Application of alcohol dehydrogenase from geobacillus denitrificans in catalytic synthesis of alpha, omega-binary fatty acid

By using the bifunctional alcohol dehydrogenase (ADH2) of Geobacillus thermodenitrificans, a one-step oxidation reaction from ω-hydroxy fatty acids to α,ω-di fatty acids was achieved, solving the problems of complex enzyme system construction and intermediate accumulation in existing technologies, and improving reaction efficiency and green production capabilities.

CN121975877APending Publication Date: 2026-05-05NANJING TECH UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610082685.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-21
Publication Date
2026-05-05

AI Technical Summary

Technical Problem

Existing biocatalytic methods for producing lauryl iodide require two-step oxidation reactions, involve complex enzyme system construction, and the intermediate aldehydes are prone to accumulate, affecting reaction efficiency and cell stability. Furthermore, traditional chemical methods produce environmentally harmful byproducts.

Method used

A bifunctional alcohol dehydrogenase (ADH2) derived from Geobacillus thermodenitrificans was used to achieve a one-step oxidation reaction of ω-hydroxy fatty acids with NAD+ as a cofactor, generating α,ω-di fatty acids.

Benefits of technology

It simplifies the reaction process, improves conversion efficiency, reduces intermediate accumulation, lowers process separation costs, and provides a more efficient green biocatalytic pathway.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121975877A_ABST
    Figure CN121975877A_ABST
Patent Text Reader

Abstract

The invention discloses a difunctional alcohol dehydrogenase derived from Geobacillus thermodenitrifis, the difunctional alcohol dehydrogenase takes NAD < + > as a cofactor, can specifically catalyze a continuous oxidation reaction of omega-hydroxy fatty acid, and catalyzes the omega-hydroxy fatty acid to synthesize alpha, omega-binary fatty acid through single enzyme catalysis without an aldehyde intermediate. The alcohol dehydrogenase has dual catalytic functions of alcohol oxidation and aldehyde oxidation, the oxidation process from hydroxymethylene to carboxyl can be completed in one step, the reaction steps are simplified, accumulation and separation of intermediate aldehyde are avoided, the conversion efficiency is improved, and the alcohol dehydrogenase is alpha, omega-dibasic fatty acid and is a novel alcohol dehydrogenase. The invention provides a simple and efficient biocatalysis way for biosynthesis of dodecanedioic acid, especially dodecanedioic acid, and has important industrial application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of enzyme catalysis engineering technology, specifically to the application of an alcohol dehydrogenase derived from *Geobacillus thermodenitrificans* in the catalytic synthesis of α,ω-dicarboxylic acids from ω-hydroxy fatty acids. Background Technology

[0002] Lauric acid has important applications in polymer materials, plasticizers, and fine chemicals, and market demand is steadily increasing. Traditional production processes, based on petroleum-based feedstocks, typically require multiple chemical oxidation steps, resulting in complex catalytic systems and potentially generating environmentally harmful byproducts. With increasing demands for green industrial practices, constructing biocatalytic pathways based on fatty acid substrates has become a crucial technological direction for replacing traditional processes. The oxidation of the terminal CH bond in fatty acids is a common reaction catalyzed by heme-dependent cytochrome P450 monooxygenases (CYPs), producing the corresponding 12-hydroxylauric acid. In existing biocatalytic pathways, 12-hydroxylauric acid is usually converted to the corresponding dicarboxylic acid through a series of oxidation reactions. This process generally employs a two-step oxidation mechanism: first, the terminal hydroxyl group is oxidized to an aldehyde intermediate under the catalysis of alcohol dehydrogenase (ADH), and then further oxidized to a carboxylic acid under the action of aldehyde dehydrogenase (ALDH). This strategy requires the sequential reaction of two different types of catalytic enzymes, which makes the enzyme system construction complex. The intermediate aldehyde is prone to accumulate in the system and cause side reactions, which is not conducive to improving the reaction efficiency and also increases the separation cost of subsequent processes.

[0003] To improve reaction efficiency, studies have attempted to combine ADH and ALDH expression or construct cascade reaction systems. However, problems remain, including uneven enzyme expression, limited catalytic efficiency, and difficulties in controlling intermediates. Furthermore, aldehyde intermediates themselves possess reactivity and potential toxicity; their accumulation can adversely affect cell growth and catalytic stability, further limiting the industrialization potential of this pathway. Therefore, developing novel biocatalytic strategies capable of directly oxidizing hydroxyl to carboxyl groups in a single enzyme system is an effective way to address these issues.

