Engineering bacterium for high-yield production of 2-halogenated acid dehalogenase as well as construction method and application of engineering bacterium
By overexpressing the 2-haloacid dehalogenase gene TvHAD1 in Escherichia coli or Pichia pastoris, and optimizing the fermentation and purification process, the problems of low enzyme expression and high cost were solved, and efficient preparation of 2-haloacid dehalogenase was achieved, which has important potential for environmental remediation applications.
Patent Information
- Application Number
- CN202610309602.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-13
- Publication Date
- 2026-05-01
AI Technical Summary
Existing methods for producing 2-haloacid dehalogenases suffer from problems such as low enzyme expression levels, complex separation and purification processes, and high costs.
The 2-haloacid dehalogenase gene TvHAD1 was overexpressed in Escherichia coli or Pichia pastoris, inserted into a specific multiple cloning site using a recombinant expression vector, and the fermentation conditions and purification methods were optimized. The product was then purified using nickel ion affinity chromatography.
It significantly improved the yield and activity of 2-haloacid dehalogenase, achieving efficient enzyme preparation, especially with an enzyme yield of 102.51 mg/L in Pichia pastoris, solving the problems of low expression and high cost in existing technologies.
Smart Images

Figure CN121950658A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to an engineered bacterium that produces high levels of 2-haloacid dehalogenase, its construction method, and its application. Background Technology
[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] 2-Haloacid dehalogenases (2-HADs) are a class of enzymes that catalyze the dehalogenation and hydrolysis of 2-haloacids to produce the corresponding 2-hydroxy acids. These include stereoselective L-2-haloacid dehalogenases (L-DEX) and D-2-haloacid dehalogenases (D-DEX), and the non-stereoselective DL-2-haloacid dehalogenase (DL-DEX). The stereoselectivity of 2-haloacid dehalogenases makes them highly favored in chemical synthesis. Highly stereoselective 2-haloacid dehalogenases allow for targeted regulation of the reaction extent through asymmetric catalytic selectivity, resulting in highly optically pure target products. For example, 2-haloacid dehalogenases can be used to produce small-molecule chiral hydroxy acids and haloacids; these small-molecule organic acids are often intermediates in the synthesis of pesticides, pharmaceuticals, and chemicals. In addition, 2-haloacid dehalogenases can be used in the field of environmental remediation to efficiently degrade pesticide intermediates such as 2-chloropropionic acid and 2,4-dichlorophenoxyacetic acid, as well as disinfection byproducts such as haloacetic acids (HAAs) in drinking water, thereby reducing their genotoxicity and carcinogenic risk.
[0004] Although various strategies have been used to obtain 2-haloacid dehalogenases from different sources, existing production methods suffer from problems such as low enzyme expression levels, complex separation and purification processes, and high costs. Summary of the Invention
[0005] To overcome the above problems, the present invention provides an engineered strain that produces high-yield 2-haloacid dehalogenase, its construction method, and its application.
[0006] To achieve the above technical objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides an engineered bacterium that produces high levels of 2-haloacid dehalogenase, which is generated by overexpressing the 2-haloacid dehalogenase gene in *Escherichia coli* or *Pichia pastoris*. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0007] In one or more embodiments, the engineered bacteria that produce high levels of 2-haloacid dehalogenase are those that overexpress the 2-haloacid dehalogenase gene in *Escherichia coli*. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0008] Preferably, overexpression of the 2-haloacid dehalogenase gene TvHAD1 The method involves using the 2-haloacid dehalogenase gene. TvHAD1 All or part of the nucleotide sequence is placed after the promoter in the exogenous expression plasmid for expression; More preferably, the 2-haloacid dehalogenase gene is overexpressed in Escherichia coli. TvHAD1 The methods include: Genes containing 2-halogenated acid dehalogenase TvHAD1 A fragment encoding the gene was introduced into the *E. coli*. The 2-halogen acid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pET-28a(+); The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pET-28a(+) was inserted into pET-28a(+). EcoR I and Sac Plasmid I was obtained by cutting the I restriction site.
