Biomarker for diagnosing pulmonary fibrosis and application thereof

Abstract

The invention discloses a biomarker for diagnosing pulmonary fibrosis and application thereof, and belongs to the technical field of clinical medicine. The pulmonary fibrosis biomarker lncRNA DLEU2 provided by the invention can effectively assist in diagnosing patients with pulmonary fibrosis, and activation of human lung fibroblasts can be effectively inhibited in the human lung fibroblasts through a knock-down agent sh-DLEU2.

Description

Technical Field

[0001] This invention relates to the field of clinical medical technology, specifically to a diagnostic biomarker for pulmonary fibrosis and its application. Background Technology

[0002] Long non-coding RNAs (lncRNAs) are non-coding RNAs longer than 200 nucleotides with relatively low protein-coding capabilities. Studies have shown that the number and types of lncRNAs far exceed those of protein-coding mRNAs; however, the number of lncRNAs with clearly defined biological functions is currently very limited. At present, increasing evidence suggests that lncRNAs play important roles in a variety of biological processes. Serum biomarkers are readily available, inexpensive, and reproducible markers. Current techniques indicate that using lncRNAs as molecular biomarkers is more effective than traditional protein-specific molecular markers.

[0003] Pulmonary fibrosis is a common respiratory complication, and its incidence and mortality rates have been rising in recent years. Therefore, early detection and treatment of this disease are of great significance for improving patient survival rates. Summary of the Invention

[0004] This invention proposes a biomarker for diagnosing pulmonary fibrosis and its application, and provides a drug that can effectively reduce pulmonary fibrosis.

[0005] To achieve the above objectives, the present invention is implemented through the following technical solution: The first objective of this invention is to provide a biomarker for preparing diagnostic products for pulmonary fibrosis, said biomarker being lncRNA DLEU2, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] Furthermore, the product includes testing reagents or diagnostic reagents, as well as kits containing testing reagents and diagnostic kits containing diagnostic reagents.

[0007] Based on a general inventive concept, a second objective of this invention is to provide a method for in vitro detection of the biomarker lncRNA DLEU2, for non-diagnostic purposes, using a reagent capable of specifically detecting lncRNA DLEU2, said reagent detecting the expression level of DLEU2 in biological samples from a subject. The nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.1.

[0008] Furthermore, the reagent capable of specifically detecting lncRNA DLEU2 includes PCR primers for detecting lncRNA DLEU2 expression; the primers include an upstream primer and a downstream primer, and the primer sequences are as follows: The upstream primer is: AGATGGAGTCTCGCTCTGTCACC, as shown in SEQ ID NO.2; The downstream primer is: GAGGCAGGAGAATGGCGTGAAC, as shown in SEQ ID NO.3.

[0009] Furthermore, the biological samples from the subjects are selected from peripheral blood, tissue samples, and exosomes.

[0010] Based on a general inventive concept, a third objective of this invention is the use of a lncRNA DLEU2 knockdown agent in the preparation of a pulmonary fibrosis treatment drug, wherein the nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.1.

[0011] Furthermore, the lncRNA DLEU2 knockdown agent is sh-DLEU2.

[0012] Based on a general inventive concept, a fourth objective of this invention is to provide the application of the lncRNA DLEU2 knockdown agent sh-DLEU2 in the preparation of a lung fibroblast activation inhibitor, wherein the nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.1.

[0013] The present invention relates to biomarkers for diagnosing pulmonary fibrosis and their applications. The beneficial effects are as follows: the pulmonary fibrosis biomarkers provided by the present invention can effectively assist in the diagnosis of patients with pulmonary fibrosis, and the present invention also found that the activation of pulmonary fibroblasts can be effectively inhibited by the knockdown agent sh-DLEU2 in pulmonary fibroblasts. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0015] Figure 1This diagram illustrates the screening of the candidate lncRNA molecule DLEU2 and the results of differential expression detection of DLEU2 in in vitro and in vivo experiments. A is a volcano plot showing the differential expression of lncRNA molecules between different groups (IPF / Control) in the IPF datasets GSE21369 and GSE24206. B is a Venn diagram showing the intersection of upregulated lncRNA molecules in the two datasets. C shows further detection of molecular expression in cells after TGF-β1-induced pulmonary fibrosis, revealing a significant increase in DLEU2, while CARMN showed no statistical significance. D shows the differential expression analysis of DLEU2 in lung tissues of controls and IPF patients in datasets GSE21369 and GSE24206. E shows the differential expression analysis of DLEU2 in lung tissues of controls and IPF patients with different FVC grades in dataset GSE21369. In the GSE21369 dataset, the Spearman method was used to analyze the correlation between DLEU2 expression and FVC grade in IPF patients. F shows the difference in DLEU2 expression in the lungs of controls, early-stage IPF, and late-stage IPF patients in dataset GSE24206. In the GSE24206 dataset, the Pearson method was used to analyze the correlation between DLEU2 expression and the severity of IPF. G shows the ROC curve analysis of the diagnostic efficacy of DLEU2 expression for IPF in datasets GSE21369 and GSE24206. H shows the validation of DLEU2 upregulation in IPF patients using the external dataset GSE32537, validating DLEU2 upregulation in IPF at the mRNA level, and the ROC curve analysis of its diagnostic effect on IPF. I includes 6 healthy individuals, 6 patients with community-acquired pneumonia, and 6 patients with IPF; peripheral blood RNA was extracted, and DLEU2 expression levels were detected using RT-qPCR. J shows the DLEU2 expression level detected using RT-qPCR in the lung tissue of mice injected intratracheally with 5 mg / kg BLM.

[0016] Figure 2This diagram illustrates the effects of DLEU2 knockdown on the inhibition of lung fibroblast differentiation, migration, and the expression of pro-fibrotic factors. A shows the DLEU2 expression level in NIH-3T3 cells detected by RT-qPCR. B validates the effect of DLEU2 knockdown after constructing stable lentiviral transfectants using sh-DLEU2-1 and sh-DLEU2-2. C shows the effect of DLEU2 overexpression in NIH-3T3 cells using the LV5 vector, detected by RT-qPCR. D shows the mRNA expression levels of col1a1 and fn1 detected by RT-qPCR. E shows the expression of CTGF and PDGF in the culture supernatant of NIH-3T3 cells detected by ELISA. F shows the protein expression level of α-SMA detected by Western blotting. G shows the protein expression level of Collagen I detected by Western blotting. H shows the protein expression level of Fibronectin 1 detected by Western blotting. I shows the fluorescence intensity of α-SMA in the cytoplasm detected by IF assay. J represents the cell scratch assay used to detect the migration of TGF-β1-treated cells at 0 h and 24 h. K represents the number of NIH-3T3 cells that passed through the wells as detected by Transwell assay. *P < 0.05, ***P < 0.001.

