once the reading stabilizes, record the final pH value (accurate to 0.01). Rinse the electrode repeatedly after each measurement to prevent cross-contamination.
[0064] Determination of glucose concentration: Take 5 mL of fermentation broth and centrifuge at 8000 r / min for 5 min at 4 ℃. After centrifugation, take 0.1 mL of the supernatant and dilute it 100 times. Use an SBA-40E biosensor analyzer to measure the glucose concentration in the diluted solution. After the reading stabilizes, record the value. Repeat 3 times. The glucose concentration in the fermentation broth can be calculated.
[0065] Biomass determination: Numbered filter papers were dried in a 95 ℃ oven to constant weight, and the mass of the filter papers was weighed and recorded. 8 mL of fermentation broth was centrifuged at 8000 r / min for 5 min at 4 ℃ using a high-speed refrigerated centrifuge. After centrifugation, the supernatant was discarded to obtain bacterial cell precipitate. The precipitate was washed 2-3 times with distilled water and then transferred to numbered filter papers. The precipitate was then dried in a 95 ℃ oven to constant weight. The difference between the mass of the dried filter paper with bacterial cells and the initial mass of the filter paper was the biomass of the bacterial cells.
[0066] Natamycin content determination: The natamycin standard curve and the natamycin content in the fermentation broth were determined by ultraviolet spectrophotometry.
[0067] (1) Construction of natamycin standard curve: Prepare natamycin standard solutions of different concentrations and measure the absorbance at 290 nm and 303 nm. Plot the difference in absorbance between 290 nm and 303 nm, ΔA, as the ordinate and the concentration of natamycin standard solution as the abscissa to obtain the standard curve. The regression equation can be obtained, and the content of natamycin in the bacterial fermentation broth can be calculated by the regression equation. The standard curve of ultraviolet dual-wavelength spectrophotometry is shown in the figure. The standard curve of ultraviolet dual-wavelength spectrophotometry is: y = 0.0168x + 0.0045, R 2 =0.9991.
[0068] (2) Detection of natamycin content in fermentation broth: Take 1 mL of fermentation broth and add 9 mL of anhydrous methanol, sonicate for 30 min (100 W), centrifuge at 8000 r / min for 5 min and take the supernatant. Dilute with 70% methanol 100 times, 200 times and 500 times, and use a dual-wavelength ultraviolet spectrophotometer to measure the absorbance at 290 nm and 303 nm, calculate the difference, and substitute it into the standard curve in (1) to calculate the natamycin content in fermentation broth.
[0069] Example 5 Engineered strain S. gilvosporeus Natamycin Production via Batch Feeding Fermentation in a pimA-pimR5 L Fermenter High-yield engineered strain constructed using Example 3 S. gilvosporeus The pimA-pimR genetically engineered strain was used for fed-batch fermentation in a 5 L fermenter to produce natamycin. The specific steps are as follows: High-yield engineered strains S. gilvosporeus pimA-pimR and the starting strain S. gilvosporeus The spore suspensions of TUST01 were transferred to solid culture plates and cultured at 30 °C for 5–7 days until spores were produced. Then, a loopful of fresh spores was scraped and inoculated into 500 mL shake flasks containing 100 mL of seed culture medium and cultured at 28 °C and 220 r / min for 48 h. The seed culture was then inoculated at a rate of 15% (v / v) into 5 L fermenters containing 3 L of fermentation medium, with an initial pH of 7.4. During fermentation, glucose concentration was maintained at approximately 25 g / L by feeding glucose (800 g / L) to facilitate product formation; the temperature was maintained at 28 °C; the aeration ratio was maintained at 1–2 vvm; and agitation was controlled in conjunction with dissolved oxygen, with dissolved oxygen maintained at 30%. Samples were taken during fermentation to determine the natamycin yield, pH, residual sugar concentration in the fermentation broth, and biomass of both strains.
[0070] engineered strains S. gilvosporeus The pimA-pimR fed-batch fermentation method produced natamycin, with a maximum yield of 19.49 g / L at 120 h. (The text abruptly ends here, likely due to an incomplete sentence or missing information.)S. gilvosporeus TUST01 achieved a peak natamycin yield of 14.64 g / L at 120 h, an engineered strain. S. gilvosporeus The natamycin production of pimA-pimR is comparable to that of the chassis strain. S. gilvosporeus The yield of TUST01 was 133.12%, as shown in the following figure. Figure 4 And Table 1. Strains S. gilvosporeus The natamycin / glucose consumption conversion rate of pimA-pimR was 13.78% at 120 h, which is typical for chassis strains. S. gilvosporeus TUST01 conversion rate (11.29%, 120h) 122.05% Figure 5 ). strain S. gilvosporeus The production intensity of pimA-pimR is 0.16 g / L·h, which is the starting chassis strain. S. gilvosporeus TUST01 (0.12 g / L·h) 133.33% ( Figure 6 ). (Using strains) S. gilvosporeus The fermentation of pimA-pimR for natamycin production significantly reduces production costs and provides an excellent strain for the industrial production of natamycin.
[0071] Table 1. Production of natamycin by fed-batch fermentation of different strains in a 5 L fermenter
[0072] The relevant gene sequences used in this invention are as follows: 1. SEQ ID No. 1 Extracellular transporter gene pimA nucleotide sequence 2. SEQ ID No. 2 Erythromycin promoter Gene nucleotide sequence GCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGCCAAGCTTGGGCTGCAGGTCGACTCTAGGGCACAATCGTGCCGGTTGGTAGGATCTAGCGGAACGGA 3. SEQ ID No. 3 Pathway-specific regulatory genes pimR nucleotide sequence
Claims
1. A multi-gene overexpression engineered strain that produces high levels of natamycin, characterized in that, The overexpressed gene in the multi-gene overexpression engineered strain pimA and genes pimR, pimA The nucleotide sequence is shown in SEQ ID No.