[0009] In one or more embodiments, the engineered strain that produces high levels of 2-haloacid dehalogenase is a Pichia pastoris strain that overexpresses the 2-haloacid dehalogenase gene. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0010] Preferably, overexpression of the 2-haloacid dehalogenase gene TvHAD1 The method involves using the 2-haloacid dehalogenase gene. TvHAD1 All or part of the nucleotide sequence is placed after the promoter in the exogenous expression plasmid for expression; More preferably, the 2-haloacid dehalogenase gene is overexpressed in Pichia pastoris. TvHAD1 The methods include: Genes containing 2-halogenated acid dehalogenase TvHAD1 A fragment of the gene encoding the strain was introduced into the Pichia pastoris. The 2-halogen acid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pPIC9K; The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pPIC9K is inserted into pPIC9K. EcoR I and Not Plasmid II was obtained by cutting the I restriction site.
[0011] A second aspect of the present invention provides a method for constructing an engineered bacterium that produces high levels of 2-haloacid dehalogenase, comprising the following steps: Genes containing 2-halogenated acid dehalogenase TvHAD1 The coding gene was introduced into Escherichia coli or Pichia pastoris to obtain engineered bacteria that produce high levels of 2-haloacid dehalogenase. The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0012] In one or more embodiments, a gene containing 2-haloacid dehalogenase is used. TvHAD1 The coding gene was introduced into Escherichia coli to obtain engineered bacteria that produce high levels of 2-haloacid dehalogenase; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0013] Preferably, the 2-haloacid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pET-28a(+); The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pET-28a(+) was inserted into pET-28a(+). EcoR I and Sac Plasmid I was obtained by cutting the I restriction site.
[0014] In one or more embodiments, a gene containing 2-haloacid dehalogenase is used. TvHAD1 The coding gene was introduced into Pichia pastoris to obtain an engineered strain that produces high levels of 2-haloacid dehalogenase. The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0015] Preferably, the 2-haloacid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pPIC9K; The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pPIC9K is inserted into pPIC9K. EcoR I and Not Plasmid II was obtained by cutting the I restriction site.
[0016] A third aspect of the present invention provides the application of the engineered bacteria for high production of 2-haloacid dehalogenase as described in the first aspect or the engineered bacteria for high production of 2-haloacid dehalogenase constructed by the construction method described in the second aspect in the production of 2-haloacid dehalogenase.
[0017] A fourth aspect of the present invention provides a method for producing 2-haloacid dehalogenase, comprising the following steps: Engineered bacteria that produce high levels of 2-haloacid dehalogenase were inoculated into a fermentation medium and fermented to obtain 2-haloacid dehalogenase.
[0018] In one or more embodiments, when the starting strain of the engineered bacteria that produces high-yield 2-haloacid dehalogenase is Escherichia coli, the fermentation medium is LB medium.
[0019] Preferably, isopropyl thio-β-D-galactoside (IPTG) is added during fermentation for induction. Preferably, the concentration of IPTG is 0.5~1.5 mmol / L, and more preferably 1.0 mmol / L.
[0020] Preferably, Mg is added during fermentation. 2+ or Mn 2+ ;Mg 2+ The concentration is 0.5~1.5 mmol / L, preferably 1.0 mmol / L; Mn 2+ The concentration is 1.0~1.5 mmol / L, preferably 1.0 mmol / L.
[0021] In one or more embodiments, when the starting strain of the engineered bacteria that produces high-yield 2-haloacid dehalogenase is Pichia pastoris, the fermentation medium is BMGY medium.
[0022] Preferably, methanol is added during the fermentation process for induction, and preferably, the volume fraction of methanol is 0.5~1.0%, more preferably 1.0%.
[0023] Preferably, Co is added during the fermentation process. 2+ Co 2+The concentration is 0.5~1.5 mmol / L, preferably 1 mmol / L.
[0024] In one or more embodiments, the method for producing 2-haloacid dehalogenase further includes: collecting cell bodies after fermentation, crushing them to obtain crude enzyme solution, and purifying the crude enzyme solution to obtain 2-haloacid dehalogenase. Purification methods include: purification using nickel ion affinity chromatography (Ni-NTA).
[0025] Preferably, the specific method includes: The elution was performed in stages using imidazole PBS buffer at gradient concentrations. The eluent was collected in stages and concentrated by ultrafiltration to obtain 2-haloacid dehalogenase. The gradient concentrations were 250-500 mM.