[0017] Figure 3 This diagram illustrates how DLEU2 knockdown inhibits pulmonary fibrosis in mice. A shows mouse lung tissue collected after intratracheal instillation of lentivirus sh-DLEU2-1, with RT-qPCR used to verify the DLEU2 knockdown effect. B shows the Ashcroft score used to assess the degree of pulmonary fibrosis in mice. C shows the hydroxyproline content in mouse lung tissue. E shows the correlation analysis between hydroxyproline and DLEU2 expression in mouse lung tissue. D shows the assessment of collagen deposition in mouse lung tissue pathological sections after HE and Masson staining. F shows the effect of DLEU2 knockdown on BLM-induced collagen expression in mouse lung tissue, with RT-qPCR used to detect the mRNA expression levels of col1a1 and fn1. G is a bar chart showing the expression levels of α-SMA, Collagen I, and Fibronectin 1 detected by Western blotting. H is a band diagram showing the expression levels of α-SMA, Collagen I, and Fibronectin 1 detected by Western blotting. I represents the expression of α-SMA and Collagen I in BLM-induced pulmonary fibrosis in mice after DLEU2 knockdown, detected by IHC. J represents the expression of CTGF and PDGF, detected by ELISA. **P < 0.01, ***P < 0.001. Detailed Implementation

[0018] The present invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0019] This invention discloses a biomarker for preparing diagnostic products for pulmonary fibrosis, wherein the biomarker is lncRNA DLEU2, and its nucleotide sequence is shown in SEQ ID NO.1.

[0020] This invention discloses a method for in vitro detection of the biomarker lncRNA DLEU2, for non-diagnostic purposes, using a reagent capable of specifically detecting lncRNA DLEU2, which detects the expression level of DLEU2 in biological samples from a subject.

[0021] This invention also provides the application of the lncRNA DLEU2 knockdown agent sh-DLEU2 in the preparation of a drug for treating pulmonary fibrosis.

[0022] This invention also provides the application of lncRNA DLEU2 knockdown agents sh-DLEU2-1 and sh-DLEU2-2 in the preparation of lung fibroblast activation inhibitors.

[0023] Example 1

[0024] The screening of the biomarker lncRNA DLEU2 was conducted using bioinformatics analysis, specifically as follows: (1) Data download The expression profile datasets GSE21369, GSE24206, and GSE32538 of IPF patients were downloaded from the GEO database using the R package GEOquery. The samples in the datasets were all from human lung tissue. The GSE21369 dataset contains gene expression profiles of lung tissue from ILD patients and adjacent normal lung tissue from lung cancer patients, totaling 29 samples: lung tissue from 11 IPF patients, 5 non-specific interstitial pneumonia (NSIP) patients, 2 respiratory bronchiolitis-interstitial lung disease (RB-ILD) patients, 2 hypersensitivity pneumonitis (HP) patients, 2 cryptogenic organizing pneumonia (COP) patients, and 1 unclassifiable idiopathic interstitial pneumonia (UF) patient. Five adjacent normal lung tissue samples and one normal lung tissue sample from a lung transplant patient served as normal controls. The GSE24206 dataset contains gene expression profiles of fresh frozen lung tissue from IPF patients and healthy controls, totaling 23 samples: lung tissue from 17 IPF patients and 6 healthy controls. Among the 17 IPF patients, 8 had early-stage IPF and 9 had late-stage IPF. The GSE32538 dataset contains gene expression profiles of lung tissue from ILD patients and healthy controls, totaling 199 samples: 106 IPF patients, 14 RB-ILD patients, 14 NSIP patients, 10 UF patients, 2 COP patients, and 3 desquamative interstitial pneumonia (DIP) patients, with 50 healthy controls. For the GSE21369 and GSE32538 datasets, only gene expression profiles from IPF patients and healthy controls were used for subsequent analysis.

[0025] (2) Differential expression analysis and ncRNA screening in IPF dataset: target lncRNA molecules were screened in GSE21369 and GSE24206 datasets, and target miRNA molecules were screened in GSE32538 dataset.

[0026] (3) Assess the correlation between the expression of the target molecule DLEU2 and the severity of IPF.

[0027] (4) Further validate the expression of DLEU2 in IPF using an external dataset.

[0028] The results are as follows Figure 1 As shown in AH: First, two molecules, DLEU2 and CARMN, were screened from the GSE21369 and GSE24206 datasets. Further validation of these initially screened molecules in the datasets revealed that their expression in the lung tissue of IPF patients was indeed increased compared to normal individuals. In the GSE21369 dataset, higher DLEU2 expression levels in the lung tissue of IPF patients were associated with poorer forced vital capacity (FVC). In the GSE24206 dataset, DLEU2 expression levels in lung tissue were positively correlated with the severity of IPF. Analysis of the GSE21369 and GSE24206 datasets and ROC curve plotting showed that DLEU2 expression has good efficacy in diagnosing IPF. Further validation using the external dataset GSE32537 revealed that DLEU2 is an upregulated gene. ROC curve analysis of DLEU2 expression upregulation in IPF at the mRNA level and its diagnostic efficacy for IPF were also performed.

[0029] Example 2 The detection of DLEU2 expression in human peripheral blood and in vitro / in vivo experiments includes the following steps: (1) Peripheral blood was collected from 6 healthy individuals, 6 patients with community-acquired pneumonia (CAP), and 6 patients with pulmonary fibrosis (IPF). 3-5 ml of peripheral blood was collected, and 3 times the volume of erythrocyte lysis buffer was added. The mixture was gently vortexed or inverted to mix, and placed on ice for 15 min, during which time it was gently vortexed twice. The mixture was centrifuged at 450g at 4℃ for 10 min to precipitate leukocytes. The supernatant was carefully aspirated, and 2 times the volume of erythrocyte lysis buffer was added to the leukocyte pellet. The leukocytes were gently vortexed to resuspend them, and the mixture was centrifuged at 450g at 4℃ for 10 min to precipitate leukocytes. The supernatant was carefully and thoroughly aspirated, and the cell pellet was collected.

[0030] (2) To detect the expression of DLEU2 in activated fibroblast NIH-3T3 cells, the cells were divided into a control group and a group treated with 10 ng / ml TGF-β1 for 72 hours; (3) To detect DLEU2 expression in bleomycin-induced pulmonary fibrosis in mice, animals were divided into three groups: a 7-day saline group, a 28-day saline group, a 7-day bleomycin (BLM) group, and a 28-day BLM group. Bleomycin and saline were administered via intratracheal infusion, with a total volume of 50 μL for both groups. The dose of bleomycin was 5 mg / kg. (4) Add 1 ml of Trizol to the obtained peripheral blood cell pellet, NIH-3T3 cells and mouse lung tissue, let stand for 5 min, add 200 μl of chloroform, mix well and let stand for 2-3 min, then place the centrifuge tube in a centrifuge and centrifuge at 12000 rpm for 15 min. (5) After centrifugation, transfer the upper aqueous phase to a new RNase-free centrifuge tube, add an equal volume of isopropanol and mix well, then let stand for 10 min. (6) Place the centrifuge tube in a centrifuge for centrifugation. After centrifugation, retain the precipitate. (7) Add 70% ethanol prepared with pre-cooled DEPC water, centrifuge, discard the supernatant, dry at room temperature for 5-10 min, add DEPC water to obtain total RNA for each group.

