Toxoplasma gondii biomarker and application thereof

By targeting the Toxoplasma gondii biomarker G-quadruplex, small molecule ligands sanguinarine and TMPyP4 were screened, solving the problems of large side effects and drug resistance of existing anti-Toxoplasma gondii drugs and providing a safe and efficient new treatment option.

CN121915178APending Publication Date: 2026-04-24BEIJING SHIJITAN HOSPITAL CAPITAL MEDICAL UNIVERSITY +1
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202610089322.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-22
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

Existing anti-toxoplasmosis drugs have significant side effects, increased drug resistance, and are not ideal for treating chronic and congenital toxoplasmosis. There is a lack of effective new drugs.

Method used

A Toxoplasma gondii biomarker, G-quadruplex (G-quadruplex), is provided. By screening for small molecule ligands that bind to it, such as sanguinarine and TMPyP4, it targets the G-rich sequence in the promoter region of the TgAP2IX-5 gene, thereby inhibiting the proliferation of Toxoplasma gondii.

Benefits of technology

The selected drugs significantly inhibit the proliferation of Toxoplasma gondii, have low toxicity and high safety, and are more effective than existing drugs, making them suitable for the treatment of zoonotic toxoplasmosis and providing a new treatment option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121915178A_ABST
    Figure CN121915178A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and discloses a toxoplasma gondii biomarker and an application thereof in order to solve the technical problem of relatively less research on TgAP2IX-5 regulation of toxoplasma gondii at present, and particularly, a G-quadruplex nucleic acid sequence is formed in a TgAP2IX-5 gene promoter region, and the TgAP2IX-5 gene promoter region is constructed to obtain the toxoplasma gondii biomarker. And screening of toxoplasma gondii-resistant drugs is carried out by taking the synthesized G-quadruplex as a target spot. The screened small molecular ligands sanguinarine and TMPyP4 have obvious effects of inhibiting transcription of the TgAP2IX-5 gene and proliferation of toxoplasma gondii, and the action effect is superior to that of a clinically common therapeutic drug sulfadiazine; and a good treatment effect can be achieved at a relatively low concentration.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a Toxoplasma gondii biomarker and its application. Background Technology

[0002] Apicomplexa is a phylum of unicellular, obligate intracellular protozoan parasites, including many human pathogens such as *Plasmodium* spp. (the malaria pathogen), *Toxoplasma* (the cause of Toxoplasma gondii), and *Cryptosporidium* spp. (the cause of Cryptosporidium gondii). Apicomplex parasites cause disease through uncontrolled biomass expansion, leading to inflammatory responses and host cell destruction. Although these parasites exhibit a sexual reproductive cycle in their definitive host, their pathogenic mechanism primarily stems from asexual replication within the host cell. All Apicomplex organisms possess a complex life cycle, with parasitic proliferation strictly regulated by the cell cycle, ultimately forming new daughter cells containing a mononuclear cell and complete organelles.

[0003] Toxoplasmosis is a zoonotic disease caused by Toxoplasma gondii, posing a serious threat to human health and animal husbandry. Toxoplasma gondii has a complex life cycle and can parasitize multiple hosts, causing disease. In immunocompromised individuals, toxoplasmosis can lead to miscarriage in pregnant women and severe complications such as encephalitis and retinitis, even endangering their lives. In animal husbandry, especially in felines and livestock such as pigs and sheep, toxoplasmosis infection can cause miscarriage, stillbirth, and decreased growth performance, resulting in significant economic losses for farmers.

[0004] With the deepening research into the biological characteristics of Toxoplasma gondii, more and more targets have been discovered and validated. Currently, therapeutic targets for Toxoplasma gondii mainly focus on the following pathways: First, targeting DNA topoisomerases or gyrases to interfere with genetic material synthesis. Second, targeting glyoxalase, folic acid synthesis, lipid or energy metabolism to intervene in metabolic pathways. Third, targeting acroplast translation and mitochondrial mechanisms to intervene in organelle function. Fourth, targeting calmodulin-like kinases and histone modifications to intervene in signal transduction, gene expression, and epigenetic regulation. Fifth, targeting aspartate, cysteine, or serine proteases to intervene in protein degradation. The exploration and research of these diverse targets provide a rich and precise theoretical basis and direction for developing highly effective and specific anti-Toxoplasma gondii drugs, promoting the research and development of drugs for the prevention and control of toxoplasmosis to a deeper and more effective level.

[0005] Currently, the primary first-line treatment for toxoplasmosis is the combination of pyrimethamine (PYR) and sulfadiazine (SDZ), which works by inhibiting the folate metabolism pathway of Toxoplasma gondii. However, these drugs have several serious side effects, such as hematologic toxicity, rash, and leukopenia, which may interrupt treatment and lead to disease relapse. In addition to these first-line drugs, azithromycin, clarithromycin, spiramycin, atovaquinone, dapoxetine, and trimethoprim-sulfamethoxazole are used as alternative treatments. While these drugs expand treatment options to some extent, no drug has yet been found to fully meet clinical needs in large-scale, multicenter clinical trials, especially for chronic and congenital toxoplasmosis, where treatment efficacy remains unsatisfactory. With the gradual development of resistance to existing drugs by Toxoplasma gondii, the risk of treatment failure increases, making the development of novel anti-toxoplasmosis drugs particularly urgent. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a Toxoplasma gondii biomarker and its application.

[0007] The first objective of this invention is to provide a Toxoplasma gondii biomarker, wherein the Toxoplasma gondii biomarker is a G-tetramolecular, and the G-tetramolecular is... TgAP2IX-5 A G-rich sequence in the gene promoter region; the G-quadruplex is a nucleic acid secondary structure. The nucleotide sequence of the G-rich sequence is shown in SEQ ID NO.1.

[0008] Preferably, the G-quadruplex is an intramolecular parallel G-quadruplex structure.

[0009] A second object of the present invention is to provide the use of a small molecule ligand in the preparation of a medicament for the prevention and / or treatment of Toxoplasma gondii infection, wherein the small molecule ligand is a small molecule ligand capable of binding to the aforementioned Toxoplasma gondii biomarkers.

[0010] Preferably, the small molecule ligands are sanguinarine and / or TMPyP4.

[0011] A further preferred dosage of sanguinarine is 10-15 mg / kg body weight.

[0012] Further preferred, the dosage of TMPyP4 is 15 mg / kg body weight.

[0013] A third object of the present invention is to provide the use of the above-mentioned Toxoplasma gondii biomarkers as therapeutic targets in screening drugs for the prevention and / or treatment of Toxoplasma gondii infection.

[0014] A fourth object of the present invention is to provide a method for screening drugs for the prevention and / or treatment of toxoplasmosis infection, comprising the following steps: pass TgAP2IX-5 A G-rich sequence in the gene promoter region forms a Toxoplasma gondii biomarker, and the nucleotide sequence of the G-rich sequence is shown in SEQ ID NO.1; Using the established Toxoplasma gondii biomarkers as targets, small molecule ligands that can bind to and stabilize their structures are screened by fluorescence and circular dichroism spectroscopy analysis. Experimental verification was conducted on the small molecule ligands obtained through screening to identify those capable of inhibiting... TgAP2IX-5 Small molecule ligands that inhibit Toxoplasma gondii proliferation through gene transcription are drugs used to prevent and / or treat Toxoplasma gondii infection.

[0015] Preferred, capable of inhibiting TgAP2IX-5 The small molecule ligands that inhibit Toxoplasma gondii proliferation through gene transcription are sanguinarine and / or TMPyP4.

[0016] Preferably, experimental validation includes cytotoxicity experiments of small molecule ligands against Vero cells, the host of Toxoplasma gondii, and quantitative real-time PCR (qPCR) detection of the effects of small molecule ligands on Toxoplasma gondii. TgAP2IX-5 Experiments included: gene transcription inhibition, absolute qPCR detection of the inhibitory effect of small molecule ligands on Toxoplasma gondii proliferation, fluorescence detection of the inhibitory effect of small molecule ligands on the number of Toxoplasma gondii larvae in vacuoles, fluorescence and CCK8 assays to detect the inhibitory effect of small molecule ligands on Toxoplasma gondii proliferation, and the effect of small molecule ligands on Toxoplasma gondii and enteritis in mice with Toxoplasma gondii cyst infection-induced colitis.

[0017] Compared with the prior art, the advantages of this invention are as follows: (1) This invention is the first to confirm the existence of a G-quadruplex structure in Toxoplasma gondii, and the first to demonstrate this structure through... TgAP2IX-5 A G-rich sequence in the gene promoter region forms a G-quadruplex, and a method for screening drugs to prevent or treat Toxoplasma gondii infection using the synthesized G-quadruplex as a target was proposed. Validation experiments showed that the small molecule ligands sanguinarine or TMPyP4 screened using this method have significant inhibitory effects. TgAP2IX-5 Its effects on gene transcription and Toxoplasma gondii proliferation are superior to those of sulfadiazine, a commonly used clinical treatment; and sanguinarine and TMPyP4 are respectively at 9 and 6 It can achieve good therapeutic effects at low concentrations.

