HDR enhancer for improving cell homologous recombination efficiency and application thereof

By using a combination of SCR-7, M3814, Romidepsin, and L755507, the non-homologous end junction repair pathway is inhibited, cell cycle G2/M phase arrest and chromatin opening are promoted, and RAD51 activity is enhanced. This solves the problems of low cell homologous recombination efficiency and reagent toxicity in existing technologies, and achieves efficient and safe homologous recombination.

CN122012629APending Publication Date: 2026-05-12GUANGZHOU UBIGENE BIOSCIENCES CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610159964.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

Existing methods for improving the efficiency of homologous recombination in cells lack synergistic effects, and common reagents have cytotoxicity or mutagenicity, affecting gene editing efficiency.

Method used

By using SCR-7 and M3814 to inhibit the non-homologous end junction repair pathway, Romidepsin promotes cell cycle arrest in the G2/M phase and the opening of chromatin structure, while L755507 enhances RAD51 activity. Through the synergistic regulation of multiple signaling pathways, homologous recombination is promoted.

Benefits of technology

It significantly improves the efficiency of homologous recombination in cells, reduces the toxic effects of reagents on cells, and ensures the effectiveness and safety of gene editing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012629A_ABST
    Figure CN122012629A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of gene engineering, in particular to an HDR enhancer for improving cell homologous recombination efficiency and application of the HDR enhancer, and the HDR enhancer for improving the cell homologous recombination efficiency comprises an inhibitor of a non-homologous end connection repair pathway and an intracellular homologous recombination accelerant; the inhibitors of the non-homologous end connection repair pathway are SCR-7 and M3814, the intracellular homologous recombination accelerators are L755507 and Romidepsin, the four agents synergistically target an NHEJ signal pathway, the cell cycle, chromatin structure opening and HDR signal pathway are regulated and controlled at the same time, and the problem that an existing reagent for improving the cell homologous recombination efficiency is insufficient in synergistic effect is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an HDR enhancer for improving the efficiency of homologous recombination in cells and its applications. Background Technology

[0002] DNA repair mechanisms mainly include two types: non-homologous DNA end joining (NHEJ) and homology-directed repair (HDR). NHEJ is a rapid repair method that directly glues broken genome segments together without relying on DNA homology. This repair method is relatively efficient and can occur at any stage of cell growth. Homology-directed repair, on the other hand, is a precise method of repairing broken DNA. It requires homologous DNA as a template for repair and usually only occurs in the S-G2 / M phase of the cell, resulting in lower cell editing efficiency.

[0003] Cellular gene point mutation technology or gene knock-in technology, developed based on the CRISPR / Cas9 system, creates double-strand breaks in the genome by cutting DNA at specific sites, providing a specific homologous recombination sequence. This allows cells to repair the DNA double-strand breaks through homologous recombination while inserting the desired fragment into the genome. However, the probability and efficiency of homologous recombination are low, resulting in a low success rate for constructing point mutation or gene knock-in cells.

[0004] Therefore, current methods to improve the efficiency of homologous recombination in cells mainly include inhibiting NHEJ, cell cycle arrest, or promoting chromatin structure opening. Many reagents used for cell cycle regulation and chromatin modification lack sufficient synergistic effects and possess strong cytotoxicity or mutagenicity, leading to decreased cell viability and even non-specific gene damage, affecting subsequent gene editing efficiency and the construction of mutant cells. Summary of the Invention

[0005] To address the aforementioned shortcomings, the present invention aims to propose an HDR enhancer for improving the efficiency of homologous recombination in cells and its application, thereby solving the problem of insufficient synergistic effect of existing reagents for improving the efficiency of homologous recombination in cells.

[0006] To achieve this objective, the present invention adopts the following technical solution: An HDR enhancer for improving the efficiency of homologous recombination in cells, comprising an inhibitor of the non-homologous end junction repair pathway and an intracellular homologous recombination promoter; The inhibitors of the non-homologous end junction repair pathway are SCR-7 and M3814, and the intracellular homologous recombination promoters are L755507 and Romidepsin.

[0007] Preferably, the working concentration of SCR-7 is 1-20 μM, the working concentration of Romidepsin is 0.001-0.2 μM, the working concentration of M3814 is 0.1-10 μM, and the working concentration of L7555507 is 0.1-20 μM.

[0008] Preferably, the HDR enhancer is composed of SCR-7, Romidepsin, M3814 and L755507; The working concentrations of SCR-7 are 1-20 μM, Romidepsin is 0.001-0.2 μM, M3814 is 0.1-10 μM, and L7555507 is 0.1-20 μM.

[0009] Furthermore, the HDR enhancer is composed of SCR-7, Romidepsin, M3814, and L755507; The working concentrations of SCR-7 and Romidepsin are 5 μM, 0.1 μM, 5 μM, and 20 μM, respectively.

[0010] A method for improving the efficiency of homologous recombination in cells, using any of the above-mentioned HDR enhancers, includes the following steps: S1. Based on the required volume of complete culture medium and the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. S2. Prepare a premixed complex for gene editing, mix it with cells for electroporation, and transfer the cells after electroporation to a cell culture medium containing HDR enhancer for further culture.