[0031] (8) Prepare the gDNA removal reaction system according to the reverse transcription kit. Composition: 2 μL of 5×g DNA Buffer, 1 μg of total RNA obtained in step (7), and 1 μL of gDNA Eraser were added to the total volume of 10 μL using RNase-Free ddH2O. The mixture was stirred at 42℃ for 2 min to obtain the reaction solution, which was stored on ice. The total RNA of each group was prepared separately for healthy individuals, patients with pneumonia (CAP), and patients with pulmonary fibrosis (IPF). (9) Prepare the reverse transcription reaction system according to the reverse transcription kit. Composition: Amount used: PrimeScript RT Enzyme Mix I 1 μL, RT primer Mix 1 μL, 5×PrimeScript Buffer 2 4 μL, enzyme-free water 4 μL, reaction solution of step (8) 10 μL; All components are mixed and reacted at 37℃ for 15 min, and reacted at 85℃ for 5 s to obtain the reaction system. The reaction system is placed on ice for later use. (10) Design and synthesize primers for DLEU2. The nucleotide sequence of DLEU2 (SEQ ID NO.1, human) is as follows: The primer sequences for DLEU2 are as follows: The upstream primer SEQ ID NO.2 is: AGATGGAGTCTCGCTCTGTCACC; The downstream primer SEQ ID NO.3 is: GAGGCAGGAGAATGGCGTGAAC; Primers for DLEU2 (mouse-derived) were designed and synthesized. The nucleotide sequence of DLEU2 (mouse-derived) (SEQ ID NO.4, mouse-derived) is as follows: The primer sequences for DLEU2 (mouse-derived) are as follows: The upstream primer SEQ ID NO.7 is: TCTCATTGGAAGGCTCCTC; The downstream primer SEQ ID NO.8 is: GCTGGAACTTTAACGGGAA; (11) The primers used for quantitative real-time PCR to test DLEU2 expression are as follows: Prepare the following reaction solution for real-time PCR: TB Green Premix Ex Taq II 10 μl, PCR upstream primer 0.8 μl, PCR downstream primer 0.8 μl, ROX Reference Dye 0.4 μl, cDNA 2 μl, ddH2O 6 μl, total volume 20 μl; The PCR amplification program settings are as follows: Pre-denaturation was performed at 95℃ for 30 seconds; followed by 40 cycles (each cycle consisting of 95℃ for 5 seconds, 60℃ for 30 seconds, and 72℃ for 30 seconds). Melting curves were automatically plotted after amplification to verify the specificity of the amplified products. All samples were performed in triplicate, and normalization analysis was performed using GAPDH as an internal control gene. (12) Using GAPDH as an internal reference, adopting The relative expression levels of genes were calculated using the method described above. A bar chart was generated using GraphPadprism 9.0, and statistical analysis was performed. The results are shown below. Figure 1 As shown in Figure I.

[0032] Experimental results are as follows Figure 1 As shown in Figure 1, the expression of DLEU2 in the peripheral blood of IPF patients was upregulated compared to healthy individuals, indicating that DLEU2 expression is elevated in pulmonary fibrosis. DLEU2 expression was also increased in activated fibroblasts or mouse pulmonary fibrosis lung tissue, as shown in Figure 1C and 1D. Figure 1 As shown in J.

[0033] Example 3 Detecting the effects of DLEU2 knockdown and overexpression on lung fibroblast activation In this embodiment, DLEU2 is mouse-derived DLEU2, which is the nucleotide sequence of DLEU2 (mouse-derived) (SEQ ID NO.4). The nucleotide sequence of the DLEU2 knockdown agent sh-DLEU2-1, as shown in SEQ ID NO.5, is: GTTGGAGGTCTCTGTAATAA; The nucleotide sequence of the DLEU2 knockdown agent sh-DLEU2-2 is listed in SEQ ID NO.6 as: CCATTAAAGATGCTGATAAAT.

[0034] The nucleotide sequence of the DLEU2 knockdown agent sh-DLEU2-3 is listed in SEQ ID NO.9 as: GAGAACTGTTGTGTGATTAAT.

[0035] 3.1 Lentiviral infection of cells and screening of stable transfected strains 3.1.1 Preliminary Experiment of Target Cell Infection (1) Plating: During the infection pre-experiment, cells were divided into control group, 10 MOI group, 30 MOI group, 50 MOI group, 80 MOI group, and 100 MOI group, and seeded with 3 x 10⁶ cells per cell. 3 NIH-3T3 cells were cultured in 96-well plates with 3 replicates per group. After 24 hours of culture with 100 μl of complete culture medium, the cell count was twice the initial count (6 x 10⁶ cells / well). 3 indivual; (2) Infection: Change the medium for the cells before infection and add 90 μl of culture medium; calculate the required volume of virus to be added based on the virus titer and MOI value; Virus volume = number of cells × MOI / virus titer, 3 replicates per group; (3) Continue culturing: Continue culturing in an incubator, observe the growth and fluorescence expression of cells under a microscope every day, and change the medium as needed to maintain cell viability; (4) Confirmation of infection effect: 72 hours after infection, the abundance of fluorescence expression was observed by fluorescence microscopy. Under the condition of 50 MOI, the infection efficiency of the virus was about 80%, and the cells grew well. Therefore, this was used as the subsequent infection condition.

[0036] 3.1.2 Screening of effective lentiviruses: Lentiviral groups were divided into a blank control group, a DLEU2 overexpression lentivirus group (LV5-DLEU2), an overexpression negative control group (LV5-NC), an interference negative control group (sh-NC), and shRNA-interfered DLEU2 expression lentivirus groups (sh-DLEU2-1, sh-DLEU2-2, sh-DLEU2-3). The detection time was 72 hours. RT-qPCR detection of DLEU2 expression revealed the two lentiviruses with the best interference effect: sh-DLEU2-1 and sh-DLEU2-2. Figure 2 A), and RT-qPCR was also used to detect the overexpression effect of DLEU2 ( Figure 2 C).