[0026] The beneficial effects of this invention are as follows: This invention overexpresses the *Trichoderma viride* 2-haloacid dehalogenase gene TvHAD1 in *Escherichia coli* or *Pichia pastoris* to construct engineered strains of 2-haloacid dehalogenase, significantly improving the production capacity of 2-haloacid dehalogenase. On a shake-flask scale, the recombinant *Pichia pastoris* engineered strain produced an enzyme yield of 102.51 mg / L, and the recombinant *Escherichia coli* engineered strain produced an enzyme yield of 21.07 mg / L, achieving high production of 2-haloacid dehalogenase. Attached Figure Description
[0027] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0028] Figure 1 Electrophoresis diagrams for the validation of recombinant engineered bacterial genomic DNA, where A represents the validation result of Escherichia coli BL21 recombinant engineered bacteria and B represents the validation result of Pichia pastoris GS115 recombinant engineered bacteria; Figure 2 This is a map of plasmid I; Figure 3 This is a map of plasmid II; Figure 4 The effect of inducer concentration on enzyme production by engineered bacteria is shown in Figure 1. In Figure 2, A represents the effect of IPTG concentration on BL21-TvHAD1 engineered bacteria, and B represents the effect of methanol concentration on GS115-TvHAD1 engineered bacteria. Figure 5 The effects of metal ions on enzyme production by engineered bacteria are shown in Figure 1. A represents the effect on BL21-TvHAD1 engineered bacteria, and B represents the effect on GS115-TvHAD1 engineered bacteria. Figure 6SDS-PAGE analysis of the proteins expressed by engineered bacteria; where A is the expression product of BL21-TvHAD1 engineered bacteria and B is the expression product of GS115-TvHAD1 engineered bacteria, and the target band size is approximately 30.1 kDa. Figure 7 The comparison shows the enzyme production performance of engineered bacteria, where A represents the comparison of enzyme activity and B represents the comparison of enzyme yield. Figure 8 The effect of metal ions on the activity of purified TvHAD1 enzyme; Figure 9 Substrate specificity analysis for TvHAD1; Figure 10 The image shows the enzymatic kinetics curve of TvHAD1. Detailed Implementation
[0029] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0030] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.
[0031] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0032] Example 1 The cloned *Trichoderma viride* 2-haloacid dehalogenase gene TvHAD1 was optimized and synthesized according to the codon preferences of *Pichia pastoris* and *Escherichia coli*. TvHAD1 The amino acid sequence of the protein is shown in SEQ ID NO: 1, 2-Haloacid dehalogenase gene. TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2.
[0033] Genes containing 2-halogenated acid dehalogenase TvHAD1 The gene segment encoding pET-28a(+) was inserted into pET-28a(+). EcoR I and Sac Plasmid I was obtained by cutting the I restriction site. The constructed plasmid I was transformed into competent BL21 cells using chemical transformation and then plated on LB plates containing kanamycin (KanR) for screening.
[0034] The double enzyme digestion primer sequences are as follows: pET-28a (+) EcoR IF: CGCGGAATTCATGCCTTCAAAAACCTCACC (SEQ ID NO: 5).
[0035] pET-28a (+) SacI -R: CGCGGAGCTCTCACTCCAGTTCCCGCACCTT (SEQ ID NO: 6).
[0036] Genes containing 2-halogenated acid dehalogenase TvHAD1 The gene segment encoding pPIC9K is inserted into pPIC9K. EcoR I and Not Plasmid II was obtained by cutting the I restriction site. The linearized plasmid II was transformed into competent GS115 cells by electroporation, followed by initial screening on MD plates and resistance screening using high concentration of G418 to obtain multi-copy transformants.
[0037] The double enzyme digestion primer sequences are as follows: pPIC9K- EcoR IF: GGAGAATTCATGCCTTCAAAAACCTCACCC (SEQ ID NO: 3).
[0038] pPIC9K- Not IR: AGGCGGCCGCTCACTCCAGTTCCCGCAACTTC (SEQ ID NO: 4).
[0039] Agarose gel electrophoresis results showed that both the *E. coli* BL21 transformant and the *Pichia pastoris* GS115 transformant exhibited a specific band at approximately 804 bp, corresponding to the target gene. TvHAD1 The theoretical size is consistent ( Figure 1 Sequencing confirmed that the constructed recombinant plasmid sequence was completely correct, and positive recombinant engineered bacteria were successfully obtained, named BL21-TvHAD1 (originating strain: Escherichia coli BL21) and GS115-TvHAD1 (originating strain: Pichia pastoris GS115), respectively.
[0040] The maps of plasmid I and plasmid II are as follows: Figure 2 and Figure 3 As shown.