[0018] (2) This invention uses the synthesized G-quadruplex as the therapeutic target to screen drugs for the prevention or treatment of Toxoplasma gondii infection. The screened drugs can treat Toxoplasma gondii, have low toxicity to host cells, and do not cause significant damage to the major organs of experimental animals such as mice at therapeutic doses. They have good safety and can effectively overcome the drawback of excessive toxicity to the host of anti-Toxoplasma gondii drugs. Therefore, they are more suitable for drug screening for zoonotic toxoplasmosis. (3) The drugs screened by this invention using the synthesized G-quadruplex as the target can effectively inhibit TgAP2IX-5 Gene transcription plays a crucial role in regulating organelle functions such as budding cycle, tachyzoite division and proliferation, and inner membrane complex (IMC) protein in Toxoplasma gondii. This approach differs significantly from existing anti-Toxoplasma gondii drug development strategies and targets. By targeting the G-quadruplex, a key nucleic acid molecule switch target, it is expected to provide new options for clinical treatment. Attached Figure Description

[0019] Figure 1 Figure 1 shows the IFA analysis results of the presence of the G4 structure in Toxoplasma gondii. Figure 2 for TgAP2IX-5 A schematic diagram of the sequence in which the gene promoter region can form G4; Figure 3 for TgAP2IX-5 Conformation analysis results of the TgP20 sequence in the gene promoter region; Figure 4 The fluorescence emission spectra of wild-type and mutant TgP20 sequences bound to NMM; Figure 5 This is a non-denaturing polyacrylamide gel electrophoresis image; lanes 1 and 2 are Marker-18nt-FAM and Marker-25nt-FAM, respectively; lanes 3-5 are TgP20-FAM; lanes 6-8 are TgP20M-FAM. Figure 6 The image shows a denaturing polyacrylamide gel electrophoresis pattern; lanes 1 and 2 are Marker-18nt-FAM and Marker-25nt-FAM, respectively; lanes 3 and 4 are TgP20-FAM, respectively; and lanes 5 and 6 are TgP20M-FAM, respectively. Figure 7 For the detection of TgP20 G4 in luciferase reporter gene assay TgAPIX5 Figure showing the effect on gene transcription activity; Figure 8 Figure 1 shows the effect of different concentrations of TgP20 on the fluorescence emission spectrum of sanguinarine. Figure 9 Figure showing the effect of different concentrations of sanguinarine on the configuration of TgP20 G4; Figure 10 Figure 1 shows the effect of different concentrations of TgP20 on the fluorescence emission spectrum of TMPyP4. Figure 11 Figure showing the effect of different concentrations of TMPyP4 on the configuration of TgP20 G4; Figure 12 To detect the effect of sanguinarine on Toxoplasma gondii using relative qPCR TgAP2IX-5 The effect of gene transcription is shown in the figure. Figure 13 To detect the effects of TMPyP4 on Toxoplasma gondii using relative qPCR TgAP2IX-5 The effect of gene transcription is shown in the figure. Figure 14 Figure showing the results of CCK8 assay for the effect of sanguinarine on Vero cell viability; Figure 15 Figure showing the results of absolute qPCR detection of the inhibitory effect of sanguinarine on Toxoplasma gondii proliferation; Figure 16 The figure shows the results of fluorescence detection of the effect of sanguinarine on the number of Toxoplasma gondii vacuoles. Figure 17 The image shows the results of fluorescence assay for the inhibitory effect of sanguinarine on Toxoplasma gondii proliferation. Figure 18 The image shows the results of the CCK8 assay for detecting the inhibitory effect of sanguinarine on Toxoplasma gondii proliferation. Figure 19 The results of CCK8 assay and absolute qPCR assay for detecting the inhibitory effects of TMPyP4 on Vero cell viability and Toxoplasma gondii proliferation are shown in Figure 1. Figure 2 shows the effect of CCK8 assay on Vero cell viability; Figure 3 shows the inhibitory effect of absolute qPCR assay on Toxoplasma gondii proliferation. Figure 20 To detect the number of Toxoplasma gondii in the colon of mice infected with Toxoplasma gondii cysts using absolute qPCR and relative qPCR methods, respectively. TgAP2IX-5 The results of the effects on gene transcription are shown in the figure; where A represents the effect of absolute qPCR detection of the drug on the number of Toxoplasma gondii in the colon of mice with Toxoplasma gondii cysts; and B represents the effect of relative qPCR detection of the drug on the number of Toxoplasma gondii in the colon of mice with Toxoplasma gondii cysts. TgAP2IX-5 The effect of gene transcription is shown in the figure. Figure 21 Figure 1 shows the results of fluorescence detection of the effect of TMPyP4 on the number of Toxoplasma gondii vacuoles. Figure 22 The image shows the results of fluorescence assay to detect the inhibitory effect of TMPyP4 on Toxoplasma gondii proliferation. Figure 23 The image shows the results of the CCK8 assay for detecting the inhibitory effect of TMPyP4 on Toxoplasma gondii proliferation. Figure 24 Figure showing the effect of drugs on the body weight of mice in a Toxoplasma gondii cyst infection model. Figure 25 HE staining results of mouse tissues from different groups; where A is the blank control group; B is the model group; C is the model group + sanguisorbin 15 mg / kg group; D is the model group + sanguisorbin 10 mg / kg group; E is the model group + TMPyP4 15 mg / kg group; and F is the model group + sulfadiazine 100 mg / kg group; the scale bar is 25. ; Figure 26 The drug's effect on serum levels in mice with Toxoplasma gondii cyst infection model The effect of IL6 secretion on IL-6 secretion is shown in the figure. Figure 27 Colon tissue of mice with Toxoplasma gondii cyst infection model and IL6 The effect of gene transcription is shown in the figure. Detailed Implementation

[0020] The following will be described in conjunction with embodiments of the present invention. Figures 1 to 27 The technical solutions in the embodiments of the present invention are clearly and completely described herein. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0021] I. Confirmation of the presence of Toxoplasma gondii biomarker (G-tetramolecular (G4)) structure in Toxoplasma gondii The presence of the G4 structure in Toxoplasma gondii was verified using an indirect immunofluorescence assay (IFA). The specific experimental procedure is as follows: 1. Collect freshly escaped Toxoplasma gondii worms, take 100... Inoculated onto cell crawling sheets with confluent cells, and after 1 h of invasion, uninvaded parasites were washed away with pre-warmed serum-free DMEM medium, followed by 12 h of culture with 2% DMEM medium. 2. Wash the cell slides three times with PBS, air dry, and fix with 4% paraformaldehyde for 20 min; 3. Permeabilize with 0.5% Triton X-100 for 10 min; 4. Block with 3% BSA at 37℃ for 60 min; 5. Add primary antibody BG4 (1:200) and incubate at 37 °C for 1 h; 6. Wash with PBS 5-6 times, letting stand for 3 minutes each time; 7. The secondary antibody Alexa FluorR488 conjugated goat anti-rabbit IgG was diluted in PBS at a ratio of 1:1000, incubated at 37 ℃ for 1 h, and then washed 5 times with PBS. 8. Add DAPI, stain at 37 ℃ for 10 min, wash 3 times with PBS, then add anti-fluorescence quenching agent and mount with mounting medium. After drying, take pictures using a Leica SP8 laser confocal microscope.

[0022] Immunofluorescence staining analysis results as follows Figure 1 As shown, through Figure 1 It is known that the G4 structure exists in Toxoplasma gondii.

[0023] two, TgAP2IX-5 Potential nucleic acid sequence analysis and structural confirmation in genes that may form G4 1. Bioinformatics analysis of potential G4 sequences Through the QGRS Mapper website ( https: / / bioinformatics.ramapo.edu / QGRS / index.php / ) TgAP2IX-5 Nucleic acid sequences that may form stable G4 sequences in the gene promoter region were predicted. The prediction results showed that a G-rich sequence achieved a QGRS Mapper prediction score of 38 (the highest score), indicating a very high probability of this sequence forming a G4. This G-rich sequence was named TgP20, and its nucleotide sequence is shown in SEQ ID NO.1; a schematic diagram of its location, base composition, and possible basic G4 conformation in the promoter region is shown below. Figure 2 As shown.