[0037] 3.1.3 Screening for the minimum lethal concentration of puromycin (1) Cell plating: Prepare a single-cell suspension of NIH-3T3 cells and plate the cells at a density of 3 x 10⁻⁶ cells / cells. 3 Cells were seeded in 24-well plates and cultured for 24 hours. (2) Add puromycin: Add puromycin and continue culturing, with final concentrations of 0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, and 10.0 μg / ml. Maintain the puromycin concentration, change the medium every other day, and observe continuously for 4 days. Select the lowest puromycin concentration that can completely kill the cells as 3.0 μg / ml.

[0038] 3.1.4 Screening of stable mutant strains (1) Based on the lowest puromycin concentration screened above, reduce the drug concentration to 1 / 2-1 / 4 of the previous concentration, and continue to screen and amplify infected cells; (2) Cell preservation and retesting: During the amplification process, cells were continuously cryopreserved to ensure that at least 6 vials of each cell line were cryopreserved. After 2-3 vials were cryopreserved, one vial was taken out for thawing to determine the cell growth status, and RT-qPCR was performed again to verify the expression of DLEU2 to confirm the knockdown (Figure 2B) and overexpression effects.

[0039] 3.2 Detection of DLEU2-shRNA and its overexpression effect 3.2.1 Cell RNA Extraction (1) The stable cell line constructed above was seeded at a rate of 1×10⁶ cells per well. 5 Cells were seeded in 6-well plates and cultured. (2) Discard the culture medium in the 6-well plate, add 1 ml of Trizol to each well, let stand at room temperature for 10 min, and then collect the liquid into a 1.5 ml EP tube; (3) After adding 200 μl of chloroform, shake the EP tube vigorously for 30 seconds and let it stand at room temperature for 2-3 minutes; (4) After pre-cooling the high-speed centrifuge, centrifuge the sample at 4℃ and 12000g for 15-20min, and transfer 400μl of the upper colorless aqueous phase into a new 1.5ml EP tube; (5) Add 600 μl of isopropanol to the EP tube, mix by inverting, let stand at room temperature for 10 min, and then centrifuge at 12000g at 4℃ for 10 min. (6) Carefully discard the supernatant, add 1 ml of freshly prepared 75% ethanol to wash the RNA precipitate, and centrifuge at 7500 g for 5 min at 4℃; (7) Carefully discard the 75% ethanol, let the dried RNA precipitate stand at room temperature for 5-10 minutes, and after the RNA becomes gel-like, add an appropriate amount of DEPC water to dissolve it. Then use a NanoDrop2000 micro-volume spectrophotometer to measure the RNA purity and concentration. (8) The steps for the gDNA removal reaction and reverse transcription reaction are the same as in Example 2; (9) The steps of the real-time PCR reaction are the same as in Example 2. The relative expression levels of DLEU2 in the experimental group and the control group are detected.

[0040] 3.3 Detection of the effect of DLEU2 on fibroblast differentiation and expression of pro-fibrotic factors The experiment was divided into four groups: a control group, a NIH-3T3 cell group treated with 10 ng / ml TGF-β1, a sh-NC cell group treated with 10 ng / ml TGF-β1, a sh-DLEU2-1 cell group treated with 10 ng / ml TGF-β1, a sh-DLEU2-2 cell group treated with 10 ng / ml TGF-β1, a LV5-NC cell group treated with 10 ng / ml TGF-β1, and a LV5-DLEU2 cell group treated with 10 ng / ml TGF-β1. The treatment time with 10 ng / ml TGF-β1 in each group was 72 h.

[0041] 3.3.1 Total RNA extraction and RT-qPCR detection from cells (1) The stable cell line constructed above was seeded at a rate of 1×10⁶ cells per well. 5 Cells were seeded in 6-well plates and cultured for 24 hours. Then, 10 ng / ml TGF-β1 was added to each group and incubated for 72 hours. Total RNA was then extracted from the cells. The specific steps for extracting total RNA were the same as in 3.2.1.

[0042] (2) The steps for the gDNA removal reaction and reverse transcription reaction are the same as in Example 2; (3) The steps of the real-time PCR reaction are the same as in Example 2, and the mRNA expression of col1a1 and fn1 in each group is detected.

[0043] 3.3.2 Extraction of total cellular protein (1) The stable cell line constructed above was seeded at a rate of 2 × 10⁶ cells per well. 5 Cells were seeded in 60 mm dishes and cultured for 24 hours. Then, 10 ng / ml TGF-β1 was added to each group and the cells were treated for 72 hours before total cell protein was extracted. (2) Take 200-400 µl / 60 mm dish of BeyoLytic™ mammalian active protein extraction reagent, and add appropriate amounts (4-8 µl each of inhibitor and protein extraction reagent at a ratio of 1:50) of protease inhibitor and phosphatase inhibitor according to the specific experimental purpose. Add BeyoZonase™ super nuclease to a final concentration of 50 U / ml (0.52-1.04 µl) to reduce the viscosity of the extraction product. Place in an ice bath for later use; (3) Discard the culture medium in the 60mm dish, wash 3 times with pre-cooled PBS, add the solution prepared above, and shake on an ice shaker for 2-20 minutes to lyse. (4) Use a pipette to suspend the cell extract and transfer it to a centrifuge tube. Centrifuge at 14,000g at 4ºC for 5-10 minutes and collect the supernatant.

[0044] 3.3.3 Protein sample quantification (1) Preparation of protein standards: Prepare protein standards to a concentration of 25 mg / ml, aliquot, and store at -20ºC for long-term use. When measuring protein sample concentration, further dilute to 0.5 mg / ml for use; (2) Preparation of BCA working solution: Prepare BCA working solution according to the ratio of reagent A: reagent B = 50:1; (3) Protein sample concentration detection: Add 0.5 mg / ml standard to each well of a 96-well plate at volumes of 0, 1, 2, 4, 8, 12, 16, and 20 µl, respectively, and simultaneously add standard diluent to each well to bring the volume to 20 µl. Add 1 µl of the sample to be tested to each well of the 96-well plate, and similarly add standard diluent to bring the volume to 20 µl, thus diluting the sample 20-fold. Add 200 µl of prepared BCA working solution to both the sample and standard wells, and incubate at 37ºC for 30 min. Measure the absorbance at an A562 nm wavelength using a microplate reader, and calculate the sample protein concentration based on the standard curve. (4) Protein denaturation: After mixing the protein sample with 5× loading buffer, heat in a 100℃ metal bath for 5-10 min, cool to room temperature, aliquot and store at -80℃.

[0045] 3.3.4 Western blot (WB) assay for detecting cellular protein levels (1) SDS-PAGE gel preparation and electrophoretic separation of proteins 1) Preparation of SDS-PAGE adhesive: A. Based on the molecular size of the protein, 10% and 6% separating gels are mainly prepared. The specific reagents and volumes required for preparation are shown in Table 1.

