KASP molecular marker related to soybean seed size and application of KASP molecular marker

Abstract

The invention relates to the technical field of molecular breeding of crops, in particular to a KASP molecular marker related to the size of soybean seeds and application of the KASP molecular marker. The molecular marker group comprises three SNP (Single Nucleotide Polymorphism) sites located in an intron region of a gene GmW82.04G097200 of a soybean T2T genome, wherein an SNP1 site is located at 8152017bp, and T / C nucleotide polymorphism exists; the SNP2 site is located at 8152443bp, and the A / G nucleotide polymorphism exists; the SNP3 site is located at 8153901bp, and C / G nucleotide polymorphism exists in the SNP3 site; alleles of the three SNP sites are combined to form three haplotypes corresponding to soybean seeds in size. The method has the advantages that three groups of specific KASP primer groups are provided, and genotypes of different soybeans are rapidly distinguished by virtue of PCR amplification and fluorescence signal detection, so that accurate screening of large-grain phenotype individuals is realized, the breeding period is effectively shortened, and the breeding input cost is reduced.

Description

KASP molecular markers related to soybean seed size and their applications Technical Field

[0001] This invention relates to the field of crop molecular breeding technology, and in particular to a KASP molecular marker related to soybean seed size and its application. Background Technology

[0002] Soybean (Glycine max (L.) Merrill) is a core source of plant protein and oil for humans, and its yield and quality directly affect food and oil supply security and agricultural economic development. Seed size is a key agronomic trait determining soybean yield, directly influencing not only the core yield component of 100-seed weight but also closely related to commercial quality indicators such as seed length, width, surface area, and perimeter, significantly impacting the economic benefits of soybean production. It is predicted that global soybean demand will increase by 80% by 2050, driven by global population growth and rising protein consumption demand. Therefore, optimizing seed size traits through genetic improvement and cultivating large-seed, high-yielding soybean varieties has become a core task for ensuring the sustainable development of the soybean industry.

[0003] In traditional soybean breeding practices, the selection of seed size traits relies on manual observation and measurement of phenotypes after crop maturity. This method not only requires waiting for the complete growth cycle, resulting in a lengthy breeding period, but is also susceptible to interference from environmental factors such as soil fertility and climate conditions, leading to insufficient selection accuracy and low screening efficiency, severely restricting the breeding process of large-seed soybean varieties. With the development of molecular biology techniques, marker-assisted selection (MAS) technology, through molecular markers closely linked to the target trait, can achieve precise identification of superior genotypes in the early stages of crop growth, significantly shortening the breeding cycle and improving selection efficiency, and has become a core technical means for soybean genetic improvement.

[0004] Currently, although some studies have developed molecular markers for soybean seed size-related genes, traditional markers such as SSR and ordinary agarose gel electrophoresis markers have drawbacks such as low throughput, cumbersome operation, and high cost, making it difficult to meet the needs of large-scale germplasm resource screening and high-throughput breeding. KASP (Competitive Allele-Specific PCR) technology, as a highly efficient SNP genotyping technique, can achieve accurate genotyping of target SNP loci through specific primer design and fluorescence signal detection. It has advantages such as high specificity, high detection throughput, stable results, and no need for gel electrophoresis. It has been successfully applied in molecular breeding of multiple traits such as soybean pod setting habit, flowering time, and seed size, showing broad application prospects.

[0005] Meanwhile, traditional soybean reference genomes suffer from gaps in sequence and incomplete assembly, limiting the accuracy of functional gene localization and SNP site identification. T2T (telomere-to-telomere) genome assembly technology, however, achieves gapless resolution of the entire chromosome, providing a more reliable reference for precise gene sequence annotation and efficient SNP site mining, and facilitating the development of more specific and accurate functional molecular markers. The GmW82.04G097200 gene (corresponding to the Glyma.04G092700 gene annotated in the traditional reference genome Wm82.a2.v1 version), as a key candidate gene associated with soybean seed size, has polymorphic sites in its intron regions that have not yet been developed into efficient molecular markers. Therefore, based on the complete T2T genome sequence, mining SNP sites within this gene that are significantly associated with seed size and developing corresponding KASP molecular markers and detection methods has significant practical significance and application value for improving the efficiency of genetic improvement of soybean seed size traits and accelerating the breeding of large-grained, high-yielding soybean varieties. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides a KASP molecular marker related to soybean seed size and its application.