[0024] 2. Experiments confirmed that the TgP20 sequence did indeed form the G4 configuration. (1) Circular dichroism spectroscopy experiment The structure of the TgP20 sequence was characterized using circular dichroism spectroscopy, as follows: Solution preparation: The nucleic acid sequence was synthesized in vitro. The sequence was dissolved in Tris-HCl (10 mM, 100 mM KCl, pH 7.4) buffer to prepare a 100 mL solution. The mother liquor was heated at 95 °C for 5 min, then cooled to room temperature. The mother liquor was diluted to a final concentration with buffer solution. .

[0025] Circular dichroism detection: The configuration of this sequence was detected at room temperature using a Chirascan circular dichroism spectrometer. A buffer spectrum was used as background, and the scanning wavelength was 230 nm–360 nm with 1 nm increments. After background subtraction, the circular dichroism spectrum was recorded. Figure 3 As shown. (Through) Figure 3Experimental results show that the sequence has a negative peak at 241 nm and a positive peak at 263 nm, indicating that it forms an intramolecular parallel G4 configuration.

[0026] (2) G4 probe fluorescence emission spectroscopy experiment Principle: N-methyl mesophorphyrin IX (NMM) is a fluorescent probe that specifically binds to G4. NMM has weak autofluorescence, but its autofluorescence emission is significantly enhanced when NMM binds to G4, which can be used to determine whether the bound nucleic acid sequence has formed a G4 structure.

[0027] Preparation of stock solutions: The wild-type TgP20 sequence was synthesized as GGGGGGTGGAGGGTGGGGGT, and the mutant TgP20M sequence as GGAGTGTGGAGTGTGGTGTT was synthesized as a control. The wild-type and mutant sequences were prepared into 100 µM stock solutions using Tris-HCl (10 mM, 100 mM KCl, pH 7.4) and Tris-HCl (10 mM, 100 mM NaCl, pH 7.4) buffer, respectively. The solutions were heated at 95 °C for 5 min and then cooled to room temperature. NMM was dissolved in DMSO to prepare a 20 µM stock solution.

[0028] Fluorescence emission spectroscopy detection: 313.5 µL of annealed wild-type and mutant sequence stock solutions were mixed with 16.5 µL of NMM stock solution and incubated at room temperature for 10 min. Fluorescence emission spectra were recorded using a Hitachi F-7000 fluorescence spectrometer with an excitation wavelength of 393 nm, a scanning wavelength of 500 nm–700 nm, and a step size of 2 nm.

[0029] Data processing: Use Graphpad Prism 9.5 to process the data and create charts.

[0030] Fluorescence emission spectrum such as Figure 4 As shown, through Figure 4 The results show that in K + Or Na + In the case of existence, N MM When bound to the wild-type TgP20 sequence that can form G4, fluorescence emission is significantly enhanced. However, for the mutant TgP20 sequence that cannot form G4, the fluorescence emission intensity does not change significantly after binding to NMM, which further proves that the TgP20 sequence can indeed form the G4 configuration.

[0031] (3) Non-denaturing polyacrylamide gel electrophoresis experiment Principle: When DNA is electrophoresed in a non-denaturing polyacrylamide gel, the DNA folded into a G4 structure is more compact than linear DNA, and therefore migrates faster.

[0032] Synthesize the following nucleic acid sequences labeled with FAM: Wild-type sequence TgP20-FAM: FAM-GGGGGGTGGAGGGTGGGGGT; Mutant sequence TgP20M-FAM: FAM-GGAGTGTGGAGTGTGGTGTT; marker sequence Marker-18nt-FAM: FAM-TTTTTTTTTTTTTTTTTT; marker sequence Marker-25nt-FAM: FAM-TTTTTTTTTTTTTTTTTTTTTTTTTT; Each of the above nucleic acid sequences was prepared into a 100 µM nucleic acid stock solution using Tris-HCl (10 mM, 100 mM KCl, pH 7.4) buffer, heated at 95 °C for 5 min, and then cooled to room temperature.

[0033] Non-denaturing polyacrylamide gel: prepared by mixing the components and allowing the liquid to solidify; the configuration parameters of the non-denaturing polyacrylamide gel are shown in Table 1 below.

[0034] Table 1. Preparation parameters of non-denaturing polyacrylamide gel

[0035] Electrophoresis buffer: 1×TBE solution.

[0036] Sample loading: Each annealed nucleic acid stock solution sample is mixed with loading buffer and then loaded.

[0037] Electrophoresis: constant voltage 110V, ice bath electrophoresis throughout, electrophoresis time is about 1 hour to 1.5 hours.

[0038] Imaging: After electrophoresis, the gel was imaged using an AI600 series imaging system.

[0039] pass Figure 5 It can be seen that TgP20-FAM has a faster migration rate than TgP20M-FAM. TgP20M-FAM has the same migration rate as the two marker sequences, which fully demonstrates that TgP20-FAM formed the G4 configuration, while TgP20M-FAM, like the marker sequence, did not form the G4 configuration.

[0040] (4) Denaturing polyacrylamide gel electrophoresis experiment Principle: When DNA is electrophoresed in denaturing polyacrylamide gel, potential nucleic acid sequences that can form G4 cannot fold into G4 due to the denaturing environment. Therefore, their migration rate is the same as that of mutated or marker nucleic acid sequences that cannot form G4 conformation.

[0041] Synthesize the following nucleic acid sequences labeled with FAM: Wild-type sequence TgP20-FAM: FAM-GGGGGGTGGAGGGTGGGGGT; Mutant sequence TgP20M-FAM: FAM-GGAGTGTGGAGTGTGGTGTT; marker sequence Marker-18nt-FAM: FAM-TTTTTTTTTTTTTTTTTT; marker sequence Marker-25nt-FAM: FAM-TTTTTTTTTTTTTTTTTTTTTTTTTT; Each of the above nucleic acid sequences was prepared into a 100 µM nucleic acid stock solution using Tris-HCl (10 mM, 100 mM KCl, pH 7.4) buffer, heated at 95 °C for 5 min, and then cooled to room temperature.

[0042] Modified polyacrylamide gel: It is prepared by mixing the components and allowing the liquid to solidify; the configuration parameters of the modified polyacrylamide gel are shown in Table 2 below.

[0043] Table 2. Preparation parameters of denatured polyacrylamide gel

[0044] After thoroughly mixing the above components in an Erlenmeyer flask, place it in an ultrasonic cleaner for ultrasonic treatment to dissolve the urea and remove air bubbles from the liquid. After the denatured polyacrylamide gel solidifies, clean the gel plate with ultrapure water and assemble it into an electrophoresis tank. Add electrophoresis buffer and electrophoresis at 350 V for 1 hour. This high-voltage electrophoresis preheating buffer prevents urea precipitation at low temperatures.

[0045] Electrophoresis buffer: 1×TBE solution.

[0046] Sample loading: Mix the annealed nucleic acid stock solution sample with loading buffer and then load the sample.

[0047] Second electrophoresis: constant voltage 300 V, electrophoresis time approximately 1.5 h.

[0048] Imaging: After electrophoresis, the gel was imaged using an AI600 series imaging system.

[0049] pass Figure 6It can be seen that there is no significant difference in migration rate between TgP20-FAM and TgP20M-FAM, which is significantly different from the results of the Native-PAGE electrophoresis experiment mentioned above. This further indicates that TgP20-FAM forms the G4 configuration, while TgP20M-FAM, like the marker sequence, does not form the G4 configuration. III. G4 structure formed by TgP20 sequence TgAP2IX-5 Effects of gene transcription activity The G4 structure formed by the TgP20 sequence was detected by in vitro fluorescein reporter gene assay. TgAP2IX-5 The effect on gene transcription activity.

[0050] 1. Gene synthesis and vector construction The synthesized wild-type sequence TgP20 and its mutant sequence TgP20M were constructed into the pGL3-basic vector, respectively. The pGL3-basic vector contained firefly luciferase, and the pRL-TK plasmid contained kidney luciferase, with kidney luciferase serving as a control.

[0051] 2. Plasmid concentration The concentration of TgP20-pGL3-basic was 0.5230 μg / μl, and the concentration of TgP20M-pGL3-basic was 0.4181 μg / μl.

[0052] 3. Plasmid transfection (1) 293T cells were seeded into 24-well culture plates one day before transfection to achieve a cell density of 60-70% at the time of transfection. The culture medium was DMEM + 10% FBS.

[0053] (2) As shown in Table 3 below, according to the plasmid combination in Table 3, the amount of promoter and transcription factor plasmid is 1 μg, and the amount of PRL-TK plasmid is 0.1 μg; add to 50 μL serum-free DMEM medium (the concentration of pcDNA3.1 empty vector, PGL3-basic empty vector, and pRL-TK empty vector used is 1 mg / mL), a total of 3 groups; after incubating at room temperature for 5 min, add 2 μL of lipo2000 transfection reagent to each group of medium, mix well, incubate at room temperature for 15 min, and add serum-free DMEM medium to 500 μL.