[0046]

[0047] Prepare the liquid in a 50ml centrifuge tube according to the volume in the table above, let it stand at room temperature for a few minutes to degas, carefully pour the gel into the gap between the glass plates, press the gel together with 500µl of anhydrous ethanol, and wait for the gel to solidify before proceeding with subsequent operations. B. Preparation of 5% stacking gel: Take another 50ml centrifuge tube and add 2.7ml deionized water, 0.67ml 30% polyacrylamide solution, 0.5ml 1.0M Tris-HCl (pH 6.8), 0.04ml 10% SDS, 0.04ml 10% AP and 0.004ml TEMED in sequence. After mixing, discard the isopropanol in the glass plate where the separating gel has solidified. Then quickly pour in the prepared stacking gel solution, slowly insert the matching sample comb, and wait for the upper layer of gel to solidify.

[0048] 2) Electrophoretic separation of proteins A. Sample loading: After clamping the glass plate carrying the SDS-PAGE gel with the electrode plates, place it into the electrophoresis tank, add electrophoresis buffer to check for leakage in the inner tank, slowly and vertically pull out the sample comb, and then add an appropriate amount of protein sample and protein marker to the lane. B. Electrophoresis: The stacking gel is kept at a constant voltage of 80V for about half an hour, and the separating gel is kept at a constant voltage of 120V until the color of the loading buffer is almost at the bottom of the gel (about 1-2 hours).

[0049] (2) Transfer membrane 1) Sandwich Preparation: First, cut a PVDF membrane to the appropriate size and activate it in methanol for 10 seconds. Then, immerse it and filter paper in the transfer solution. Next, prepare the sandwich in the following order from bottom to top: sponge, filter paper, PVDF membrane, gel, filter paper, sponge, removing air bubbles when adding each layer. Fix the sandwich in the sieve plate, and insert the sieve plate into the transfer tank in the following order: white to red, black to black. 2) Transfer conditions: bury the transfer tank in an ice-water mixture, fill the transfer tank with wet transfer solution. Proteins with a molecular weight of less than 70 kDa can be electrotransferred at 200 mA for 1.5 h. For proteins with a larger molecular weight, electrotransfer overnight at 4 degrees Celsius with a low current.

[0050] (3) Blocking, antibody incubation and color development 1) Blocking: Pour an appropriate amount of 5% or 7% milk into the antibody incubation box, place the PVDF membrane after transfer into the milk, and block at room temperature for 1 hour, or at 4°C overnight. 2) Primary antibody incubation: After removing the blocking solution, add the primary antibody directly and incubate overnight at 4°C. Wash the membrane with TBST for 5 min × 4 times. 3) Secondary antibody incubation: Incubate HRP-labeled secondary antibody at room temperature for 1 hour, then wash the membrane with TBST 4 times for 5 minutes each time; 4) ECL colorimetric development: Prepare the working solution according to the ECL colorimetric kit used. Remove the membrane from the TBST, absorb excess liquid on clean absorbent paper, and evenly drop the prepared ECL working solution onto the membrane. Incubate in the dark for 5 minutes, then expose using an imaging system. Quantitative analysis is performed after measuring the optical density of the bands using GEL Pro Analyzer software.

[0051] 3.3.5 Enzyme-linked immunosorbent assay (ELISA) The specific steps are as follows: (1) Collection of cell culture supernatant: Collect cell culture supernatant, centrifuge for 20 min (2000-3000 rpm / min), and freeze at -80℃; (2) Addition of standards: Set up standard wells and sample wells, and add 50 μl of different concentrations of standard to each standard well. CTGF: standard concentrations are 800, 400, 200, 100, 50, and 0 pg / ml respectively; PDGF: standard concentrations are 24, 12, 6, 3, 1.5, and 0 pg / ml respectively; (3) Sample addition: Set up blank wells and test sample wells respectively. The sample is diluted 5 times before detection. That is, add 40 μl of sample diluent to the test sample well first, and then add 10 μl of test sample. (4) Incubation after enzyme addition: Except for blank wells, add 100 μl of enzyme-labeled reagent to each well and incubate at 37℃ for 60 min; (5) Washing: After discarding the liquid in the microplate, shake it dry, fill each well with washing buffer, let it stand for 30 seconds and then discard it. Repeat 5 times. (6) Color development and termination: Add 50 μl of color developer A to each well, then add 50 μl of color developer B, and develop color at 37°C in the dark for 15 min; add 50 μl of stop solution to each well to terminate the reaction; (7) Measurement and calculation: The absorbance (OD value) of each well at a wavelength of 450 nm was measured in a multi-functional microplate reader. The linear regression equation of the standard curve was obtained by applying the concentration and OD value of the standard. The OD value of the sample was substituted into the equation to calculate the sample concentration. Then, it was multiplied by a dilution factor of 5 to obtain the actual concentration of the sample.

[0052] The knockdown effect of sh-DLEU2 is as follows Figure 2 As shown in AB, the effect of DLEU2 overexpression was detected as follows: Figure 2As shown in C. RT-qPCR detection revealed that silencing DLEU2 inhibited the mRNA expression of col1a1 and fn1 induced by the fibroblast activator TGF-β1, and overexpression of DLEU2 further promoted the upregulation of TGF-β1-induced col1a1 and fn1 mRNA expression. Figure 2 D. ELISA analysis revealed that DLEU2 knockdown reduced the expression levels of pro-fibrotic factors CTGF and PDGF in TGF-β1-induced cell culture supernatant, while DLEU2 overexpression upregulated the expression of pro-fibrotic factors CTGF and PDGF in TGF-β1-induced cell culture supernatant. Figure 2 As shown in E. Furthermore, the Western blot results indicate that silencing DLEU2 inhibits TGF-β1-induced protein expression of α-SMA, Collagen I, and Fibronectin 1, while overexpression of DLEU2 increases TGF-β1-induced protein expression of α-SMA, Collagen I, and Fibronectin 1, as shown in E. Figure 2 G and Figure 2 H.

[0053] The above results indicate that knocking down DLEU2 can inhibit TGF-β1-induced lung fibroblast differentiation, migration and the expression of profibrotic factors, while overexpression of DLEU2 can promote TGF-β1-induced lung fibroblast differentiation, migration and the expression of profibrotic factors.

[0054] 3.4. Detection of the effect of DLEU2 on fibroblast proliferation and invasion. 3.4.1 Cell Scratch Assay (1) Cell seeding: Prepare a single-cell suspension of NIH-3T3 cells, mark the bottom back of the 6-well plate with a cross mark using a marker pen, and seed 1 x 10 cells per well. 5 One cell; (2) Scratching: Using a 20 μl pipette tip, scrape the cells along the marked "+" pattern in a 6-well plate. The cells were then washed with PBS, and images were taken under a microscope at 0 h. The cells were then cultured in basal culture for another 48 h. (3) Taking pictures: After discarding the culture medium and washing with PBS, take pictures under a microscope and compare them with the pictures taken at 0h; (4) Results analysis: The area and height of the scratch were calculated using ImageJ software; Scratch width = scratch area / scratch height Cell migration rate is calculated using the following formula: Cell migration rate = BE / ×100%; Where B is the initial width and E is the final width.