[0007] The primary objective of this invention is to provide a KASP molecular marker set related to soybean seed size, comprising three SNP sites located in the intron region of the GmW82.04G097200 gene in the soybean T2T genome:

[0008] SNP1 is located at 8152017bp and exhibits T / C nucleotide polymorphism; SNP2 is located at 8152443bp and exhibits A / G nucleotide polymorphism; SNP3 is located at 8153901bp and exhibits C / G nucleotide polymorphism.

[0009] Preferably, the allele combinations of the three SNP loci form three haplotypes corresponding to soybean seed size, specifically: the Hap001 haplotype is SNP1-T / SNP2-A / SNP3-C, corresponding to medium seed size; the Hap002 haplotype is SNP1-C / SNP2-G / SNP3-C, corresponding to large seed size; and the Hap003 haplotype is SNP1-T / SNP2-A / SNP3-G, corresponding to small seed size.

[0010] The second objective of this invention is to provide a specific primer set for detecting the KASP molecular marker set related to soybean seed size, comprising three sets of KASP primers targeting SNP1, SNP2, and SNP3 loci respectively: the first set of primers targeting SNP1 includes allele-specific upstream primers K-4S-SNP1-FAM and K-4S-SNP1-HEX and a universal downstream primer K-4S-SNP1-Common: 5'-GAAGGTGACCAAGTTCATGCTGATTTAATGCCTAAGTTCTTGAAT-3'; 5'-GAAGGTCGGAGTCAACGGATTGATTTAATGCCTAAGTTCTTGAAC-3'; 5'-TTTGAAAGTATTTGTGTAGCCTG-3'; the second set of primers targeting SNP2 includes allele-specific downstream primers K-4S-SNP2-FAM and K-4S-SNP2-HEX and a universal upstream primer K-4S-SNP1-FAM. 2-Common: 5'-GAAGGTGACCAAGTTCATGCTACATGTTTGATACTGCAGCACTT-3'; 5'-GAAGGTCGGAGTCAACGGATTACATGTTTGATACTGCAGCACTC-3'; 5'-CAGGCTACACAAATACTTTCAAA-3'; The third set of primers targeting the SNP3 site includes allele-specific upstream primers K-4S-SNP3-FAM and K-4S-SNP3-HEX and universal downstream primers K-4S-SNP3-Common: 5'-GAAGGTGACCAAGTTCATGCTTTCCAAAATAGCAATCACGTTTCAC-3'; 5'-GAAGGTCGGAGTCAACGGATTTTCCAAAATAGCAATCACGTTTCAG-3'; 5'-TCTTTTGGAACCTTTTTTTTTTATTAAT-3'.

[0011] A third objective of this invention is to provide a detection kit comprising the aforementioned KASP molecular marker set related to soybean seed size.

[0012] Preferably, it also includes KASP Master Mix, positive control Hap002 homozygous genomic DNA, and PCR reaction buffer.

[0013] The fourth objective of this invention is to provide the application of the aforementioned KASP molecular marker set related to soybean seed size in soybean molecular marker-assisted breeding or soybean germplasm resource seed size screening.

[0014] Preferably, soybean molecular marker-assisted breeding is used for screening the early generations of soybean hybridization breeding. Soybean leaves are used as samples during the soybean seedling stage. After extracting genomic DNA from the leaves, the genotype of the KASP molecular marker group is detected to determine the soybean seed size phenotype.