[0054] Table 3 Design of transfection plasmid combinations

[0055] (3) Discard the culture medium in the well, add 500 μL of the transfection complex prepared in the previous step, and incubate at 37 °C for 4-6 h.

[0056] (4) Discard the culture medium, add 1 mL of complete culture medium, and incubate at 37 °C for 48 h.

[0057] 4. Dual-luciferase reporter gene assay This part of the procedure was performed using the Dual-Luciferase Reporter Gene Detection Kit instructions. The specific experimental methods are as follows: (1) Cell lysis: Add 200 μl of cell lysis buffer (CLB) to each well of a 24-well culture plate and incubate on ice for 5 min to fully lyse the cells.

[0058] (2) After complete lysis, collect the lysate, centrifuge at 10,000 rpm for 5 min, and take the supernatant as the test solution.

[0059] (3) Dissolve firefly luciferase buffer (LRB) and firefly luciferase substrate (50×) (LRS), kidney luciferase buffer (LRB II), and kidney luciferase substrate (50×) (LRS II) and bring to room temperature. Dilute each with the corresponding buffer to 1× working solution and place in an ice bath for later use.

[0060] (4) Turn on the chemiluminescence immunoassay analyzer, take another 96-well plate, add 10-20 μl of cell lysis supernatant to the 96-well chemiluminescence plate, and then add 100 μl of firefly luciferase detection working solution. Shake the plate to mix well.

[0061] (5) Measure the luminescence value at 350-700 nm on the instrument, with a detection time of 1 sec.

[0062] (6) After completing the above steps for determining firefly luciferase, add 100 μl of Renshin luciferase detection working solution, shake the plate to mix well, and measure the luminescence value at 350-700 nm for 1 sec.

[0063] (7) When using Renidae luciferase as an internal control, divide the RLU value obtained by firefly luciferase measurement by the RLU value obtained by Renidae luciferase measurement. Compare the activation level of the target reporter gene among different samples based on the obtained ratio.

[0064] Test results as follows Figure 7 As shown, through Figure 7 It can be seen that, compared with mutant sequences that cannot form G4, the TgP20 sequence forms an increased number of G4 sequences. TgAP2IX-5 Transcriptional activity of genes.

[0065] IV. Target TgAP2IX-5 Drug screening for anti-Toxoplasma gondii using G4 structures formed by the TgP20 sequence in the gene promoter region. Since the potential small molecule ligands have fluorescent properties, fluorescence spectroscopy was used to analyze the binding ability of the potential small molecule ligands to the TgP20 G4 sequence, and circular dichroism spectroscopy was used to investigate the effect of the potential small molecule ligands on the configuration of TgP20 G4.

[0066] The above experiments demonstrated the existence of a G4 structure within Toxoplasma gondii, and that the G4 structure formed by the TgP20 sequence increases the transcriptional activity of the TgAP2IX-5 gene. Therefore, G4 ligands may inhibit Toxoplasma gondii proliferation by regulating gene transcription. This invention therefore investigates whether sanguinarine and TMPyP4, as G4 ligands, can inhibit Toxoplasma gondii proliferation through [the following text is incomplete and requires further context: "to regulate gene transcription and thus inhibit Toxoplasma gondii proliferation."] TgAP2IX-5 G4 regulates gene transcription, thereby inhibiting Toxoplasma gondii proliferation. Specifically, are sanguinarine and TMPyP4, as G4 ligands, targeted by this mechanism? TgAP2IX-5 Anti-Toxoplasma gondii drugs with promoter G4.

[0067] 1. Analysis of the binding affinity between sanguinarine and TgP20 G4 (1) Fluorescence spectroscopy analysis The TgP20 sequence was synthesized as GGGGGGTGGAGGGTGGGGGT. A 100 µM TgP20 stock solution was prepared using Tris-HCl buffer (10 mM, 100 mM KCl, pH 7.4), heated at 95 °C for 5 min, and then cooled to room temperature. Sanguisorbine (chloride form) was prepared as an 800 mM stock solution. The sanguisorbine stock solution and the TgP20 stock solution were mixed in different proportions in Tris-HCl buffer (10 mM, 100 mM KCl, pH 7.4) to achieve a final sanguisorbine concentration of 20 mM and final TgP20 concentrations of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 µM. A Hitachi F-7000 fluorescence spectrometer was used with an excitation wavelength of 474 nm, an excitation and emission slit width of 5 nm, and a scanning range of 500 nm–700 nm to record the fluorescence emission spectrum of sanguinarine. The results are as follows: Figure 8 As shown.

[0068] pass Figure 8 The results showed that sanguinarine has strong autofluorescence emission. After mixing with different concentrations of TgP20 sequences, the fluorescence emission intensity of sanguinarine decreased with increasing DNA concentration, indicating that the TgP20 sequence can cause fluorescence quenching of sanguinarine, suggesting that the two can bind.

[0069] (2) Circular dichroism spectroscopy analysis TgP20 stock solution and sanguisorbin stock solution were mixed in Tris-HCl (10 mM, 100 mM KCl, pH 7.4) buffer at different ratios to achieve a final TgP20 concentration of 10 mM and final sanguisorbin concentrations of 20, 40, 60, 80, and 100 mM. The configuration of this sequence was detected using a Chirascan circular dichroism spectrometer. The buffer spectrum was used as background, and the scanning wavelength was 230 nm–360 nm with a step size of 1 nm. After background subtraction, the circular dichroism spectra were recorded. Figure 9 As shown.

[0070] pass Figure 9 The results showed that sanguinarine can maintain the stability of its parallel configuration after binding with TgP20.

[0071] 2. Binding ability analysis of TMPyP4 and TgP20 G4 (1) Fluorescence spectroscopy analysis The TgP20 sequence was synthesized as GGGGGGTGGAGGGTGGGGGT. The synthesized sequence was prepared into a 100 µM TgP20 stock solution using Tris-HCl buffer (10 mM, 100 mM KCl, pH 7.4), heated at 95 °C for 5 min, and then cooled to room temperature. A 500 mM TMPyP4 stock solution was prepared. The TMPyP4 stock solution and the TgP20 stock solution were mixed in different proportions in Tris-HCl buffer (10 mM, 100 mM KCl, pH 7.4) to achieve a final TMPyP4 concentration of 20. The final concentrations of TgP20 were 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 mM. A Hitachi F-7000 fluorescence spectrometer was used with an excitation wavelength of 422 nm, an excitation and emission slit width of 5 nm, and a scanning range of 500 nm–700 nm to record the fluorescence emission spectra of TMPyP4. The results are as follows: Figure 10 As shown.

[0072] pass Figure 10 The results showed that TMPyP4 had strong fluorescence emission on its own. After being mixed with different concentrations of TgP20 sequences, the fluorescence emission intensity of TMPyP4 decreased with increasing DNA concentration, indicating that the TgP20 sequence could cause fluorescence quenching of TMPyP4, suggesting that the two could bind.

[0073] (2) Circular dichroism spectroscopy analysis The TgP20 stock solution and TMPyP4 stock solution were mixed in different proportions in Tris-HCl (10 mM, 100 mM KCl, pH 7.4) buffer to make the final concentration of TgP20 10. The final concentrations of TMPyP4 were 20, 40, 60, 80, and 100, respectively. The configuration of this sequence was detected using a Chirascan circular dichroism spectrometer. A buffer spectrum was used as background, and the scanning wavelength was 230 nm–360 nm with a step size of 1 nm. After background subtraction, the circular dichroism spectra were recorded. The results are as follows: Figure 11 As shown.

[0074] pass Figure 11 The results show that TMPyP4 can maintain the stability of its parallel configuration after binding with TgP20.

[0075] V. Targeting TgAP2IX-5 Drugs screened from gene promoter region G4 TgAP2IX-5 Effects of gene transcription 1. Sanguisorbine TgAP2IX-5 Effects of gene transcription Toxoplasma gondii sample collection after drug intervention: A monolayer of Vero cells was seeded in a 6-well plate. After the cells adhered and grew, they were then seeded at a concentration of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of the drug was added to the cells to achieve a final sanguinarine concentration of 2.5%. 5 10 Meanwhile, a drug-free culture medium was used as a blank control group, and sulfadiazine 40 was used as the control group. As a positive control, the cells were cultured for another 24 hours. All cells and parasites were scraped off using a cell scraper, and the cells were repeatedly disrupted using a syringe. The cells were centrifuged at 2000 rpm for 10 minutes to remove cell debris. The parasites were collected, and RNA was extracted. Quantitative real-time PCR (qPCR) was used to detect RNA in each group of *Toxoplasma gondii*. TgAP2IX-5 Transcription status of the gene (the gene to be tested).