1. pimR The nucleotide sequence is shown in SEQ ID No.
3.
2. The high-natamycin-producing multi-gene overexpression engineered strain according to claim 1, characterized in that, The chassis strain used in the high-natamycin-producing multi-gene overexpression engineered strain is... Streptomyces gilvosporeus TUST01, strain preservation number CGMCC No. 31467.
3. The engineered bacterium that produces high levels of natamycin through multi-gene overexpression according to claim 1, characterized in that, The plasmid used for gene overexpression is pIMEP, which contains a strong promoter. , The nucleotide sequence is shown in SEQ ID No.
2.
4. A method for constructing a multi-gene overexpression engineered strain that produces high levels of natamycin, characterized in that, The construction steps are as follows: (1) Extraction E. coli The recombinant plasmid pIMEP-pimA-pimR from the DH5α-positive transformant was transformed into methylation-deficient Escherichia coli. E. coli In ET12567 / pUZ8002; Positive transformants were obtained through antibiotic screening. The positive transformants were cultured in liquid culture medium to the logarithmic growth phase, and the cells were collected by centrifugation, washed to remove antibiotics, and resuspended for later use. (2) Collection S. gilvosporeus Fresh spores of strain TUST01 were prepared into a spore suspension; the spore suspension was subjected to heat shock treatment, and then seed culture medium was added to culture to germinate the spores. The germinated spores were collected by centrifugation and resuspended to obtain a germinating spore suspension for later use. (3) The material prepared in step (1) E. coli ET12567 / pUZ8002 positive rotor bacterial suspension and the preparation in step (2) S. gilvosporeus TUST01 germinating spore suspension was mixed at a 1:1 volume ratio and spread onto MS solid medium containing MgCl2 for culture. Resistance selection was performed by covering the plates with a solution containing nalidixic acid and apramycin. Culture continued until single colonies appeared, and positive conjugates were selected to obtain the high-natamycin-producing genetically engineered strain. S. gilvosporeus pimA-pimR.
5. The *Escherichia coli* according to claim 4 E. coli DH5α positive transformant, characterized in that, The E. coli E. coli The steps for constructing DH5α positive transformants are as follows: (1) with S. gilvosporeus Using TUST01 genomic DNA as a template, PCR amplification was performed using specific primers to obtain samples with homologous arms. pimA Gene fragments, those with homologous arms pimR Gene fragments and erythromycin promoters with homologous arms Gene fragments; (2) Using the homologous recombination method, the... pimA The gene fragment was ligated into the enzyme-digested linearized pIMEP plasmid vector to construct the recombinant plasmid pIMEP-pimA. (3) Using the homologous recombination method, the... and pimR The gene fragment was ligated into the enzyme-digested and linearized recombinant plasmid pIMEP-pimA to construct the co-expression recombinant plasmid pIMEP-pimA-pimR. (4) The recombinant plasmid pIMEP-pimA-pimR was transformed into... E. coli In DH5α competent cells, cells containing the recombinant plasmid pIMEP-pimA-pimR were obtained through apramycin resistance selection. E. coli DH5α positive transformant.
6. A method for producing natamycin by fermentation using a high-yield natamycin multi-gene overexpression engineered strain, characterized in that, The fermentation production method is as follows: The strain used was a genetically engineered strain. S. gilvosporeus pimA-pimR: The genetically engineered strain was inoculated onto MS solid medium plates and cultured at 28 °C until gray conidia were produced. The spores were then inoculated into seed culture medium shake flasks and cultured at 28 °C and 220 r / min for 48 h. The cultured seed culture was then transferred to a fermenter containing fermentation medium, with glucose added simultaneously to maintain a residual sugar concentration of 25 g / L. The temperature was controlled at 28 °C, the aeration ratio was maintained at 1-2 vvm, the stirring was correlated with dissolved oxygen, and the dissolved oxygen was controlled at 30%. Fermentation lasted for 120-156 h. The seed culture medium is water-soluble soybean meal powder. 10.0 g of glucose, 10.0 g of water-soluble starch, 6.0 g of peptone, 6.0 g of corn steep liquor, 2.0 g of NaCl, 1.0 g of MgSO4·7H2O, 0.5 g of KH2PO4, and 5.0 g of CaCO3 were dissolved in deionized water and brought to a final volume of 1 L. The pH was adjusted to 7.0 and sterilized at 121 °C for 20 min. The fermentation medium is water-soluble soybean meal powder. 15.0 g of glucose, 40.0 g of water-soluble starch, 30.0 g of beef extract, 10.0 g of peptone, 6.3 g of yeast extract, 0.3 g of NaCl, 2.0 g of MgSO4·7H2O, dissolved in deionized water and brought to a final volume of 1 L. The pH was adjusted to 7.4 and sterilized at 121 °C for 20 min.
Citation Information
Patent Citations
Streptomyces gilvosporeus recombinant expression plasmid, and engineering bacterium and application thereof
CN105907778A
Construction and application of streptomyces gilvosporeus capable of efficiently transporting natamycin extracellularly
CN114806997A
Streptomyces gilvosporeus engineering strain with high yield of natamycin and construction method of streptomyces gilvosporeus engineering strain
CN120924463A