[0015] Preferably, the soybean germplasm resource seed size screening includes the classification of soybean germplasm resources with unknown phenotypes by grain type, wherein the grain type classification includes large grain type, medium grain type and small grain type, corresponding to three haplotypes Hap002, Hap001 and Hap003 respectively.

[0016] The fifth objective of this invention is to provide a method for detecting soybean seed size-related genotypes, comprising the following steps: S1. Extracting genomic DNA from the soybean sample to be tested; S2. Using the extracted genomic DNA as a template, performing KASP-PCR amplification using the aforementioned KASP primer set, simultaneously detecting SNP1, SNP2, and SNP3 sites; S3. Detecting the fluorescence signal of the PCR amplification product, and determining the genotype of each of the three SNP sites based on the fluorescence signal type; S4. Combining the genotype combination of the three SNP sites to determine the soybean haplotype, thereby identifying the seed size-related genotype of the soybean sample to be tested, wherein the haplotype includes Hap002 corresponding to large seed size, Hap001 corresponding to medium seed size, and Hap003 corresponding to small seed size.

[0017] Preferably, each reaction system for KASP-PCR amplification includes: soybean sample DNA template, 5 ng / μl, 1 μl; 2x Master Mix, 1 μl; KASP molecular marker specific primer set mixture, F1:F2:R = 1:1:3, 0.02 μl; reaction conditions include: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, 61~55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, 30 cycles.

[0018] Compared with the prior art, the present invention can achieve the following beneficial effects: (1) High specificity: The molecular marker targets the functional region of the GmW82.04G097200 gene, which is precisely annotated by the T2T genome. The primers are designed in combination with the tight linkage characteristics of the three SNP sites, which can accurately distinguish the three haplotypes Hap001, Hap002 and Hap003. The genotype and phenotype have a high degree of fit and no false positive results; (2) High detection efficiency: The three key SNP sites are detected simultaneously by three sets of primers. The detection time for a single sample does not exceed 2 hours. No subsequent processing such as gel electrophoresis is required. It is suitable for large-scale high-throughput screening and significantly improves detection efficiency; (3) Early screening: The detection can be completed through leaf tissue during the soybean seedling stage. There is no need to wait for maturity to determine the seed size phenotype, which effectively shortens the breeding cycle and reduces the breeding cost; (4) Wide application: It can be widely used in the evaluation of soybean germplasm seed size, early generation screening of hybrid breeding, and breeding of large-grained soybean varieties. It provides technical support for the precise improvement of soybean seed size traits and is of great significance for improving soybean yield and ensuring food security.

[0019] In summary, this invention fully utilizes the linkage characteristics of SNP sites and the precise sequence information of the T2T genome to solve the technical pain points of "long phenotypic identification cycle, cumbersome detection process, and low screening efficiency" in soybean seed size breeding. It fills the application gap of efficient molecular markers for soybean seed size traits and has clear innovation, outstanding practicality, and broad industrial promotion value. Attached Figure Description

[0020] Figure 1 shows the single nucleotide polymorphisms and haplotype distribution of the GmW82.04G097200 gene. The figure shows the allelic composition of three SNP sites (physical locations 8152017bp, 8152443bp, and 8153901bp) in the intron region of the GmW82.04G097200 gene that are significantly associated with seed size, as well as the frequency distribution of three haplotypes (Hap001, Hap002, and Hap003) in the T2T assembled soybean genome.

[0021] Figure 2 shows a comparison of the seed size phenotype of the GmW82.04G097200 gene EMS mutant line (SQJ3435) and its wild-type W82. The first row of the figure shows the seed phenotype of the wild-type soybean variety W82, and the second row shows the seed phenotype of the GmW82.04G097200 gene EMS mutant line SQJ3435. The scale bar is 1 cm.