[0076] Synthesis detection TgAP2IX-5 Primers required for gene transcription: Forward primer: GGGCACACTTGGGTGTGATA; Reverse primer:CACGTCGACACAGGACTGAA; Primers for synthesizing and detecting the 529bp internal reference gene: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Configure the primers to 10 using H2O (DEPC). The mother liquor is kept for later use.

[0077] The qPCR reaction systems and reaction program settings for the test gene and the internal reference gene are shown in Tables 4 and 5 below. The CT values ​​of the test gene and the internal reference gene were obtained through qPCR. Based on the obtained CT values, the mRNA expression levels of the test gene and the internal reference gene were calculated using the ΔΔCt method. Using the internal reference gene as a reference, the relative mRNA expression level of the test gene was calculated.

[0078] Table 4 qPCR reaction system

[0079] Table 5 qPCR reaction procedure

[0080] In each group of Toxoplasma gondii TgAP2IX-5 Gene transcription status, such as Figure 12 As shown, through Figure 12 It can be seen that high, medium, and low doses of sanguinarine can significantly inhibit... TgAP2IX-5 It inhibits gene transcription in a dose-dependent manner. Three concentrations of sanguinarine showed significantly better inhibitory effects on gene transcription than sulfadiazine, a first-line clinical drug.

[0081] 2. TMPyP4 against TgAP2IX-5 Effects of gene transcription Toxoplasma gondii sample collection after drug intervention: A monolayer of Vero cells was seeded in a 6-well plate. After the cells adhered and grew, they were then seeded at a concentration of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of the drug was added to the cells to achieve a final TMPyP4 concentration of 2.5%. 5 10 That is, different concentrations of TMP groups, with a drug-free culture medium as a blank control group, and sulfadiazine 40 As a positive control, the cells were cultured for another 24 hours. All cells and parasites were scraped off using a cell scraper, and the cells were repeatedly disrupted using a syringe. The cells were centrifuged at 2000 rpm for 10 minutes to remove cell debris. The parasites were collected, and RNA was extracted from them. Relative qPCR was used to detect RNA in each group of *Toxoplasma gondii*. TgAP2IX-5 Gene transcription status.

[0082] Synthesis detection TgAP2IX-5 The primer sequences required for gene transcription are designed as follows: Forward primer: GGGCACACTTGGGTGTGATA; Reverse primer:CACGTCGACACAGGACTGAA; Primers for synthesizing the 529bp internal reference gene: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Configure the primers to 10 using H2O (DEPC). The mother liquor is kept for later use.

[0083] The qPCR reaction system and reaction program settings for the test gene and the internal reference gene are shown in Tables 4 and 5 above, respectively. The CT values ​​of the test gene and the internal reference gene were obtained through qPCR. Based on the obtained CT values, the mRNA expression levels of the test gene and the internal reference gene were calculated using the ΔΔCt method. Using the internal reference gene as a reference, the relative mRNA expression level of the test gene was calculated.

[0084] In each group of Toxoplasma gondii TgAP2IX-5 Gene transcription status, such as Figure 13 As shown, through Figure 13 It can be seen that high, medium, and low doses of TMPyP4 can all significantly inhibit TgAP2IX-5 It inhibits gene transcription in a dose-dependent manner. Three concentrations of TMPyP4 showed significantly better inhibitory effects on gene transcription than sulfadiazine, a first-line clinical drug.

[0085] VI. Effects of drugs selected targeting the G4 region of the TgAP2IX-5 gene promoter on Toxoplasma gondii proliferation. 1. Effects of sanguinarine on Toxoplasma gondii proliferation (1) Detection of the effect of sanguinarine on Vero cell proliferation using the CCK8 assay Add 100 μL of cell suspension to each well of a 96-well plate, and add 5 × 10³ Vero cells to each well. Pre-culture the 96-well plate in a 37°C, 5% CO2 incubator to allow cell adhesion. Add DMEM medium containing different concentrations of the test drug to the culture wells to achieve a final sanguinarine concentration of 2.5%. 5 10 Continue incubation in the incubator for 24 hours. Add 10 μL of CCK8 solution to each well, avoiding the formation of air bubbles. Return the 96-well plate to the incubator and continue incubation for 0.5–4 hours. Measure the absorbance of each well at 450 nm using a microplate reader. Calculate cell viability. The formula for calculating cell viability is as follows: Cell viability = [(As-Ab) / (Ac-Ab)] × 100%; Where As is the absorbance of the experimental wells (containing cells, culture medium, CCK8 solution and drug solution); Ac is the absorbance of the control wells (containing cells, culture medium and CCK8 solution, but no drug); and Ab is the absorbance of the blank wells (containing culture medium and CCK8 solution, but no cells and drug).

[0086] The calculation results of cell viability are as follows: Figure 14 As shown, through Figure 14 It can be seen that as the concentration of sanguinarine increases, cell viability gradually decreases, and the CC of sanguinarine decreases. 50 Greater than 60 At 2.5, which can inhibit gene transcription. 5 10 At the concentration, cell viability is close to 100%.

[0087] (2) Detection of the inhibitory effect of sanguinarine on Toxoplasma gondii proliferation by absolute qPCR method Toxoplasma gondii sample collection after drug intervention: A monolayer of Vero cells was seeded in a 6-well plate. After the cells adhered and grew, they were then seeded at a concentration of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of sanguinarine was added to the cells to achieve a final concentration of 10... 30 50 Meanwhile, a drug-free culture medium was used as a blank control, and sulfadiazine 40 was added. As a positive control, the cells were cultured for another 24 hours. All cells and parasites were scraped off using a cell scraper, and the cells were repeatedly broken up with a syringe. The cells were centrifuged at 2000 rpm for 10 minutes to remove cell debris, and the parasites were collected. The parasite DNA was extracted, and the copy number of the P529 gene in each group of Toxoplasma gondii was detected by absolute qPCR.

[0088] The primers required for detecting the copy number of the P529 gene are designed as follows: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Primers were configured to 10 using ddH2O. The mother liquor is kept for later use.

[0089] The qPCR reaction system and reaction program settings are shown in Tables 4 and 5 above, respectively.

[0090] To construct a standard curve: Using the primers described above and PRU strain DNA, the target fragment was obtained by PCR, ligated into a vector, transformed into competent cells, single colonies were picked for colony PCR verification, the correct colonies were selected for large-scale expression, plasmids were extracted to obtain Toxoplasma gondii standards, qPCR was performed according to serial dilutions, and a standard curve was plotted based on the obtained CT values.

[0091] The copy number of the P529 gene in each group of Toxoplasma gondii is as follows: Figure 15 As shown, through Figure 15 It can be seen that low, medium, and high doses of sanguinarine can significantly inhibit the copy number of the P529 gene, i.e., inhibit the proliferation of Toxoplasma gondii, in a dose-dependent manner. The inhibitory effect of sanguinarine at all three concentrations on gene transcription is significantly better than that of sulfadiazine, a first-line clinical drug.

[0092] (3) Effect of sanguinarine on the number of Toxoplasma gondii vacuoles by fluorescence detection Collect freshly escaped RFP Toxoplasma gondii strains, and take 100 Inoculated onto confluent cell slides, after 1 hour of invasion, uninvaded parasites were washed away with pre-warmed serum-free DMEM medium, followed by culturing in 2% DMEM medium for another 12 hours. Different volumes of DMEM medium containing the drug were then added to the cells to achieve a final sanguinarine concentration of 2.5%. 5 10 Meanwhile, a drug-free culture medium was used as a blank control, and sulfadiazine 40 was added. As a positive control, cells were cultured for another 48 hours. Cell slides were washed three times with PBS, air-dried, and fixed with 4% paraformaldehyde for 20 min. After washing three times with PBS, anti-fluorescence quencher was added, and the slides were mounted with mounting medium. After air-drying, images were taken using a Leica SP8 laser confocal microscope. The results are shown below. Figure 16 As shown.

[0093] pass Figure 16 It is known that low, medium, and high concentrations of sanguinarine and sulfadiazine can all inhibit the number of Toxoplasma gondii vacuoles.

[0094] (4) Detection of the inhibitory effect of sanguinarine on the proliferation of Toxoplasma gondii using fluorescence method Collect freshly escaped RFP Toxoplasma gondii strains, and take 100 Inoculated onto confluent cell slides, after 1 hour of invasion, uninvaded parasites were washed away with pre-warmed serum-free DMEM medium, followed by 12 hours of further culture in 2% DMEM medium. Different volumes of DMEM medium containing the drug were then added to the cells to achieve a final sanguinarine concentration of 2.5%. 5 10 Meanwhile, a drug-free culture medium was used as a blank control, and sulfadiazine 40 was added. As a positive control, cells were cultured for another 48 hours. Cell slides were washed three times with PBS, air-dried, and fixed with 4% paraformaldehyde for 20 min. After washing three times with PBS, anti-fluorescence quencher was added, and the slides were mounted with mounting medium. After air-drying, images were taken using a Leica SP8 laser confocal microscope. The results are shown below. Figure 17 As shown.