[0004] Summary of the Invention

[0005] This invention, through screening and research of alcohol dehydrogenases from various sources, yielded an alcohol dehydrogenase derived from *Geobacillus thermodenitrificans* (named ADH2). This enzyme possesses both alcohol oxidation and aldehyde oxidation activities and can utilize NAD+. +This technology enables the continuous oxidation of ω-hydroxy fatty acids to synthesize α,ω-dicarboxylic acids.

[0006] The specific technical solution of this invention is as follows:

[0007] The application of alcohol dehydrogenase (ADH2) derived from *Geobacillus thermodenitrificans* in the catalytic synthesis of α,ω-dicarboxylic acids from ω-hydroxy fatty acids. The amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:1.

[0008] The alcohol dehydrogenase described in this invention uses NAD3. + As a cofactor, it oxidizes ω-hydroxy fatty acids to α,ω-dicarboxylic acids in one step.

[0009] Preferably, the ω-hydroxy fatty acid is a C8~C16 saturated ω-hydroxy fatty acid.

[0010] In a specific example of the present invention, the ω-hydroxy fatty acid is 12-hydroxylauric acid.

[0011] A specific example of the application described in this invention is that the reaction system contains 2 mM substrate (100 mM substrate dissolved in DMSO), 0.5 mg / mL purified ADH2 enzyme solution, and NAD+ to a final concentration of 0.1 mM. + To activate the enzyme reaction, the reaction was carried out at 45°C and 1000 rpm for 2 h.

[0012] Advantages of this invention:

[0013] This invention addresses the problem of existing technologies that commonly employ a two-step oxidation mechanism involving alcohol dehydrogenases and aldehyde dehydrogenases, resulting in the production of the intermediate aldehyde. It screens out a novel bifunctional alcohol dehydrogenase that utilizes NAD+. + The cofactor completes the one-step oxidation of hydroxymethylene to carboxyl groups, thereby simplifying the reaction process, improving conversion efficiency, and providing a more efficient biocatalytic pathway for the green bio-based production of dicarboxylic acids. Attached Figure Description

[0014] The accompanying drawings, which form part of this application, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0015] Figure 1 SDS-PAGE electrophoresis analysis of alcohol dehydrogenase ADH2. Lane 1 contains the soluble crude enzyme solution expressed intracellularly, lane 2 is the blank control, and lane 3 contains the purified enzyme.

[0016] Figure 2 Screening results for bifunctional alcohol dehydrogenases.

[0017] Figure 3 Enzymatic properties analysis of the bifunctional alcohol dehydrogenase ADH2, including (a) optimal temperature, (b) temperature stability, (c) optimal pH, and (d) pH stability.

[0018] Figure 4 The results of catalysis and mass spectrometry of 12-hydroxylauric acid by the bifunctional alcohol dehydrogenase ADH2 are presented.

[0019] Figure 5 The results show the catalytic effect of the bifunctional alcohol dehydrogenase ADH2 on 12-hydroxylauric acid in the reaction system with ADH and ALDH. Detailed Implementation

[0020] To enable those skilled in the art to better understand the present invention, the invention will be further described below with reference to the accompanying drawings and embodiments. It should be noted that these embodiments are only for explaining the invention and not for limiting its scope. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.

[0021] Example 1: Preparation of alcohol dehydrogenase ADH2

[0022] (1) Construction of engineered bacteria expressing bifunctional alcohol dehydrogenase ADH2

[0023] The bifunctional alcohol dehydrogenase ADH2 described in this invention is derived from *Geobacillus thermodenitrificans*, and its amino acid sequence is shown in SEQ ID NO:1. To improve protein expression, a recombinant *E. coli* expression vector was constructed. The enzyme was prepared according to the literature *Microbiology* (2009), 155, 2078-2085. Using genomic DNA of the strain *Geobacillus thermodenitrificans* as a template, high-fidelity enzyme 2×Phanta Max Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and primer pair BF(5'CG) were used. CATATG CAAAATTTTACGTTTCGCAATCCG 3', Nde I) and BR (5'GC CTCGAGPCR amplification was performed using ATTTCTGCGTGCGTTTTACCG 3', Xho I), following the experimental procedures outlined in the Vazyme biological products and user manual. The amplified coding gene DNA fragment should be 1161 bp. Nucleic acid electrophoresis verified the correct band length, and its base sequence is shown in SEQ ID NO:2. The amplified DNA fragment was then digested with Dpn I to digest the template DNA. After digestion, the PCR product was purified to remove primers, enzymes, mononucleotides, etc. This step was performed using the AxyPrep PCR Clean up kit.