[0022] Figure 3 shows the design schematics of three sets of KASP primers; the figure shows the primer binding regions and fluorescent labeling types for SNP1, SNP2, and SNP3 sites, respectively. Detailed Implementation

[0023] In the following description, embodiments of the invention will be described with reference to the accompanying drawings. In the description below, the same modules are denoted by the same reference numerals. Where the same reference numerals are used, their names and functions are also the same. Therefore, their detailed description will not be repeated.

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and do not constitute a limitation thereof.

[0025] This invention provides a KASP molecular marker for the GmW82.04G097200 gene associated with soybean seed size. This marker set includes three SNP sites located in the intron region of the GmW82.04G097200 gene in the soybean T2T genome: SNP1 (physical location 8152017 bp, exhibiting T / C nucleotide polymorphism); SNP2 (physical location 8152443 bp, exhibiting A / G nucleotide polymorphism); and SNP3 (physical location 8153901 bp, exhibiting C / G nucleotide polymorphism). Allelic combinations of these three SNP sites form three haplotypes corresponding to soybean seed size. Haplotypes: Hap001 haplotype is SNP1-T / SNP2-A / SNP3-C (SNP1 site homozygous T, SNP2 site homozygous A, SNP3 site homozygous C), representing a medium-sized allele combination; Hap002 haplotype is SNP1-C / SNP2-G / SNP3-C (SNP1 site homozygous C, SNP2 site homozygous G, SNP3 site homozygous C), representing a large-sized allele combination; Hap003 haplotype is SNP1-T / SNP2-A / SNP3-G (SNP1 site homozygous T, SNP2 site homozygous A, SNP3 site homozygous G), representing a small-sized allele combination.

[0026] After years of field trials at multiple locations, soybean varieties carrying the Hap002 haplotype showed significantly higher 100-seed weight, seed length, width, area, and perimeter than those carrying the Hap001 and Hap003 haplotypes. This molecular marker can effectively distinguish soybean materials with different seed size genotypes, providing a solid basis for the precise screening of large-seed soybeans.

[0027] A specific primer set for detecting the above-mentioned KASP molecular markers is provided, including three sets of KASP primers targeting SNP1, SNP2, and SNP3 sites respectively, specifically: the first set of primers (targeting SNP1 site) is: (1) allele-specific upstream primer K-4S-SNP1-FAM (corresponding to the T allele of SNP1), the sequence of which is shown in SEQ ID NO.1: 5'-GAAGGTGACCAAGTTCATGCTGATTTAATGCCTAAGTTCTTGAAT-3' (fluorescently labeled FAM); (2) allele-specific upstream primer K-4S-SNP1-HEX (corresponding to the C allele of SNP1), the sequence of which is shown in SEQ ID NO.2: 5'-GAAGGTCGGAGTCAACGGATTGATTTAATGCCTAAGTTCTTGAAC-3' (fluorescently labeled HEX); (3) universal downstream primer K-4S-SNP1-Common (targeting SNP1 site), the sequence of which is shown in SEQ ID NO. NO.3 shows: 5'-TTTGAAAGTATTTGTGTAGCCTG-3'; the second set of primers (for SNP2 site) (1) allele-specific downstream primer K-4S-SNP2-FAM (corresponding to SNP2-A allele), the sequence of which is shown in SEQ ID NO.4: 5'-GAAGGTGACCAAGTTCATGCTACATGTTTGATACTGCAGCACTT-3' (fluorescently labeled FAM); (2) allele-specific downstream primer K-4S-SNP2-HEX (corresponding to SNP2-G allele), the sequence of which is shown in SEQ ID NO.5: 5'-GAAGGTCGGAGTCAACGGATTACATGTTTGATACTGCAGCACTC-3' (fluorescently labeled HEX); (3) universal upstream primer K-4S-SNP2-Common (for SNP2 site), the sequence of which is shown in SEQ ID NO.6 shows: 5'-CAGGCTACACAAATACTTTCAAA-3'; the third set of primers (for SNP3 site) (1) allele-specific upstream primer K-4S-SNP3-FAM (corresponding to the C allele of SNP3), the sequence of which is shown in SEQ ID NO.7: 5'-GAAGGTGACCAAGTTCATGCTTTCCAAAATAGCAATCACGTTTCAC-3' (fluorescently labeled FAM); (2) allele-specific upstream primer K-4S-SNP3-HEX (corresponding to the G allele of SNP3), the sequence of which is shown in SEQ ID NO.As shown in SEQ ID NO. 8: 5'-GAAGGTCGGAGTCAACGGATTTTCCAAAATAGCAATCACGTTTCAG-3' (fluorescently labeled HEX); (3) Universal downstream primer K-4S-SNP3-Common (targeting SNP3 site), sequence as shown in SEQ ID NO. 9: 5'-TCTTTTGGAACCTTTTTTTTTTATTAAT-3'.