[0095] pass Figure 17 It is known that sanguinarine can inhibit the proliferation of Toxoplasma gondii.

[0096] (5) Detection of the inhibitory effect of sanguinarine on Toxoplasma gondii proliferation by CCK8 assay A monolayer of Vero cells was seeded in a 96-well plate. After the cells adhered and grew, they were incubated at a rate of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of the drug was added to the cells. A drug-free medium was used as a blank control. Sulfadiazine 40 g was added to the DMEM medium. As a positive control, continue culturing for 48 hours. Add 10 μL of CCK8 solution to each well, avoiding air bubbles, and return the 96-well plate to the incubator for another 0.5–4 hours. Measure the absorbance of each well at 450 nm using a microplate reader. Calculate cell viability. Cell viability = [(As-Ab) / (Ac-Ab)] × 100%. Where, As is the absorbance of the experimental wells (containing cells, culture medium, CCK8 solution, and drug solution); Ac is the absorbance of the control wells (containing cells, culture medium, and CCK8 solution, but no drug); and Ab is the absorbance of the blank wells (containing culture medium and CCK8 solution, but no cells or drug). Results are as follows: Figure 18 As shown.

[0097] pass Figure 18 It can be seen that low doses of sanguinarine can effectively inhibit the proliferation of Toxoplasma gondii, and this effect is dose-dependent.

[0098] 2. Effects of TMPyP4 on Toxoplasma gondii proliferation (1) Detection of the effect of TMPyP4 on Vero cell proliferation by CCK8 assay Add 100 μL of cell suspension to each well of a 96-well plate, and add 5 × 10³ Vero cells to each well. Pre-culture the 96-well plate in a 37°C, 5% CO2 incubator to allow cell adhesion. Add DMEM medium containing different concentrations of the test drug to the culture wells and incubate for another 24 h. Add 10 μL of CCK8 solution to each well, avoiding air bubbles, and return the 96-well plate to the incubator for another 0.5–4 h. Measure the absorbance of each well at 450 nm using a microplate reader. Calculate cell viability. Cell viability = [(As-Ab) / (Ac-Ab)] × 100%. Where As is the absorbance of the experimental wells (containing cells, culture medium, CCK8 solution, and drug solution); Ac is the absorbance of the control wells (containing cells, culture medium, and CCK8 solution, but no drug); and Ab is the absorbance of the blank wells (containing culture medium and CCK8 solution, but no cells or drug). Results are as follows: Figure 19 As shown in A in the diagram.

[0099] pass Figure 19 As shown in A, cell viability gradually decreases with increasing TMPyP4 concentration, and the C2C of TMPyP4... 50 Nearly 400 At 2.5, which can inhibit gene transcription. 5 10 At the concentration, cell viability is close to 100%.

[0100] (2) Absolute qPCR method to detect the inhibitory effect of TMPyP4 on Toxoplasma gondii proliferation Toxoplasma gondii sample collection after drug intervention: A monolayer of Vero cells was seeded in a 6-well plate. After the cells adhered and grew, they were then seeded at a concentration of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of the drug was added to the cells to achieve a final TMPyP4 concentration of 2.5%. 5 10 Meanwhile, a drug-free culture medium was used as a blank control, and sulfadiazine 40 was added. As a positive control, the cells were cultured for another 24 hours. All cells and parasites were scraped off using a cell scraper, and the cells were repeatedly broken up with a syringe. The cells were centrifuged at 2000 rpm for 10 minutes to remove cell debris, collect the parasites, and extract their DNA. The copy number of the P529 gene in each group of Toxoplasma gondii was detected using absolute qPCR.

[0101] The primers required for synthesizing and detecting the copy number of the P529 gene are as follows: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Primers were configured to 10 using ddH2O. The mother liquor of L is reserved for later use.

[0102] The qPCR reaction system and reaction program settings are shown in Tables 4 and 5 above, respectively.

[0103] To construct a standard curve: Using the primers described above and PRU strain DNA, the target fragment was obtained by PCR, ligated into a vector, transformed into competent cells, single colonies were picked for colony PCR verification, the correct colonies were selected for large-scale expression, plasmids were extracted to obtain Toxoplasma gondii standards, qPCR was performed according to serial dilutions, and a standard curve was plotted based on the obtained CT values.

[0104] The copy number of the P529 gene in each group of Toxoplasma gondii is as follows: Figure 19 As shown in B, through Figure 19 As shown in B, low, medium, and high doses of TMPyP4 significantly inhibited the copy number of the P529 gene, i.e., inhibited the proliferation of Toxoplasma gondii, in a dose-dependent manner. The inhibitory effect of medium and high concentrations of TMPyP4 on gene transcription was significantly superior to that of sulfadiazine, a first-line clinical drug.

[0105] (3) Effect of TMPyP4 on the number of Toxoplasma gondii vacuoles by fluorescence method Collect freshly escaped RFP Toxoplasma gondii strains, and take 100 Inoculated onto confluent cell slides, after 1 hour of invasion, uninvaded parasites were washed away with pre-warmed serum-free DMEM medium, followed by culturing in 2% DMEM medium for another 12 hours. Different volumes of DMEM medium containing the drug were added to the cells, with drug-free medium serving as a blank control. Sulfadiazine 40... As a positive control, cells were cultured for another 48 hours. Cell slides were washed three times with PBS, air-dried, and fixed with 4% paraformaldehyde for 20 min. After washing three times with PBS, anti-fluorescence quencher was added, and the slides were mounted with mounting medium. After air-drying, images were taken using a Leica SP8 laser confocal microscope. The results are shown below. Figure 21 As shown.

[0106] pass Figure 21 It is known that medium and high doses of TMPyP4 and sulfadiazine can inhibit the number of Toxoplasma gondii vacuoles.

[0107] (4) Detection of the inhibitory effect of TMPyP4 on Toxoplasma gondii proliferation by fluorescence method Collect freshly escaped RFP Toxoplasma gondii strains, and take 100 Inoculated onto confluent cell slides, after 1 hour of invasion, uninvaded parasites were washed away with pre-warmed serum-free DMEM medium, followed by 12 hours of further culture in 2% DMEM medium. Different volumes of DMEM medium containing the drug were added to the cells, with drug-free medium serving as a blank control. Sulfadiazine 40... As a positive control, cells were cultured for another 48 hours. Cell slides were washed three times with PBS, air-dried, and fixed with 4% paraformaldehyde for 20 min. After washing three times with PBS, anti-fluorescence quencher was added, and the slides were mounted with mounting medium. After air-drying, images were taken using a Leica SP8 laser confocal microscope. The results are shown below. Figure 22 As shown.

[0108] pass Figure 22 Analysis showed that TMPyP4 can inhibit the proliferation of Toxoplasma gondii.

[0109] (5) Detection of the inhibitory effect of TMPyP4 on Toxoplasma gondii proliferation by CCK8 assay A monolayer of Vero cells was seeded in a 96-well plate. After the cells adhered and grew, they were incubated at a rate of 5 × 10⁶ cells / well. 6 Cells were infected with tachyzoites of the PRU strain and incubated at 37°C for 4 h. After washing three times with PBS to remove uninvaded parasites, DMEM medium containing different volumes of the drug was added to the cells. A drug-free medium was used as a blank control. Sulfadiazine 40 g was added to the DMEM medium. As a positive control, continue culturing for 24 hours. Add 10 μL of CCK8 solution to each well, avoiding air bubbles, and return the 96-well plate to the incubator for another 0.5–4 hours. Measure the absorbance of each well at 450 nm using a microplate reader. Calculate cell viability. Cell viability = [(As-Ab) / (Ac-Ab)] × 100%. Where, As is the absorbance of the experimental wells (containing cells, culture medium, CCK8 solution, and drug solution); Ac is the absorbance of the control wells (containing cells, culture medium, and CCK8 solution, but no drug); and Ab is the absorbance of the blank wells (containing culture medium and CCK8 solution, but no cells or drug). Results are as follows: Figure 23 As shown.

[0110] pass Figure 23 It can be seen that low doses of TMPyP4 can effectively inhibit the proliferation of Toxoplasma gondii, and this effect is dose-dependent.

[0111] VII. Targeting TgAP2IX-5 Effects of drugs screened from gene promoter region G4 on Toxoplasma gondii cyst-induced colitis in mice. 1. Animal model construction and drug intervention (1) Purification of the capsule in mice ① 1000 prunes were injected intraperitoneally into mice.