[0024] The purified DNA fragment was double-digested with the vector pET-22b(+) using Nde I and Xho I (Baori Biotechnology Co., Ltd.). Each digestion was performed in 50 μl solutions, following the instructions of the DNA restriction endonuclease manufacturers. After digestion, the DNA fragment was recovered using a gel. Ligation of the vector DNA and the fragment DNA was carried out at a molar ratio of 1:3, using a 10 μl ligation solution catalyzed by T4 ligase. Ligation was performed overnight at 16°C to obtain the plasmid pET22b-ADH2. After ligation, the ligation solution was transformed into competent E. coli BL21(DE3) cells using the heat shock method and plated on LB agar plates containing 100 μg / ml ampicillin, incubated at 37°C for 14-16 h. Sequencing results were verified by sequencing (performed by Anhui General Biotechnology Co., Ltd.), yielding the corresponding recombinant strain E. coli BL21(DE3)-ADH2.

[0025] (2) Expression of alcohol dehydrogenase ADH2

[0026] The recombinant strain constructed in step (1) was inoculated into 50 mL of LB liquid medium, and ampicillin was added to a final concentration of 100 µg / mL. The culture was incubated overnight at 37°C at 180 rpm / min. 2% of the overnight cultured seed culture was inoculated into 50 mL of fresh LB liquid medium and incubated at 37°C at 180 rpm / min until the OD600 reached 0.6–1.0. IPTG (final concentration 0.1 mM) was then added, and expression was induced at 20°C for 16–20 h. The induced fermentation broth was centrifuged at 12000 rpm / min for 10 min, the supernatant was discarded, and the cells were resuspended in a 50 mM K2HPO4-KH2PO4 (pH 8.3) buffer. The cells were then sonicated and subjected to SDS-PAGE electrophoresis. The stacking gel concentration was 4%, the separating gel concentration was 12.5%, and the sample was mixed with the loading buffer at a 3:1 ratio. The mixture was reacted in a boiling water bath for 5 min before electrophoresis. The electrophoresis apparatus was initially set to 120V. As the sample moved to the separating gel, the voltage was increased to 230V until the sample reached the bottom of the electrophoresis tank, at which point the electrophoresis ended. The results are as follows: Figure 1 As shown, the molecular weight of ADH2 is 42.8 kDa, which is consistent with the calculated molecular weight, indicating that ADH2 was successfully induced and expressed, accounting for about 80% of the total soluble protein.

[0027] (3) Isolation and purification of alcohol dehydrogenase ADH2

[0028] Because ADH2 has a six-histidine (His) tag fused to its N-terminus, nickel chloride in the Ni column can bind to proteins containing the His tag and also to imidazole. Therefore, the Ni column was used to purify the target protein separately. Example 2: After centrifugation, the supernatant from the fermentation expression was filtered through a 0.22 μm filter. The Ni column was washed with Buffer A (50 mM Tris-HCl, pH 8.0) at a flow rate of 2 mL / min until equilibration. The protein sample was injected into the injection loop using a syringe, and the breakthrough protein was collected. The Ni column was washed again with Buffer A (50 mM Tris-HCl, pH 8.0) until no protein was eluted. The target protein was eluted using a gradient of 20% Buffer B (50 mM Tris-HCl, 500 mM imidazole, pH 8.0). The protein solution purified by nickel column was subjected to desalting using a pre-packed GE desalting column. The imidazole-containing buffer was replaced with 50 mM Tris-HCl (pH 8.0) to remove imidazole from the protein solution. The collected protein solution was validated by SDS-PAGE, and the results are shown below. Figure 1 The amino acid sequencing results were consistent with those of SEQ ID NO:1.

[0029] Following the above method, pure enzyme solutions of alcohol dehydrogenase ABO (ABO67118.1) from Geobacillus thermodenitrificans NG80-2, alcohol dehydrogenase 101 (WP_088554065.1) from Calderihabitans maritimus, and alcohol dehydrogenase VEG (VEG72963.1) from Pasteurella aerogenes were prepared.