[0028] During primer design, Primer5 software was used to predict and avoid primer dimers and non-specific binding. The three primer sets were verified by BLAST comparison with the soybean T2T genome database. They showed good specificity and no obvious non-specific amplification sites, which can ensure accurate amplification of the target fragment and meet the detection requirements of KASP technology.

[0029] A soybean seed size detection kit is provided, comprising: (1) a specific primer set for detecting KASP molecular markers (sequences shown in SEQ ID NO.1 to SEQ ID NO.9); (2) 2×KASP Master Mix; (3) positive control: Hap002 homozygous genomic DNA; (4) negative control: sterile water; (5) PCR reaction buffer; (6) instructions for use (including reaction system, reaction conditions and interpretation criteria): the reaction system for each primer set is 2 μl: soybean sample DNA template, 5 ng / μl, 1 μl; 2x Master Mix for ASPCR V1, 1 μl; KASP molecular marker specific primer set mixture (KASPAssay) Mix), F1:F2:R=1:1:3, 0.02μl; reaction conditions included: 95℃ pre-denaturation for 10min; 95℃ denaturation for 20sec, 61~55℃ annealing for 40sec, decreasing by 0.6℃ per cycle, 10 cycles; 95℃ denaturation for 20sec, 55℃ annealing for 40sec, 30 cycles.

[0030] This kit can be used directly for large-scale laboratory testing. It is easy to operate and provides reliable results. It can complete the testing of 96 or 384 samples in a single run, making it suitable for high-throughput screening scenarios. The testing cost is reduced by more than 70% compared to traditional sequencing and typing.

[0031] A detection method based on the above-mentioned KASP molecular marker is provided, which specifically includes the following steps: S1. Genomic DNA extraction: Genomic DNA is extracted from soybean leaves, seeds and other tissues using the CTAB method or a commercial DNA extraction kit. The purity and concentration of the DNA are detected to ensure that the OD260 / OD280 is between 1.8 and 2.0 and the concentration is about 50 ng / μL to meet the requirements of PCR amplification. If the DNA purity does not meet the standard, it can be purified again using a DNA purification kit to avoid interference from impurities on the amplification reaction.

[0032] S2. KASP-PCR amplification used extracted genomic DNA as a template and performed PCR amplification using the three sets of KASP primer combinations mentioned above. Specifically, KASP-labeled primers were used to amplify the DNA of soybean samples on the Gene Matrix high-throughput genotyping system. Each reaction system consisted of 2 μl units, as follows: soybean sample DNA template (5 ng / μl), 1 μl; 2× Master Mix for ASPCR V1, 1 μl; corresponding KASP Assay Mix (F1:F2:R = 1:1:3), 0.02 μl. The reaction conditions were: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, annealing at 61–55℃ for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 sec, annealing at 55℃ for 40 sec, for 30 cycles. This optimized reaction system and conditions effectively balanced amplification specificity and efficiency, reducing the generation of non-specific bands.