[0041] Example 2 Optimization of key fermentation conditions 2.1 Optimization of inducer concentration To determine the optimal induction conditions, the effect of inducer concentration on the enzyme production capacity of the two engineered strains was investigated. For the BL21-TvHAD1 engineered strain: cultured in LB medium until OD 600 When the bacterial growth rate reached approximately 0.6–0.8, IPTG was added at final concentrations of 0.5, 1.0, 1.5, and 2.0 mmol / L, respectively, and the cells were further induced and cultured at 16°C and 180 r / min for 20 h. After the culture was completed, the cells were collected by centrifugation at 4°C and 8000 r / min for 10 min, washed twice with 1×PBS buffer, and then sonicated on ice (360W power, 1.5 s operation time, 3 s interval, total duration 30 min). Cell debris was then removed by centrifugation at 4°C and 12000 r / min for 15 min. The resulting supernatant was the crude enzyme solution, which was used for enzyme activity assay.
[0042] For GS115-TvHAD1 engineered bacteria: culture in BMGY medium until OD 600 After reaching a temperature of 2.0–2.4, the culture medium was discarded by centrifugation, and the culture was transferred to fresh BMMY induction medium. Methanol was added to final concentrations of 0.5%, 1.0%, 1.5%, and 2.0% (v / v) for induction, respectively. Enzyme activity was monitored from day 4 to day 10 of induction. The relative enzyme activity of each group was calculated with the highest enzyme activity as 100%. After induction, the supernatant was collected by centrifugation to obtain the crude enzyme solution.
[0043] The results are as follows Figure 4 As shown: For the BL21-TvHAD1 engineered bacteria, the relative enzyme activity reached its maximum when the IPTG concentration was 1.0 mmol / L. Figure 4 (A); For the GS115-TvHAD1 engineered bacteria, an induction concentration of 1.0% (v / v) methanol yields the best enzyme production effect. Figure 4 (See section B). Therefore, the optimal inducer concentrations of 1.0 mmol / L IPTG and 1.0% methanol were determined for the prokaryotic and eukaryotic expression systems, respectively, for subsequent fermentation experiments.
[0044] 2.2 Optimization of Metal Ion Species Different metal ions (Ca) were added to the basal fermentation medium at final concentrations ranging from 0.1 to 2.0 mmol / L. 2+ Mg 2+ Co 2+ or Mn 2+ The effect of this study on the enzyme production capacity of two recombinant engineered bacteria was investigated. The relative enzyme activity of each experimental group was calculated with the enzyme activity of the fermentation group without added metal ions as 100%.
[0045] The results are as follows Figure 5As shown, the effects of metal ions on enzyme production vary significantly. For the BL21-TvHAD1 engineered bacteria, low concentrations of Mg... 2+ (0.5 mmol / L) and Mn 2+ (1.0 mmol / L) can effectively promote enzyme production, of which Mn 2+ The promoting effect of Ca was more significant; while Ca 2+ It exhibits a significant inhibitory effect. Figure 5 (A). For GS115-TvHAD1 engineered bacteria, 1.0 mmol / L Co 2+ It can significantly increase enzyme production by about 20%, while Ca 2+ and Mg 2+ Then inhibit enzyme production ( Figure 5 (B). This result provides a crucial basis for designing and optimizing culture media for different engineered bacteria.
[0046] Example 3 Purification of 2-haloacid dehalogenase: The engineered strains BL21-TvHAD1 and GS115-TvHAD1 were cultured under the optimized conditions determined in Example 2. After fermentation, the cells were collected, lysed, and crude enzyme solution was obtained. The His-tagged fusion protein in the crude enzyme solution was purified using nickel-NTA chromatography. The purification buffers included: buffer A (50 mM PBS, pH 7.4) and buffer B (50 mM PBS containing 500 mM imidazole, pH 7.4). Imidazole-PBS buffers of varying concentrations were prepared using buffer A and buffer B. Ni... After packing the NTA resin column, equilibrate it with 5 column volumes of low-concentration imidazole buffer (20-50 mM). Then, load the crude enzyme solution onto the column at a flow rate of approximately 1 mL / min. Next, wash with 5-10 column volumes of 50 mM imidazole buffer to remove non-specifically adsorbed proteins. Finally, perform a phased elution using an elution buffer containing 250-500 mM imidazole and collect the eluent. The eluent contains the purified protein. However, because the buffer contains salts and imidazole, which can affect subsequent enzymatic experiments, the collected eluent is concentrated by centrifugation using an ultrafiltration centrifuge tube capable of retaining proteins with a molecular weight cutoff of 30 kDa to remove imidazole and salts. The fraction retained in the tube is high-purity TvHAD1 protein.