[0112] ② After 35-40 days, the mice were sacrificed and their head skin was sprayed with 75% alcohol.

[0113] ③ Make an incision from the base of the neck down to the nose and remove the scalp skin. Starting from the initial incision, make another incision at the base of the skull, cutting along the right and left sides of the skull base, and dissect the skull with forceps. Collect the brain with a scraper, severing the connection to the olfactory bulb in the process. Repeat the above steps on other mice.

[0114] ④ Transfer the brain to a 50 mL conical tube and rinse it several times with pre-chilled PBS to remove red blood cells. Transfer the brain to a culture dish and homogenize it in 10 mL PBS using a syringe (homogenize no more than 5 brains in 10 mL, on ice).

[0115] ⑤ Collect the homogenate with a syringe and transfer it to a grinder. Further homogenize by grinding at least 10 times throughout the process. Keep the homogenate on ice.

[0116] ⑥ Prepare 50 mL of 45% Percoll solution (22.5 mL of Percoll is stored in 27.5 mL of PBS).

[0117] ⑦ Divide 50 mL of 45% Percoll solution into two centrifuge tubes. Add 5 mL of homogenization and encapsulation solution to each tube. (Use high-quality non-round-bottom or round-bottom centrifuge tubes; the amounts of 45% Percoll solution and homogenization and encapsulation solution can be adjusted as needed.) ⑧ Centrifuge both solutions at 26,600 xg for 20 minutes at 4°C, pre-cooling the centrifuge beforehand.

[0118] 9. Carefully remove 3 mL from the bottom of each test tube (centrifuge tube) and discard it. Specifically, use a long syringe needle or a long gavage needle to remove it into a 5 mL syringe and then discard it. The specific amount to be removed depends on the total amount of centrifugation. In this example, it is 3 mL.

[0119] ⑩ Carefully remove the next 20 mL from the bottom of each test tube and place it into a new 50 mL conical tube. Fill each test tube to 50 mL with pre-cooled PBS; the exact amount removed depends on the total volume of centrifugation, and in this example, it is 20 mL. Add fresh PBS in a gradient.

[0120] Centrifuge the solution at 130×g for 10 minutes and then heat at 4℃.

[0121] Through this step, tissue capsules should form particles at the bottom of the tube. Aspirate the supernatant and resuspend the precipitate in 500 μL of PBS. Take a small aliquot of these solutions (e.g., 10 μL) and prepare wet mounts using coverslips and microscope slides. Count the number of capsules present in the aliquots and determine the total number of capsules in the particles.

[0122] The encapsulation was further concentrated by centrifugation at 1,400×g for 4 minutes at room temperature.

[0123] Remove the supernatant. At this stage, the precipitate can be stored at -80°C for future analysis.

[0124] (2) Animal grouping, administration and sampling Seven-week-old female BALB / c mice were acclimatized and then randomly divided into six groups of eight mice each: a control group, a model group fed 50 Pru capsules, a model group plus sanguinarine 15 mg / kg, a model group plus sanguinarine 10 mg / kg, a model group plus TMPyP4 15 mg / kg, and a model group plus sulfadiazine 100 mg / kg. Except for the control group, all other groups were administered 50 Pru capsules by gavage on day 0 to induce colitis. The drug was prepared as a suspension using 0.5% CMC-Na. Each mouse in the treatment groups was administered 0.1 ml of the corresponding dose of drug suspension by gavage for 7 consecutive days. Simultaneously, the control and model groups were administered 0.1 ml of 0.5% CMC-Na by gavage. Twenty-four hours after the last administration, mice were anesthetized with sodium pentobarbital, and serum and colon tissue were collected for subsequent analysis.

[0125] 2. Effects of sanguinarine and TMPyP4 on body weight in mice with Toxoplasma gondii-induced colitis model The effects of Toxoplasma gondii-induced enteritis on mouse body weight and the effects of different doses of sanguinarine and TMPyP4 on body weight in colitis model mice. Figure 24 As shown. (Through) Figure 24 It can be seen that as the duration of Toxoplasma gondii infection progressed, the body weight of mice in the Toxoplasma gondii-infected group gradually decreased compared to the normal control group. High and low doses of sanguinarine, sulfadiazine, and TMPyP4 could all reverse the weight loss in mice to varying degrees, with the order of strength being 100 mg / kg sulfadiazine > 15 mg / kg sanguinarine > 15 mg / kg TMPyP4 > 10 mg / kg sanguinarine.

[0126] 3. Effects of sanguinarine and TMPyP4 on colonic pathological damage in mice infected with Toxoplasma gondii (1) Tissue embedding and sectioning ①Tissues fixed with 4% paraformaldehyde were placed in a series of alcohols for dehydration: overnight in 75% alcohol; 2 hours in 85% alcohol; 1 hour in 90% alcohol; 1 hour in 95% alcohol; 30 minutes in 100% alcohol I; and 30 minutes in 100% alcohol II.

[0127] ②Clearing treatment: Clear in anhydrous ethanol or xylene for 5-10 min; clear in xylene I for 5-10 min; Clear the xylene II solution for 5-10 minutes (observe the clearing effect).

[0128] ③Wax embedding: Impregnate in paraffin I for 1 hour; impregnate in paraffin II for 1 hour; impregnate in paraffin III for 1 hour and then trim.

[0129] ④ Sectioning: Place the trimmed wax block on a paraffin microtome and section it continuously to a thickness of 4 μm.

[0130] ⑤ Drying: Float the slices on the surface of 40 ℃ warm water and flatten them. Use a glass slide that has been treated to prevent them from falling off to lift them out. Place them in a 60 ℃ oven and bake for 2-3 hours. After baking, store at room temperature for later use.

[0131] (2) HE staining Dewaxing in xylene I for 10 min; dewaxing in xylene II for 10 min; dexylene removal in 100% ethanol I for 5 min; dexylene removal in 100% ethanol II for 5 min; ethanol removal in 95% ethanol for 5 min; ethanol removal in 85% ethanol for 5 min; ethanol removal in 75% ethanol for 5 min; washing away alcohol in distilled water for 5 min; hematoxylin staining for 3-8 min, rinsing briefly with running water; differentiation in 1% hydrochloric acid-ethanol solution for 30 sec (observe differentiation effect), rinsing briefly with running water; blueing in 1% ammonia solution for 30 sec, rinsing briefly with running water; after satisfactory staining under a microscope, staining with eosin for 1-3 min; dehydration in 95% ethanol I for 5 min; dehydration in 95% ethanol II for 5 min; dehydration in 100% ethanol I for 5 min; dehydration in 100% ethanol II for 5 min; xylene I for 5 min; xylene II for 10 min; mounting with neutral resin. Photographs under a microscope.

[0132] (3) Results HE staining results are as follows Figure 25 As shown, through Figure 25It can be seen that the intestinal mucosal epithelial cells in the blank group were neatly arranged, forming a single layer of columnar cells. In the model group, the intestinal mucosal epithelium was partially sloughed off, with an irregular arrangement; some mucosal epithelial cells showed necrosis, characterized by nuclear condensation, darker nuclear staining, increased eosinophilicity of the cytoplasm, and significant red staining of the cytoplasm. Compared with the model group, the intestinal mucosa integrity was better in both the low-dose and high-dose sanguinarine groups, with slight proliferation of mucosal epithelial cells and a more compact and numerous columnar cell arrangement. The intestinal mucosa integrity was better in the TMPyP4 group, with neatly arranged columnar mucosal epithelial cells. The mucosa integrity was also better in the sulfadiazine group, with relatively neatly arranged columnar mucosal epithelial cells. These results indicate that sanguinarine and TMPyP4 have an inhibitory effect on Toxoplasma gondii in mice and can alleviate the pathological damage to intestinal epithelial cells caused by Toxoplasma gondii infection, with efficacy superior to the existing drug sulfadiazine.

[0133] 4. Effects of sanguinarine and TMPyP4 on inflammatory factors in mice infected with Toxoplasma gondii (1) Effect of enzyme-linked immunosorbent assay (ELISA) on drug secretion of inflammatory cytokines Inflammatory cytokines in the serum of mice in each group were detected using an ELISA kit. And the concentration of IL6, the results are as follows Figure 26 As shown. (Through) Figure 26 The results showed that, compared with normal control mice, the serum of mice infected with Toxoplasma gondii contained [a higher concentration of parasites]. The concentrations of IL-6 and other substances were significantly increased. After drug intervention, compared with the Toxoplasma gondii infection group, the serum levels of IL-6 in mice in each treatment group were significantly higher. The concentrations of IL-6 and IL-6 decreased to varying degrees, and the differences were statistically significant.