[0030] Example 2 Screening of bifunctional alcohol dehydrogenases

[0031] Enzyme activity assay: The recombinant strain constructed in Example 1 was fermented and cultured according to the method in Example 2. The enzyme activity of the obtained crude protein enzyme solution was measured using 12-hydroxylauric acid as a substrate. The assay method is as follows:

[0032] Enzyme activity unit definition: One enzyme activity unit is the amount of enzyme required to catalyze the production of 1 μmol of lauryl iodide per minute from 12-hydroxylauric acid at 30℃ and pH 8.3.

[0033] Accurately weigh 20 mg of 12-hydroxylauric acid and dissolve it in 1 mL of DMSO. Mix well to obtain a 100 mM substrate solution. Accurately pipette 10 μL of the substrate solution into a reaction vessel, add 45 μL of appropriately diluted enzyme solution, and add NAD+ to a final concentration of 0.1 mM. + Using an inactivated enzyme reaction solution as a control, the reaction was carried out at 30 °C for 30 min, and the product formation was detected by gas chromatography. The gas chromatography results showed that the target product was detected in both ABO and ADH2, with ADH2 showing higher enzyme activity than ABO. The reaction could not be achieved with 101 and VEG. Figure 2 As shown.

[0034] Example 3: Stability analysis of the bifunctional alcohol dehydrogenase ADH2

[0035] To determine the optimal conditions for the catalytic reaction of ADH2, the optimum temperature and temperature stability of ADH2 were measured. Optimal temperature: The purified enzyme obtained in Example 4 was appropriately diluted and added to the substrate solution prepared in Example 3. The solutions were then reacted in water baths at 20 °C, 25 °C, 30 °C, 35 °C, 40 °C, 45 °C, 50 °C, 55 °C, 60 °C, 65 °C, and 70 °C for 30 min. Product formation was detected by gas chromatography, and enzyme activity at each temperature was calculated according to a standard curve. Figure 3 As shown, the optimal temperature for ADH2 is 45 ℃.

[0036] Temperature stability: The purified enzyme obtained in Example 4 was appropriately diluted and incubated in water baths at 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, and 70 ℃ for 2 h each. After incubation, samples were taken and the remaining enzyme activity was measured according to the enzyme activity assay method in Example 3. The highest enzyme activity at 0 h was taken as 100%, and the relative enzyme activity after incubation at each temperature was calculated. Curves showing the changes in residual enzyme activity under different incubation conditions were plotted. The results are as follows: Figure 4 As shown, after ADH2 was incubated at 20–45°C for 2 hours, the original enzyme activity was minimally lost, retaining 80% of the enzyme activity.

[0037] Example 4: Catalytic effect of the bifunctional alcohol dehydrogenase ADH2 and ADH+ALDH catalytic system on 12-hydroxylauric acid

[0038] To investigate whether there are differences between the ADH2 catalytic system and those of ADH and ALDH, this example uses 12-hydroxylauric acid as a substrate to study the two systems. The reaction system contained 2 mM substrate (100 mM substrate dissolved in DMSO), 0.5 mg / mL purified ADH2 enzyme solution / ADH (NC_001147.6) + ALDH (CCG96717.1) enzyme solution, and NAD+ was added to a final concentration of 0.1 mM. + The enzyme reaction was activated. The reaction was carried out at 45℃ and 1000 rpm for 2 h. After the reaction, the product concentration was determined by gas chromatography (GC). The GC analysis conditions were as follows: HP-5 capillary column (30 m × 0.320 mm id × 0.25 μm) and flame ionization detector (FID).

[0039] Experimental results Figure 5 As shown, the results indicate that under the same protein concentration conditions in the system, ADH2 single enzyme can achieve the same level of catalytic reaction as ADH and ALDH dual enzymes.

Claims

1. Application of alcohol dehydrogenase derived from Geobacillus thermodenitrificans in the catalytic synthesis of α,ω-dicarboxylic acids from ω-hydroxy fatty acids.

2. The application as described in claim 1, characterized in that... The amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

1.

3. The application as described in claim 1, characterized in that... The alcohol dehydrogenase uses NAD + As a cofactor, it oxidizes ω-hydroxy fatty acids to α,ω-dicarboxylic acids in one step.

4. The application as described in any one of claims 1 to 3, characterized in that... The ω-hydroxy fatty acid is a C8~C16 saturated ω-hydroxy fatty acid.

5. The application as described in claim 4, characterized in that... The ω-hydroxy fatty acid is 12-hydroxylauric acid.