[0047] The purified protein sample was subjected to SDS-PAGE. PAGE analysis was used to confirm the purity and molecular weight. The Bradford method was used to determine protein concentration, calculate protein yield per unit fermentation volume, and compare the catalytic activity of the crude enzyme solutions from the two recombinant engineered bacteria.
[0048] SDS-PAGE analysis showed that the purified protein sample exhibited a single, clear band at approximately 30.1 kDa, consistent with the theoretical molecular weight of TvHAD1, indicating that high-purity target protein was obtained. Figure 6 Comparative analysis of yield and enzyme activity showed that the GS115-TvHAD1 engineered strain exhibited significant advantages: its enzyme protein yield reached 102.51 mg / L, which is 4.9 times that of the BL21-TvHAD1 engineered strain (21.07 mg / L); its crude enzyme solution activity was also approximately 4.6 times higher than that of the prokaryotic system. Figure 7 This demonstrates that the Pichia pastoris eukaryotic expression system has higher expression efficiency in this study.
[0049] Example 4 Effects of metal ions on the activity of the pure enzyme TvHAD1 The purified TvHAD1 enzyme solution was mixed with different types and concentrations (0.5-2.5 mmol / L) of metal ions (K+). + Mg 2+ Ca 2+ Fe 2+ Cu 2+ Zn 2+ The enzymes were incubated together with 2-chloropropionic acid as a substrate, and the residual activity of the enzymes was determined in a standard reaction system. The enzyme activity of the reaction system without the addition of metal ions was taken as 100%, and the relative enzyme activity was calculated.
[0050] The results are as follows Figure 8 As shown: K + It has a slight activating effect on enzyme activity, with the highest increase of approximately 15.8% at 2.0 mmol / L; Mg 2+ Ca 2+ and Fe 2+ It exhibits a concentration-dependent inhibitory effect; Cu 2+ and Zn 2+ The effect was not significant at low concentrations, but at high concentrations (≥2.0 mmol / L) of Cu... 2+ It significantly inhibits enzyme activity. This result elucidates the regulatory mechanism of TvHAD1 enzyme activity, suggesting that the presence of inhibitory ions should be avoided in practical applications.
[0051] Example 5: Substrate specificity and enzyme kinetics analysis 5.1 Substrate Specificity Analysis To clarify the catalytic properties of TvHAD1, substrate-specificity analysis was performed. Several typical halogenated pollutants were selected as substrates, including 2-chloropropionic acid, 2,4-dichlorophenoxyacetic acid, chloroacetic acid, 2-chlorobutyric acid, 2,2-dichloropropionic acid, and 4-chlorobutyric acid. The catalytic activity of the purified enzyme for each substrate was measured under the same reaction conditions to evaluate its substrate profile and application potential. Among these, 2-chloropropionic acid and 2,4-dichlorophenoxyacetic acid are common pesticide-related pollutants in the environment.
[0052] The results are as follows Figure 9 As shown, TvHAD1 exhibited the highest degradation activity for 2-chloropropionic acid, with its enzyme activity set at 100%. Its activity for 2,4-dichlorophenoxyacetic acid was approximately 67.2% of that for 2-chloropropionic acid, and its activity for chloroacetic acid was approximately 22.1% of that for 2-chloropropionic acid. However, its activity for substrates such as 2-chlorobutyric acid, 2,2-dichloropropionic acid, and 4-chlorobutyric acid was all below 3%, indicating virtually no catalytic activity. These results demonstrate that TvHAD1 exhibits a significant catalytic preference for short-chain monohalogenated acids, particularly demonstrating highly efficient degradation capabilities for common environmental pollutants such as 2-chloropropionic acid.
[0053] TvHAD1 exhibited the highest degradation activity for 2-chloropropionic acid, approximately 67.2% activity for 2,4-dichlorophenoxyacetic acid, and 21.1% activity for chloroacetic acid. Its activity for other tested substrates was weak or nonexistent. This indicates that TvHAD1 has a high catalytic preference for short-chain monohalogenated acids.