[0134] (2) Detection of the effect of drugs on the transcription of inflammatory cytokine genes by relative qPCR method The colon tissue of mice in each group was detected by qPCR. and IL6 The mRNA expression status was determined. Specifically, mouse colon tissue was lysed, Trizol was added, and RNA was extracted using the Trizol method. RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit and a thermal cycler. qPCR amplification was performed using the SYBR method.

[0135] Synthesis detection and IL6 The primers required for gene transcription are designed as follows: TNF-α Forward primer: TAGCCCACGTCGTAGCAAAC; TNF-α Reverse primer: TGTCTTTGAGATCCATGCCGT; IL6 Forward primer: GGGACTGATGCTGGTGACAA; IL6 Reverse primer:ACAGGTCTGTTGGGAGTGGT; Synthetic detection internal reference gene GAPDH Primers: GAPDH Forward primer:GGGGTCGTTGATGGCAACA; GAPDH Reverse primer: AGGTCGGTGTGAACGGATTTG; The primers were configured to 10 using H2O (DEPC). The mother liquor is kept for later use.

[0136] The qPCR reaction system and reaction program settings for the test gene and the internal reference gene are shown in Tables 4 and 5 above, respectively. The CT values ​​of the test gene and the internal reference gene were obtained through qPCR. Based on the obtained CT values, the mRNA expression levels of the test gene and the internal reference gene were calculated using the ΔΔCt method. Using the internal reference gene as a reference, the relative mRNA expression level of the test gene was calculated.

[0137] pass Figure 27 The results showed that, compared with normal control mice, mice infected with Toxoplasma gondii had higher levels of Toxoplasma gondii in their colon tissue. and IL6 The mRNA expression of [the substance] was significantly increased. After drug intervention, compared with the Toxoplasma gondii infection group, the expression of [the substance] in the colon tissue of mice in each drug-treated group was significantly increased. and IL6 The mRNA expression of the cells showed varying degrees of decrease, and the differences were statistically significant.

[0138] 5. Effects of sanguinarine and TMPyP4 on the number of Toxoplasma gondii in mice infected with Toxoplasma gondii and TgAP2IX-5 Effects of gene transcription (1) Detection of the effect of drugs on the number of Toxoplasma gondii in mice by absolute qPCR method DNA was extracted from the parasites, and the copy number of the P529 gene in each group of Toxoplasma gondii was detected by qPCR.

[0139] Synthesize the primers required for detecting the copy number of the P529 gene: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Primers were configured to 10 using ddH2O. The mother liquor is kept for later use.

[0140] The qPCR reaction system and reaction program settings are shown in Tables 4 and 5 above, respectively.

[0141] To construct a standard curve: Using the primers described above and PRU strain DNA, the target fragment was obtained by PCR, ligated into a vector, transformed into competent cells, single colonies were picked for colony PCR verification, the correct colonies were selected for large-scale expression, plasmids were extracted to obtain Toxoplasma gondii standards, qPCR was performed according to serial dilutions, and a standard curve was plotted based on the obtained CT values.

[0142] The copy number of the P529 gene in each group of Toxoplasma gondii is as follows: Figure 20 As shown in A in the diagram. (Through) Figure 20 As shown in A, both high and low doses of sanguinarine and TMPyP4 can significantly inhibit the copy number of the P529 gene (the difference is statistically significant), meaning that both high and low doses of sanguinarine and TMPyP4 can inhibit the proliferation of Toxoplasma gondii, and their effects are significantly better than those of the first-line clinical drug sulfadiazine.

[0143] (2) Relative qPCR method for detecting drug effects on Toxoplasma gondii in mice TgAP2IX-5 Effects of gene transcription Colon tissue was ground, and RNA from Toxoplasma gondii was extracted. Relative qPCR was used to detect RNA levels in the colon of mice in each group. TgAP2IX-5 Gene transcription status.

[0144] Synthesis detection TgAP2IX-5 Primers required for gene transcription: Forward primer: GGGCACACTTGGGTGTGATA; Reverse primer:CACGTCGACACAGGACTGAA; Primers for synthesizing and detecting the 529bp internal reference gene: Forward primer: TGTCACAGAGTTACATCTTTCCC; Reverse primer:TTTCACCATAGCCATCTAAGAGC; Configure the primers to 10 using H2O (DEPC). The mother liquor is kept for later use.

[0145] The qPCR reaction system and reaction program settings for the test gene and the internal reference gene are shown in Tables 4 and 5 above, respectively. The CT values ​​of the test gene and the internal reference gene were obtained through qPCR. Based on the obtained CT values, the mRNA expression levels of the test gene and the internal reference gene were calculated using the ΔΔCt method. Using the internal reference gene as a reference, the relative mRNA expression level of the test gene was calculated.

[0146] In each group of Toxoplasma gondii TgAP2IX-5 Gene transcription status, such as Figure 20 As shown in B, through Figure 20 As shown in B, both high and low doses of sanguinarine, TMPyP4, and sulfadiazine can significantly inhibit... TgAP2IX-5 Gene transcription (the difference was statistically significant). High doses of sanguinarine and TMPyP4 showed a trend of superior inhibition of gene transcription compared to sulfadiazine, a first-line clinical drug.

[0147] In summary, this invention has discovered the existence of a G4 structure within Toxoplasma gondii through research, and has also discovered... TgAP2IX-5 The promoter region contains a nucleic acid sequence that can form a stable G4 structure. This invention uses the G4 structure formed by this sequence as a Toxoplasma gondii biomarker and as a therapeutic target. It screened out G4 ligands sanguinarine and TMPyP4, which can bind to this G4 structure, as drugs for the prevention or treatment of Toxoplasma gondii infection. Furthermore, it was confirmed that sanguinarine and TMPyP4 have inhibitory effects on Toxoplasma gondii both in vivo and in vitro, and can alleviate colonic tissue damage and inflammatory response induced by Toxoplasma gondii cyst infection in mice. This provides a new method and perspective for drug development to combat zoonotic toxoplasmosis, and is of great significance in the prevention and control of toxoplasmosis.

[0148] Although embodiments of the invention have been shown and described, those skilled in the art will understand that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. A Toxoplasma gondii biomarker, characterized in that, The Toxoplasma gondii biomarker is a G-tetramolecular, and the G-tetramolecular is... TgAP2IX-5 A G-rich sequence in the gene promoter region; the G-quadruplex is a nucleic acid secondary structure. The nucleotide sequence of the G-rich sequence is shown in SEQ ID NO.

1.

2. The Toxoplasma gondii biomarker according to claim 1, characterized in that, G-quadruplexes are intramolecular parallel G-quadruplex structures.

3. The use of small molecule ligands in the preparation of drugs for the prevention and / or treatment of toxoplasmosis infection, characterized in that, The small molecule ligand is a small molecule ligand that can bind to the Toxoplasma gondii biomarker as described in claim 1 or 2.

4. The use according to claim 3, characterized in that, The small molecule ligands are sanguinarine and / or TMPyP4.

5. The use according to claim 4, characterized in that, The dosage of sanguinarine is 10-15 mg / kg body weight.

6. The use according to claim 4, characterized in that, The recommended dosage of TMPyP4 is 15 mg / kg body weight.

7. Use of a Toxoplasma gondii biomarker according to claim 1 or 2 as a therapeutic target in screening drugs for the prevention and / or treatment of Toxoplasma gondii infection.

8. A method for screening drugs for the prevention and / or treatment of toxoplasmosis infection, characterized in that, Includes the following steps: pass TgAP2IX-5 A G-rich sequence in the gene promoter region forms a Toxoplasma gondii biomarker, and the nucleotide sequence of the G-rich sequence is shown in SEQ ID NO.1; Using the established Toxoplasma gondii biomarkers as targets, small molecule ligands that can bind to and stabilize their structures are screened by fluorescence and circular dichroism spectroscopy analysis. Experimental verification was conducted on the small molecule ligands obtained through screening to identify those capable of inhibiting... TgAP2IX-5 Small molecule ligands that inhibit Toxoplasma gondii proliferation through gene transcription are drugs used to prevent and / or treat Toxoplasma gondii infection.

9. The method for screening drugs for the prevention and / or treatment of toxoplasmosis infection according to claim 8, characterized in that, Able to inhibit TgAP2IX-5 The small molecule ligands that inhibit Toxoplasma gondii proliferation through gene transcription are sanguinarine and / or TMPyP4.

Citation Information

Patent Citations

  • Novel application of sanguinarine

    CN101564392A

  • Application of sanguinarine and derivatives thereof in preparation of medicine for preventing and treating multiple sclerosis

    CN115607549A

  • Application of G quadruplex ligand and entecavir combined drug in resisting HBV (Hepatitis B Virus) infection

    CN119564697A

  • Antigenic regions for detecting anti-toxoplasma gondii IgM antibodies

    CN120025419A

  • Methods for inhibiting microbe growth

    WO2020024060A1