[0033] S3. Genotype and Haplotype Interpretation: After PCR amplification, the fluorescence signals of the three sets of primers were detected using a real-time PCR instrument. The genotype was determined based on the fluorescence type: a. Only FAM fluorescence signal was detected: homozygous for the FAM-labeled allele; b. Only HEX fluorescence signal was detected: homozygous for the HEX-labeled allele; c. Both fluorescence signals were detected simultaneously: heterozygous for the corresponding locus.

[0034] Based on the genotype detection results of the three sets of primers, the haplotypes were determined by combination as follows: a. SNP1 is homozygous for T, SNP2 is homozygous for A, and SNP3 is homozygous for C: Hap001 homozygous (medium-sized haplotype); b. SNP1 is homozygous for C, SNP2 is homozygous for G, and SNP3 is homozygous for C: Hap002 homozygous (large-sized haplotype); c. SNP1 is homozygous for T, SNP2 is homozygous for A, and SNP3 is homozygous for G: Hap003 homozygous (small-sized haplotype); d. Other genotype combinations: heterozygous haplotypes.

[0035] S4. Screening of large-grained soybeans: In soybean breeding practice, homozygous individuals of Hap002 are given priority as parents or breeding materials; in germplasm resource screening, large-grained genotype materials can be quickly identified, providing efficient support for breeding resource innovation, and is especially suitable for large-scale screening of early generation materials.

[0036] Example 1: Determination of SNPs related to soybean seed size. Specifically, using the T2T (telomere-to-telomere) assembled soybean genome as a reference, the GmW82.04G097200 gene (corresponding to the Glyma.04G092700 gene in the traditional reference genome Wm82.a2.v1 version) was selected as a candidate gene. 220 natural soybean populations covering different ecological zones were collected, planted at three experimental sites, and subjected to routine field management. After maturity, seed size-related phenotypes (100-seed weight, seed length, width, area, and perimeter) of each material were measured. Simultaneously, genomic DNA was extracted from seedling leaves and resequencing was performed. Bioinformatics analysis was used to identify SNP sites in the intron region of this gene. Combined with GWAS analysis, variant sites significantly associated with seed size were screened. After linkage disequilibrium analysis, three closely linked (r²>0.9) functional SNP sites were identified at physical locations of 8152017bp (T / C polymorphism), 8152443bp (A / G polymorphism), and 8153901bp (C / G polymorphism).

[0037] Haplotype analysis based on three-locus allele combinations identified three haplotypes: Hap001 (SNP1-T / SNP2-A / SNP3-C), Hap002 (SNP1-C / SNP2-G / SNP3-C), and Hap003 (SNP1-T / SNP2-A / SNP3-G) (Figure 1). After multi-year, multi-locus phenotypic association validation, all seed size indicators of the Hap002 haplotype were significantly higher than the other two haplotypes (P<0.001), with an average 100-seed weight 42.0% higher than Hap003, clearly establishing it as the dominant haplotype controlling large-seed traits in soybean. Furthermore, EMS mutant validation results (Figure 2) show that the 100-seed weight and seed area of ​​the mutant line SQJ3435 were significantly lower than the wild-type W82, corroborating the regulatory role of this gene and related SNP sites on seed size.

[0038] Example 2: Design of specific KASP primer sets, as follows: Based on the sequence characteristics of the three functional SNP sites screened in Example 1, and following the principles of KASP primer design, three sets of specific primer combinations were designed using Primer5 software. During the design process, different alleles corresponding to the SNP sites were introduced into the 3' end of the allele-specific upstream / downstream primers, and FAM and HEX fluorescent labeling adaptation sequences were added to the 5' end, respectively (FAM labeling adaptation sequence: GAAGGTGACCAAGTTCATGCT; HEX labeling adaptation sequence: GAAGGTCGGAGTCAACGGATT). Universal downstream / upstream primers were used to bind to conserved flanking sequences of the SNP sites to ensure amplification specificity. The specific sequences of the three primer sets are as follows: K-4S-SNP1-FAM (SEQ ID NO.1), K-4S-SNP1-HEX (SEQ ID NO.2), and K-4S-SNP1-Common (SEQ ID NO.3) for SNP1; K-4S-SNP2-FAM (SEQ ID NO.4), K-4S-SNP2-HEX (SEQ ID NO.5), and K-4S-SNP2-Common (SEQ ID NO.6) for SNP2; and K-4S-SNP3-FAM (SEQ ID NO.7), K-4S-SNP3-HEX (SEQ ID NO.8), and K-4S-SNP3-Common (SEQ ID NO.9) for SNP3 (Figure 3).