[0054] 5.2 Enzyme kinetics determination Enzyme kinetics were determined using 2-chloropropionic acid and 2,4-dichlorophenoxyacetic acid as substrates at a series of concentration gradients (0.1–10 mM). The total reaction volume was 1.5 mL. The reaction was initiated at 30 °C and terminated after 3 min using a highly acidic working solution containing mercury ions. After standing for 10 min to allow the color to stabilize, the absorbance was measured at 460 nm, and the Cl₂ produced was calculated based on the chloride ion standard curve. - The concentration was then used to obtain the initial reaction rate (V0). Finally, the Michaelis equation V0 = (V0 - V0) was applied, with substrate concentration (S) as the x-axis and V0 as the y-axis. max ×S) / (K m +S) was used for nonlinear regression fitting to calculate the maximum reaction rate (V) of the enzyme to the two substrates. max ) and Michaelis constant (K m ).
[0055] Enzyme kinetic results ( Figure 10 Further, the catalytic properties of TvHAD1 for different substrates were revealed: for 2-chloropropionic acid, its maximum reaction rate V max It is 1760 mmol·L -1min -1 Michaelis constant K m It is 0.102 mmol; for 2,4-dichlorophenoxyacetic acid, its V max It is 1593 mmol·L -1 min -1, Km is 0.085 mmol. V max This reflects the enzyme's catalytic ability under substrate saturation, indicating that TvHAD1 has a higher overall conversion efficiency for 2-chloropropionic acid. m The value reflects the affinity between the enzyme and the substrate; the smaller the value, the stronger the affinity. Although the value of 2,4-dichlorophenoxyacetic acid is slightly lower, indicating a slightly stronger affinity for the enzyme, the Va value of 2-chloropropionic acid is lower. max The significantly higher efficiency indicates a superior catalytic efficiency. This result further confirms the high catalytic potential of TvHAD1 in degrading typical halogenated pollutants in the environment, especially its excellent enzymatic performance towards short-chain monohalogenated acids such as 2-chloropropionic acid.
[0056] This invention overexpresses the *Trichoderma viride* 2-haloacid dehalogenase gene TvHAD1 in *Escherichia coli* or *Pichia pastoris* to construct an engineered strain of 2-haloacid dehalogenase. Through synergistic optimization of induction conditions and fermentation processes involving metal ions, a high-yield engineered strain of 2-haloacid dehalogenase was obtained, achieving efficient heterologous expression and large-scale preparation of this enzyme. This technology significantly improves the yield and activity of 2-haloacid dehalogenase, providing a stable and efficient enzyme source for the efficient biodegradation of typical halogenated pollutants such as 2-chloropropionic acid in the environment, and has significant potential for environmental remediation applications.
[0057] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An engineered bacterium that produces high levels of 2-haloacid dehalogenase, characterized in that, It involves overexpressing the 2-haloacid dehalogenase gene in Escherichia coli or Pichia pastoris. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO:
2.
2. The engineered bacteria for high production of 2-haloacid dehalogenase as described in claim 1, characterized in that, The engineered bacteria that produces high levels of 2-haloacid dehalogenase is formed by overexpressing the 2-haloacid dehalogenase gene in *Escherichia coli*. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2; Preferably, overexpression of the 2-haloacid dehalogenase gene TvHAD1 The method involves using the 2-haloacid dehalogenase gene. TvHAD1 All or part of the nucleotide sequence is placed after the promoter in the exogenous expression plasmid for expression; More preferably, the 2-haloacid dehalogenase gene is overexpressed in Escherichia coli. TvHAD1 The methods include: Genes containing 2-halogenated acid dehalogenase TvHAD1 A fragment encoding the gene was introduced into the *E. coli*. The 2-halogen acid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pET-28a(+); The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pET-28a(+) was inserted into pET-28a(+). EcoR I and Sac Plasmid I was obtained by cutting the I restriction site.
3. The engineered strain for high production of 2-haloacid dehalogenase as described in claim 1, characterized in that, The engineered strain that produces high levels of 2-haloacid dehalogenase is Pichia pastoris with overexpression of the 2-haloacid dehalogenase gene. TvHAD1 ; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2; Preferably, overexpression of the 2-haloacid dehalogenase gene TvHAD1 The method involves using the 2-haloacid dehalogenase gene. TvHAD1 All or part of the nucleotide sequence is placed after the promoter in the exogenous expression plasmid for expression; More preferably, the 2-haloacid dehalogenase gene is overexpressed in Pichia pastoris. TvHAD1 The methods include: Genes containing 2-halogenated acid dehalogenase TvHAD1 A fragment of the gene encoding the strain was introduced into the Pichia pastoris. The 2-halogen acid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pPIC9K; The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pPIC9K is inserted into pPIC9K. EcoR I and Not Plasmid II was obtained by cutting the I restriction site.