[0011] Preferably, in step S2, the steps prior to cultivation are as follows: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 -4×10 5 Transfer each cell to a centrifuge tube, centrifuge, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add the required sgRNA, donor template and cas9 protein, and add electroporation buffer to make up to 10ul, mix well to obtain the premixed complex, and let stand for later use; (4) Mix the premixed complex thoroughly with the centrifuged cells and set the electroporation parameters for electroporation.

[0012] Preferably, in step S1, the pre-prepared cell culture medium containing HDR enhancer needs to be preheated in an incubator at 37°C.

[0013] Preferably, in step (2), the centrifugation conditions are 300g centrifugation for 3min.

[0014] The technical solution provided by this invention may include the following beneficial effects: 1. This protocol provides an HDR enhancer to improve the efficiency of homologous recombination in cells. M3814 inhibits DNA-dependent protein kinase, and SCR-7 inhibits DNA ligase IV, respectively blocking the non-homologous end joining repair pathway from upstream recognition and downstream ligation. Romidepsin causes cell cycle arrest in the G2 / M phase, accumulating cells active in homologous recombination to meet the demand for homologous recombination. It also opens chromatin structure, making it easier for DNA repair mechanism-related factors to approach the break ends. With the non-homologous end joining repair pathway inhibited by M3814 and SCR-7, the non-homologous end joining-related factors are also inhibited, making it easier for homologous recombination-related factors to approach the break ends and promote homologous recombination. The use of L755507 directly enhances the activity of RAD51, promoting efficient search for homologous recombination templates. The four synergistically target the NHEJ signaling pathway, cell cycle, chromatin structure opening, and HDR signaling pathway, simultaneously regulating them, and significantly improving the efficiency of intracellular homologous recombination.

[0015] 2. By limiting the working concentration of each component, the toxicity of HDR enhancers to cells can be reduced, ensuring the effective performance of HDR enhancers and further improving the efficiency of homologous recombination in cells. Attached Figure Description

[0016] Figure 1 This is a cell state diagram of Example 1-1 of the present invention.

[0017] Figure 2 This is a diagram showing the homologous recombination analysis results of Example 1-1 of the present invention.

[0018] Figure 3 This is a cell state diagram of Comparative Example 1-1 of the present invention.

[0019] Figure 4 This is a graph showing the homologous recombination analysis results of Comparative Example 1-1 of the present invention.

[0020] Figure 5 These are cell state diagrams of Comparative Examples 1-2 of the present invention.

[0021] Figure 6 This is a graph showing the homologous recombination analysis results of Comparative Examples 1-2 of the present invention.

[0022] Figure 7These are cell state diagrams of Comparative Examples 1-3 of the present invention.

[0023] Figure 8 These are the homologous recombination analysis results of Comparative Examples 1-3 of the present invention.

[0024] Figure 9 These are cell state diagrams of Comparative Examples 1-4 of the present invention.

[0025] Figure 10 These are the homologous recombination analysis results of Comparative Examples 1-4 of the present invention.

[0026] Figure 11 This is a cell state diagram of Example 2-1 of the present invention.

[0027] Figure 12 This is a diagram showing the homologous recombination analysis results of Embodiment 2-1 of the present invention.

[0028] Figure 13 This is a cell state diagram of Example 2-2 of the present invention.

[0029] Figure 14 This is a diagram showing the homologous recombination analysis results of Embodiment 2-2 of the present invention.

[0030] Figure 15 This is a cell state diagram of Comparative Example 2-1 of the present invention.

[0031] Figure 16 This is a graph showing the homologous recombination analysis results of Comparative Example 2-1 of the present invention.

[0032] Figure 17 This is a cell state diagram of Comparative Example 2-2 of the present invention.

[0033] Figure 18 This is a graph showing the homologous recombination analysis results of Comparative Example 2-2 of the present invention.

[0034] Figure 19 These are cell state diagrams of Comparative Examples 2-3 of the present invention.

[0035] Figure 20 This is a graph showing the homologous recombination analysis results of Comparative Examples 2-3 of the present invention. Detailed Implementation

[0036] The technical solution of the present invention will be further illustrated below through specific embodiments.

[0037] To facilitate understanding of the present invention, a more complete description is provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0038] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0039] An HDR enhancer for improving the efficiency of homologous recombination in cells, comprising an inhibitor of the non-homologous end junction repair pathway and an intracellular homologous recombination promoter; The inhibitors of the non-homologous end junction repair pathway are SCR-7 and M3814, and the intracellular homologous recombination promoters are L755507 and Romidepsin.