[0039] The primers were verified by BLAST comparison with the soybean T2T genome database. No obvious non-specific binding sites were found. The annealing temperature was optimized by gradient PCR to determine the optimal amplification conditions for the primer combination, ensuring clear typing of different genotypes.

[0040] Example 3 uses KASP molecular markers for soybean seed size genotyping and screening of large-grain soybean materials, as follows: S1. Select 50 breeding materials with unknown phenotypes, extract genomic DNA using the CTAB method and adjust the concentration to 50 ng / mL; S2. Perform PCR amplification using three sets of KASP primer combinations; the reaction system is 2 μL (DNA template 1 μL, 2×KASPMaster Mix 1 μL, primer mixture 0.02 μL); the reaction conditions are: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, annealing at 61–55℃ for 40 sec (decreasing by 0.6℃ per cycle, 10 cycles); 95℃ denaturation for 20 sec, annealing at 55℃ for 40 sec (30 cycles).

[0041] S3. Genotype and Haplotype Interpretation: After amplification, fluorescence signals were detected using a real-time PCR instrument and cluster analysis was performed. The results showed that the genotype interpretation accuracy of the standard material reached 100%, and the three homozygous haplotypes were clearly clustered without cross-contamination.

[0042] S4. Screening of large-grained soybeans: The test results of 50 unknown materials were compared with the field phenotypic test results. The genotype and phenotype match rate reached 96%, and 14 excellent materials carrying the Hap002 large-grained haplotype were successfully screened.

[0043] It should be understood that the various forms of processes shown above can be used to reorder, add, or delete steps. For example, the steps described in this invention disclosure can be executed in parallel, sequentially, or in different orders, as long as the desired result of the technical solution disclosed in this invention can be achieved, and this is not limited herein.

[0044] The specific embodiments described above do not constitute a limitation on the scope of protection of this invention. Those skilled in the art should understand that various modifications, combinations, sub-combinations, and substitutions can be made according to design requirements and other factors. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of this invention should be included within the scope of protection of this invention.

Claims

1. A KASP molecular marker set related to soybean seed size, characterized in that: The molecular marker set includes three SNP sites located in the intron region of the soybean T2T genome GmW82.04G097200 gene: SNP1 is located at 8152017 bp and exhibits T / C nucleotide polymorphism; SNP2 is located at 8152443 bp and exhibits A / G nucleotide polymorphism; and SNP3 is located at 8153901 bp and exhibits C / G nucleotide polymorphism.

2. The KASP molecular marker set related to soybean seed size according to claim 1, characterized in that: Three haplotypes corresponding to soybean seed size are formed by allele combinations at three SNP loci: the Hap001 haplotype is SNP1-T / SNP2-A / SNP3-C, corresponding to medium-sized seeds; the Hap002 haplotype is SNP1-C / SNP2-G / SNP3-C, corresponding to large-sized seeds; and the Hap003 haplotype is SNP1-T / SNP2-A / SNP3-G, corresponding to small-sized seeds.