4. The method for constructing the engineered bacteria with high production of 2-haloacid dehalogenase as described in any one of claims 1 to 3, characterized in that, Includes the following steps: Genes containing 2-halogenated acid dehalogenase TvHAD1 The coding gene was introduced into Escherichia coli or Pichia pastoris to obtain engineered bacteria that produce high levels of 2-haloacid dehalogenase. The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO:
2.
5. The construction method as described in claim 4, characterized in that, Genes containing 2-halogenated acid dehalogenase TvHAD1 The coding gene was introduced into Escherichia coli to obtain engineered bacteria that produce high levels of 2-haloacid dehalogenase; The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2; Preferably, the 2-haloacid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pET-28a(+); The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pET-28a(+) was inserted into pET-28a(+). EcoR I and Sac Plasmid I was obtained by cutting the I restriction site.
6. The construction method as described in claim 4, characterized in that, Genes containing 2-halogenated acid dehalogenase TvHAD1 The coding gene was introduced into Pichia pastoris to obtain an engineered strain that produces high levels of 2-haloacid dehalogenase. The 2-halogen acid dehalogenase gene TvHAD1 The nucleotide sequence is shown in SEQ ID NO: 2; Preferably, the 2-haloacid dehalogenase gene TvHAD1 The gene fragment encoding the gene was introduced via a recombinant expression vector; The recombinant expression vector is specifically obtained by inserting the fragment between multiple cloning sites of pPIC9K; The specific method for constructing the recombinant expression vector includes: inserting a gene containing a 2-haloacid dehalogenase. TvHAD1 The gene segment encoding pPIC9K is inserted into pPIC9K. EcoR I and Not Plasmid II was obtained by cutting the I restriction site.
7. The use of the engineered bacteria that produce high-yield 2-haloacid dehalogenase according to any one of claims 1 to 3 or the engineered bacteria that produce high-yield 2-haloacid dehalogenase constructed by the construction method according to any one of claims 4 to 6 in the production of 2-haloacid dehalogenase.
8. A method for producing 2-haloacid dehalogenase, characterized in that, Includes the following steps: The engineered bacteria that produce high-yield 2-haloacid dehalogenase according to any one of claims 1 to 3 or the engineered bacteria that produce high-yield 2-haloacid dehalogenase according to the construction method according to any one of claims 4 to 6 are inoculated into a fermentation medium and fermented to obtain 2-haloacid dehalogenase.
9. The method for producing 2-haloacid dehalogenase as described in claim 8, characterized in that, When the starting strain of the engineered bacteria that produces high-yield 2-haloacid dehalogenase is Escherichia coli, the fermentation medium is LB medium. Preferably, isopropyl thio-β-D-galactopyranoside (IPTG) is added during fermentation for induction. Preferably, the concentration of IPTG is 0.5~1.5 mmol / L, and more preferably 1.0 mmol / L. Preferably, Mg is added during fermentation. 2+ or Mn 2+ ;Mg 2+ The concentration of Mn is 0.5~1.5 mmol / L, preferably 1.0 mmol / L; 2+ The concentration is 1.0~1.5 mmol / L, preferably 1.0 mmol / L; Alternatively, when the starting strain of the engineered bacteria that produces high-yield 2-haloacid dehalogenase is Pichia pastoris, the fermentation medium is BMGY medium. Preferably, methanol is added during fermentation for induction; preferably, the volume fraction of methanol is 0.5-1.0%, and more preferably 1.0%. Preferably, Co is added during the fermentation process. 2+ Co 2+ The concentration is 0.5~1.5 mmol / L, preferably 1 mmol / L.
10. The method for producing 2-haloacid dehalogenase as described in claim 8, characterized in that, The method for producing 2-haloacid dehalogenase further includes: collecting the cell bodies after fermentation, crushing them to obtain crude enzyme solution, and purifying the crude enzyme solution to obtain 2-haloacid dehalogenase. Purification methods include: purification using nickel ion affinity chromatography (Ni-NTA).