[0055] Experimental results are as follows Figure 2 As shown in Figure J, knocking down DLEU2 inhibited TGF-β1-induced cell migration, while overexpression of DLEU2 further accelerated the TGF-β1-induced cell migration rate, with statistically significant differences.

[0056] 3.4.2 Transwell Experiment (1) Using a 24-well plate as the lower chamber, add 500 μl of 20% FBS complete culture medium to the lower chamber beforehand, and place the transwell chamber in the 24-well plate; (2) Cell sample preparation: After transfecting cells and treating them with TGF-β1 for 72 h, NIH-3T3 cells in the logarithmic growth phase were digested with 0.25% trypsin and the cells were collected for counting. (3) Cell counting: After resuspending the cells in the basal medium, the cell concentration was adjusted to 2×10⁻⁶ cells / mL for counting. 5 pcs / ml; (4) Plating: Take 200 μl of the prepared single-cell suspension and add it to the upper layer of the transwell chamber. Make 3 replicates per group and place them in a cell culture incubator to continue culturing for 8 hours. (5) Staining: Remove the 24-well plate, discard the liquid from the upper and lower layers of the chamber, wash with PBS, and gently wipe away the cells on the bottom membrane of the chamber with a cotton swab. Wash twice with PBS, and fix with 500 μl of 4% paraformaldehyde for 30 min. Discard the paraformaldehyde, stain with crystal violet staining solution for 20 min, and wash the bottom membrane of the chamber with PBS twice for 10 min each time. (6) Taking pictures: Take multiple pictures of the bottom membrane of the chamber under a microscope, count them using ImageJ software, and take the average value for statistical analysis; Experimental results are as follows Figure 2 As shown in Figure K, it can be seen from the figure that the number of NIH-3T3 cells that can penetrate the membrane induced by TGF-β1 is significantly reduced after knocking down DLEU2 and significantly increased after overexpressing DLEU2, with statistically significant differences.

[0057] The above experimental results show that knocking down DLEU2 can effectively inhibit the proliferation and invasion of fibroblasts, while overexpressing DLEU2 can promote the proliferation and invasion of fibroblasts.

[0058] Example 4 Animal experiments - Detection of the effect of DLEU2 on pulmonary fibrosis in mice 4.1 Constructing an animal model 4.1.1 Grouping of Animal Experiments The experimental groups were: Saline + LV3-shNC group, Saline + LV3-sh-DLEU2 group, BLM + LV3-shNC group, and BLM + LV3-sh-DLEU2 group. After weighing and recording the weight of mice in each group, the mice were randomly divided into the above 4 groups using a random number table, with 6-8 mice in each group. The mice were marked with ear tags, and the tag numbers were recorded.

[0059] 4.1.2 Constructing a BLM-induced mouse model of pulmonary fibrosis (1) BLM dosage and calculation: Mice were treated with 5 mg / kg BLM, and the total volume was 50 μl instilled into the trachea. Take 100 μl of BLM with a stock solution concentration of 10 μg / μl, add 300 μl of physiological saline, and prepare a working solution with a concentration of 2.5 μg / μl for use. For example: Mice weighing 20g require 20g × 5 mg / kg = 100 μg of BLM, 100 μg / 2.5 μg / μl = 40 μl, and make up to 50 μl with physiological saline; (2) Specific operation: Intraperitoneal injection of 1% sodium pentobarbital solution. After the mice are anesthetized, fix them supine on the operating table, adjust the angle of the operating table, and gently pull out the tongue of the mice with forceps to fully expose the larynx. With the help of a head-mounted spotlight, inject BLM into the trachea. The control group received the same volume of Saline. Rotate and shake gently to help the solution distribute in the lungs. Mice were euthanized on days 7 and 28 after treatment or completion.

[0060] 4.1.3 Constructing a lentivirus carrying shRNA to knock down DLEU2 expression in mouse lung tissue (1) Calculation of lentivirus 3 (LV3) dosage: 3 x 10⁻⁶ per mouse 6 TU / ml was used as the lentivirus dosage, and the lentivirus titers were sh-DLEU2-1: 7x10 8 TU / ml, sh-NC: 1x10⁸ TU / ml. The required lentivirus volumes were calculated as follows: 4.28 μl for sh-DLEU2-1 and 30 μl for sh-NC. Both were brought to a final volume of 50 μl with physiological saline. (2) Administration time and method: Lentiviral virus was injected into the trachea, using the same method as BLM administration. Lentiviral virus was injected into the trachea on days 7, 14 and 21 after BLM administration.

[0061] 4.2 Bronchoalveolar lavage fluid and lung tissue collection 4.2.1 Acquisition and processing of bronchoalveolar lavage fluid Mice were anesthetized with 1% sodium pentobarbital via intraperitoneal injection, then fixed supine on the operating table to expose the trachea. A small incision was made in the trachea, an indwelling intravenous catheter was inserted, and the catheter was ligated and fixed with silk suture. The trachea was lavaged three times with 0.8, 0.8, and 0.5 ml of 1×PBS. The bronchoalveolar lavage fluid (BALF) was collected into a 5 ml centrifuge tube and centrifuged at 5000 rpm for 10 min within 2 hours postoperatively. The supernatant was frozen at -80°C for subsequent ELISA detection of CTGF and PDGF.

[0062] 4.2.2 Lung Tissue Acquisition Expose the mouse's heart and lungs, cut open the left atrium, and perform right ventricular puncture. Inject 5 ml of physiological saline to flush the lungs until they turn white. Cut off the right lung lobe, remove surrounding tissue and adipose tissue, and place it in a cryovial for cryopreservation in liquid nitrogen for later use. Cut off the left lung, similarly remove surrounding tissue and adipose tissue, and fix it in 4% paraformaldehyde solution at room temperature for 48-72 hours for pathological section analysis.

[0063] 4.2.3 Staining analysis of mouse lung tissue pathological sections 4.2.3-1 Preparation of Lung Pathological Histological Specimens (1) Paraffin embedding 1) Dehydration and clearing: The dehydration program was set using a Leica TP1020. Ethanol dehydration was performed in the following order: 30% ethanol for 60 min, 50% ethanol for 60 min, 70% ethanol for 60 min, 80% ethanol for 60 min, 90% ethanol for 60 min, 100% ethanol I for 30 min, and then 100% ethanol II. Xylene clearing: Xylene I and Xylene II each for 10 min. 2) Paraffin embedding: Both paraffin I and paraffin II are used to prepare embedding blocks at 56-60°C for 2 hours.