3. A specific primer set for detecting the KASP molecular marker set related to soybean seed size as described in claim 1, characterized in that: The primer sets consist of three sets of KASP primers targeting SNP1, SNP2, and SNP3 loci, respectively. The first set of primers for SNP1 includes allele-specific upstream primers K-4S-SNP1-FAM and K-4S-SNP1-HEX, and a universal downstream primer K-4S-SNP1-Common: 5'-GAAGGTGACCAAGTTCATGCTGATTTAATGCCTAAGTTCTTGAAT-3'; 5'-GAAGGTCGGAGTCAACGGATTGATTTAATGCCTAAGTTCTTGAAC-3'; 5'-TTTGAAAGTATTTGTGTAGCCTG-3'. The second set of primers for SNP2 includes allele-specific downstream primers K-4S-SNP2-FAM and K-4S-SNP2-HEX, and a universal upstream primer K-4S-SNP2-Common: 5'-GAAGGTGACCA AGTTCATGCTACATGTTTGATACTGCAGCACTT-3'; 5'-GAAGGTCGGAGTCAACGGATTACATGTTTGATACTGCAGCACTC-3'; 5'-CAGGCTACACAAATACTTTCAAA-3'; The third set of primers targeting the SNP3 site includes allele-specific upstream primers K-4S-SNP3-FAM and K-4S-SNP3-HEX and universal downstream primers K-4S-SNP3-Common: 5'-GAAGGTGACCAAGTTCATGCTTTCCAAAATAGCAATCACGTTTCAC-3'; 5'-GAAGGTCGGAGTCAACGGATTTTCCAAAATAGCAATCACGTTTCAG-3'; 5'-TCTTTTGGAACCTTTTTTTTTTATTAAT-3'.

4. A test kit, characterized in that: The kit contains the KASP molecular marker set related to soybean seed size as described in claim 1.

5. A detection kit according to claim 4, characterized in that: It also includes KASP Master Mix, positive control Hap002 homozygous genomic DNA, and PCR reaction buffer.

6. The application of the KASP molecular marker set related to soybean seed size as described in claim 1 in soybean molecular marker-assisted breeding or soybean germplasm resource seed size screening.

7. The application of the KASP molecular marker set related to soybean seed size as described in claim 6 in soybean marker-assisted breeding or soybean germplasm resource seed size screening, characterized in that: The soybean molecular marker-assisted breeding is a screening method for the early generations of soybean hybridization breeding. Soybean leaves are used as samples during the soybean seedling stage. After extracting genomic DNA from the leaves, the genotype of the KASP molecular marker group described in claim 1 is detected to determine the soybean seed size phenotype.

8. The application of the KASP molecular marker set related to soybean seed size as described in claim 6 in soybean marker-assisted breeding or soybean germplasm resource seed size screening, characterized in that: The soybean germplasm resource seed size screening includes the classification of grain type of soybean germplasm resources with unknown phenotypes. The grain type classification includes large grain type, medium grain type and small grain type, which correspond to three haplotypes, Hap002, Hap001 and Hap003, respectively.

9. A method for detecting soybean seed size-related genotypes, characterized in that: Includes the following steps: S1. Extract genomic DNA from the soybean sample to be tested; S2. Using the extracted genomic DNA as a template, KASP-PCR amplification is performed using the KASP primer set described in claim 1, and SNP1, SNP2 and SNP3 sites are detected simultaneously; S3. The fluorescence signal of the PCR amplification product is detected, and the genotype of each of the three SNP sites is determined according to the fluorescence signal type. S4. Combine the genotype combinations of the three SNP loci to determine the soybean haplotype and identify the seed size-related genotypes of the soybean sample to be tested. The haplotypes include Hap002 corresponding to the large seed type, Hap001 corresponding to the medium seed type, and Hap003 corresponding to the small seed type.

10. The method for detecting soybean seed size-related genotypes according to claim 9, characterized in that: Each reaction system for KASP-PCR amplification includes: soybean sample DNA template, 5 ng / μl, 1 μl; 2x Master Mix, 1 μl; KASP molecular marker specific primer mixture, F1:F2:R = 1:1:3, 0.02 μl; reaction conditions include: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec, 61~55℃ annealing for 40 sec, decreasing by 0.6℃ per cycle, for 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, for 30 cycles.

Images