[0064] (2) Slicing and mounting 1) Slicing: After trimming the cut surface of the paraffin block into a right-angled quadrilateral of appropriate size, fix it on the microtome, adjust the blade angle and the angle of the paraffin block, and slice it into thin slices with a thickness of 3-5µm. 2) Spreading: Float the cut slices in deionized water at 37°C-42°C to fully spread them out; 3) Mounting: Insert the glass slide vertically into the water, and then mount it close to the fully flattened wax sheet; 4) Baking: Place the pasted pieces in a 37°C constant temperature oven and bake for 3 days.

[0065] 4.2.3-2 HE staining (1) Dewaxing and hydration: Xylene I 10 min, Xylene II 10 min, anhydrous ethanol 5 min, anhydrous ethanol 5 min, 95% ethanol 5 min, 85% ethanol 5 min, 70% ethanol 5 min, pure water 5 min; (2) Staining: hematoxylin for 15 min, rinse with running water and drain, differentiate with hydrochloric acid ethanol for 30 s, rinse with tap water for 10 min, and eosin for 2 min; (3) Dehydration, permeation and mounting: Soak in 95% ethanol, anhydrous ethanol I and anhydrous ethanol II for 5 min each, soak in xylene I, xylene II and xylene III for 10 min each, and mount with neutral resin.

[0066] 4.2.3-3 Masson staining (1) Dewaxing and hydration are the same as the HE staining described above; (2) Immerse in Weigert iron hematoxylin staining for 10 min; (3) Differentiate with acidic ethanol solution for 15 seconds, then rinse with running water; (4) Bluing solution was used to restore the blue color for 5 minutes, followed by rinsing with running water; (5) Stain with Ponceau S staining solution for 5 min, then wash with weak acid working solution for 1 min; (6) Wash with phosphomolybdic acid solution for 1 min, then wash with weak acid working solution for 1 min; (7) Stain with aniline blue solution for 2 min, then wash with weak acid working solution for 1 min; (8) Dehydration, permeation and mounting are the same as HE staining as described above.

[0067] 4.2.3-4 Ashcroft fibrosis score of mouse lung tissue After scanning of HE-stained pathological sections, the Ashcroft score was used as the criterion for determining pulmonary fibrosis (see Table 2). Three pathologists conducted a blind review, randomly selecting 30 fields of view for each scanned pathological section image. The mean score of all field scores was used as the fibrosis grade for that sample. The degree of fibrosis was graded from 0 to 8. Observers first determined whether the lung tissue in the field was normal or fibrotic. A score of 0 was given if normal lung tissue predominated; if fibrosis predominated, the score was set to an odd number. If two adjacent odd numbers could not be determined, an even number was used. Fields of view mostly occupied by large blood vessels or the trachea were ignored; if only a small portion of the field was occupied, the degree of fibrosis in the remaining field was assessed.

[0068]

[0069] 4.2.3-5 Immunohistochemistry (IHC) of mouse lung tissue pathological sections (1) Paraffin sectioning 1) Baking: The slices are vertically inserted into a glass jar and baked in an oven at 60℃ for 1 hour, then xylene is added; 2) Dewaxing and hydration are the same as described above for HE staining; 3) Inactivation of endogenous peroxidase: 3% H2O2, about 200µl per tablet, in a humidified chamber for 10-15 min, wash with PBS for 5 min × 3 times; (2) Antigen retrieval: Boil alkaline antigen retrieval solution (10mM Tris buffer, 1mM EDTA, pH adjusted to 9.0 with 1M NaOH) on high in a microwave oven, add the slides, heat on high for 2 min, cool for 5 min, heat on high for 1 min, cool for 5 min (the cycle can be increased according to the retrieval effect), cool at room temperature for 15-20 min; wash with PBS for 5 min × 3 times; (3) Blocking: 50µl of 10% sheep serum per sheet, incubated in a humidified box at room temperature for 1 hour; (4) Antibody incubation: After removing the blocking agent, add 50µl of primary antibody and incubate at 37℃ for 1h in a humidified chamber; wash the slides with PBS for 5min × 3 times; add 50µl of secondary antibody with HRP and incubate at 37℃ for 30min in a humidified chamber; wash the slides with PBS for 5min × 3 times. (5) DAB staining and hematoxylin counterstaining: Add 50µl of freshly prepared DAB staining solution, control the staining under a microscope for 3-10 min, stop the staining with PBS, add hematoxylin staining solution, rinse with tap water, and separate the colors with the separating solution. (6) Dehydration, permeation, and mounting are the same as HE staining.

[0070] 4.3 Extraction of total RNA from mouse lung tissue (1) Cut a piece of lung tissue the size of a mung bean and place it in a 1.5ml EP tube. After grinding with a sterilized grinding rod, add 500μl Trizol. Then use an ultrasonic homogenizer to fully lyse the lung tissue and add 500μl Trizol for subsequent RNA extraction. (2) After adding 200 μl of chloroform, shake the EP tube vigorously for 30 seconds and let it stand at room temperature for 2-3 minutes; (3) After pre-cooling the high-speed centrifuge, centrifuge the sample at 12000g at 4℃ for 15-20min, and transfer 400μl of the colorless aqueous phase from the upper layer to a new 1.5ml EP tube; (4) Add 600 μl of isopropanol to the EP tube, mix by inverting, let stand at room temperature for 10 min, and then centrifuge at 12000 g at 4℃ for 10 min. (5) Carefully discard the supernatant, add 1 ml of freshly prepared 75% ethanol to wash the RNA precipitate, and centrifuge at 7500 g for 5 min at 4℃; (6) Carefully discard the 75% ethanol, place the dried RNA precipitate at room temperature for 5-10 minutes, and add an appropriate amount of DEPC water to dissolve it after the RNA becomes gel-like. Then use a NanoDrop2000 micro-volume spectrophotometer to measure the RNA purity and concentration. (7) The RNA obtained in step (6) was subjected to real-time PCR assay, and the results are as follows: Figure 1 As shown in J, from Figure 1 As can be seen, DLEU2 expression was upregulated in mice after 7 days of BLM treatment, and its expression was significantly increased after 28 days of BLM treatment; it was also higher than that in mice treated with BLM after 7 days. This further clarifies that DLEU2 expression is elevated in pulmonary fibrosis.

[0071] 4.4 Extraction of protein from mouse lung tissue (1) Protein extraction: After weighing the wet weight of the mouse lung tissue (the size of a mung bean), add BeyoLytic™ mammalian active protein extraction reagent at a ratio of 200-400 μl of extraction reagent per 20 mg of tissue. Depending on the specific experimental purpose, add appropriate amounts (4-8 µl each of protease inhibitor and phosphatase inhibitor at a ratio of 1:50 = inhibitor: protein extraction reagent) and 0.52-1.04 µl of BeyoZonase™ super nuclease. Then, use an ultrasonic homogenizer to fully lyse the lung tissue. After centrifugation at 12000 g for 10 min at 4℃, transfer the supernatant to a new EP tube. (2) Protein sample quantification is the same as in Example 3.

[0072] 4.5 Western blot analysis was performed to detect protein levels in mouse lung tissue. The specific experimental steps were the same as in Example 3.

[0073] 4.6 Detection of hydroxyproline content in mouse lung tissue (1) Weigh 30-50 mg of mouse lung tissue into a 15 ml glass tube, add 1 ml of hydrolysate, and place in a 95℃ water bath for 20 min to hydrolyze; (2) After rinsing the glass tube with running water, add 10µl of indicator and mix well; (3) Add 1 ml of pH-adjusting solution A to the glass tube and mix well. At this point, the solution turns red. (4) Slowly add pH-adjusting solution B dropwise into the glass tube, mixing well after each drop, until the liquid changes from red to yellow-green, bringing the pH to approximately 6.0-6.8. Continue adding deionized water to 10 ml and mix thoroughly. (5) Take 4 ml of the above-treated liquid into a new 10 ml test tube, add 30 mg of activated carbon at the same time, centrifuge at 3500 rpm / min for 10 min, and then take 1 ml of the supernatant into a new EP tube to keep as the test solution; (6) Take new 5ml test tubes and label them A550 blank tube, A550 standard tube, and A550 test tube for each sample. Add 1ml of deionized water to the blank tube, add 1ml of 5μg / ml standard working solution to the standard tube, and add 1ml of test solution to each sample test tube; at the same time, add 0.5ml of reagent one to each tube, mix well, and let stand at room temperature for 10min. Then add 0.5ml of reagent two to each tube in turn, mix well, and let stand at room temperature for 5min.

[0074] (7) Continue to add 0.5 ml of reagent 3 to each tube and mix well. Incubate at 60°C for 15 min, centrifuge at 3500 rpm / min for 10 min, and transfer 200 μl of the supernatant to a 96-well plate. Use a multi-functional microplate reader to detect the absorbance value at an A550 nm wavelength.

[0075] (8) Calculate the hydroxyproline content (μg / mg wet weight) of each sample = (A550 test tube – A550 blank tube) / (A550 standard tube – A550 blank tube) × standard tube concentration × total volume of hydrolysate / wet weight of lung tissue.

[0076] 4.7 ELISA was used to detect the expression of pro-fibrotic factors in BALF. The specific experimental procedures were the same as in Example 3. Experimental results are as follows Figure 3As shown, firstly, mouse lung tissue was collected and RT-qPCR was used to detect the downregulation of DLEU2 expression, verifying the DLEU2 knockdown effect in mice. Subsequently, HE staining and Ashcroft scoring of mouse lung tissue revealed that DLEU2 knockdown inhibited BLM-induced pulmonary fibrosis in mice. Masson staining and hydroxyproline detection of mouse lung tissue showed that DLEU2 knockdown inhibited BLM-induced collagen deposition in mouse lung tissue. RT-qPCR was used to detect the mRNA expression of col1a1 and fn1, revealing that BLM treatment upregulated their expression; however, DLEU2 knockdown significantly inhibited their expression. Western blotting was used to detect the expression of α-SMA, Collagen I, and Fibronectin 1 fibroblast-related proteins in mouse lung tissue, showing that BLM treatment upregulated their expression, but DLEU2 knockdown inhibited their expression in mouse lung tissue. After pathological sectioning of mouse lung tissue, IHC was used to detect the expression of α-SMA and Collagen I in the lung tissue. It was found that BLM treatment upregulated the expression of both CTGF and PDGF in mice; however, knocking down DLEU2 suppressed their expression. BALF from mice was collected, and ELISA analysis revealed that BLM-treated mice showed upregulated expression of CTGF and PDGF, but knocking down DLEU2 suppressed their expression in BALF.

[0077] In summary, the above results indicate that knocking down DLEU2 inhibits fibroblast differentiation, migration, and the expression of pro-fibrotic factors, while overexpression of DLEU2 promotes TGF-β1-induced fibroblast differentiation, migration, and the expression of pro-fibrotic factors. This was further validated in a mouse model of pulmonary fibrosis. Therefore, DLEU2 can be considered a potential biomarker for the diagnosis of pulmonary fibrosis, and also a potential therapeutic molecule for pulmonary fibrosis, making further research on it of great significance.

[0078] The technical solutions provided by the embodiments of the present invention have been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the embodiments of the present invention. The descriptions of the embodiments above are only for helping to understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, there will be changes in the specific implementation methods and application scope based on the embodiments of the present invention. Therefore, the content of this specification should not be construed as a limitation of the present invention.

Claims

1. A biomarker for preparing diagnostic products for pulmonary fibrosis, characterized in that: The biomarker is lncRNADLEU2, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The biomarker for preparing diagnostic products of pulmonary fibrosis according to claim 1, characterized in that: The products include testing reagents or diagnostic reagents, as well as kits containing testing reagents and diagnostic kits containing diagnostic reagents.

3. A method for in vitro detection of the biomarker lncRNA DLEU2, for non-diagnostic purposes, characterized in that: A reagent capable of specifically detecting lncRNA DLEU2 was used, which detected the expression level of DLEU2 in biological samples from the subject. The nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.

1.

4. The method according to claim 3, characterized in that: The reagent specifically capable of detecting lncRNA DLEU2 is used to detect the PCR primers for lncRNA DLEU2 expression; the primers include an upstream primer and a downstream primer, and the primer sequences are as follows: The upstream primer is: AGATGGAGTCTCGCTCTGTCACC, as shown in SEQ ID NO.2; The downstream primer is: GAGGCAGGAGAATGGCGTGAAC, as shown in SEQ ID NO.

3.

5. The method according to claim 3, characterized in that: The biological samples from the subjects were selected from peripheral blood, tissue samples, and exosomes.

6. The application of a lncRNA DLEU2 knockdown agent in the preparation of a therapeutic drug for pulmonary fibrosis, characterized in that: The nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.

1.

7. The application according to claim 6, characterized in that: The lncRNA DLEU2 knockdown agent is sh-DLEU2.

8. The application of a lncRNA DLEU2 knockdown agent in the preparation of a lung fibroblast activation inhibitor, characterized in that, The nucleotide sequence of the lncRNA DLEU2 is shown in SEQ ID NO.1; the lncRNA DLEU2 knockdown agent is sh-DLEU2.

Images