[0040] To address the problems existing in the prior art, this invention proposes a reagent for improving the efficiency of homologous recombination in cells, comprising an inhibitor of the non-homologous end joining repair pathway and an intracellular homologous recombination promoter. The inhibitors of the non-homologous end joining repair pathway are SCR-7 and M3814, and the intracellular homologous recombination promoters are L755507 and Romidepsin. These four components target the NHEJ signaling pathway, cell cycle, chromatin structure opening, and HDR signaling pathway, jointly promoting homologous recombination from four aspects. Specifically, SCR-7, as a small molecule inhibitor, can inhibit the non-homologous end joining pathway. SCR-7 can non-covalently bind to the DNA-binding domain of DNA ligase IV, thus acting as a competitive inhibitor of DNA ligase IV, preventing it from binding to its active site. DNA ligase IV is the core end ligase in the non-homologous end joining pathway, responsible for catalyzing the joining of broken DNA ends. By using SCR-7, the normal function of DNA ligase IV is prevented, thereby inhibiting the non-homologous end joining pathway. Blocking the pathway forces cells to switch to homologous recombination. M3814 is an inhibitor of DNA-dependent protein kinases (DNA-dependent kinases), which are rapidly activated upon recognizing DNA double-strand breaks and initiate non-homologous end (NLOS) repair pathways. M3814 inhibits DNA-dependent kinases, thereby inhibiting NLOS repair. L755507 enhances the activity of RAD51 protein. RAD51, as a core protein of homologous recombination, can form nucleoprotein filaments at DNA double-strand breaks. L755507 enhances the activity of RAD51, thereby... Romidepsin promotes intracellular homologous recombination. It is a highly effective histone deacetylase inhibitor that increases histone acetylation levels by inhibiting histone deacetylase activity. This neutralizes the positive charge of histones, weakens the binding force between histones and negatively charged DNA, and makes the chromatin structure looser and more open. The open chromatin structure makes it easier for the homologous recombination repair template to approach the DNA break site and complete the initiation step of homologous recombination. It also makes it easier for Cas9 protein to access the target DNA sequence, improving the cleavage efficiency. At the same time, it induces G2 / M phase arrest, allowing cells to accumulate in the cell cycle stage where homologous recombination is active.

[0041] Therefore, M3814 inhibits DNA-dependent protein kinase, and SCR-7 inhibits DNA ligase IV, blocking upstream recognition and downstream ligation respectively. This synergistic effect inhibits the non-homologous end ligation repair pathway. Romidepsin causes cell cycle arrest in the G2 / M phase, accumulating cells active in homologous recombination to meet the demands of homologous recombination. It also opens chromatin structures, making it easier for DNA repair mechanisms to access the broken ends. With the non-homologous end ligation repair pathway inhibited by M3814 and SCR-7, the factors related to non-homologous end ligation are also inhibited, making it easier for homologous recombination factors to access the broken ends and promoting homologous recombination. Under these favorable conditions, the use of L755507 directly enhances RAD51 activity, promoting efficient search for homologous recombination templates. These four agents synergistically target the NHEJ signaling pathway, cell cycle, chromatin structure opening, and HDR signaling pathway, simultaneously regulating these pathways and significantly improving intracellular homologous recombination efficiency, thus addressing the problem of insufficient synergistic effects in existing reagents for improving cellular homologous recombination efficiency.

[0042] Preferably, the working concentration of SCR-7 is 1-20 μM, the working concentration of Romidepsin is 0.001-0.2 μM, the working concentration of M3814 is 0.1-10 μM, and the working concentration of L7555507 is 0.1-20 μM.

[0043] Specifically, the four components themselves possess certain cytotoxic or mutagenic properties, which can lead to decreased cell viability and even non-specific gene damage, affecting subsequent gene editing efficiency and the construction of mutant cells. Therefore, the working concentrations are limited to 1-20 μM for SCR-7, 0.001-0.2 μM for Romidepsin, 0.1-10 μM for M3814, and 0.1-20 μM for L7555507. When using these components, the required amount should be calculated based on the volume of the complete culture medium to be mixed. At these working concentrations, the toxic effects of the HDR enhancer on cells and its impact on homologous recombination are effectively reduced, ensuring that the HDR enhancer promotes homologous recombination while effectively preventing toxic effects on cells.

[0044] Preferably, the HDR enhancer is composed of SCR-7, Romidepsin, M3814 and L755507; The working concentrations of SCR-7 are 1-20 μM, Romidepsin is 0.001-0.2 μM, M3814 is 0.1-10 μM, and L7555507 is 0.1-20 μM.

[0045] Specifically, the HDR enhancer is composed of SCR-7, Romidepsin, M3814 and L755507, which simultaneously regulate four signaling pathways to improve the efficiency of homologous recombination in cells.

[0046] Furthermore, the HDR enhancer is composed of SCR-7, Romidepsin, M3814, and L755507; The working concentrations of SCR-7 and Romidepsin are 5 μM, 0.1 μM, 5 μM, and 20 μM, respectively.

[0047] Specifically, at this concentration, the HDR enhancer can significantly reduce cytotoxicity and better improve the efficiency of homologous recombination in cells.

[0048] A method for improving the efficiency of homologous recombination in cells, using any of the above-mentioned HDR enhancers, includes the following steps: S1. Based on the required volume of complete culture medium and the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. S2. Prepare a premixed complex for gene editing, mix it with cells for electroporation, and transfer the cells after electroporation to a cell culture medium containing HDR enhancer for further culture.

[0049] Specifically, the HDR enhancer needs to be mixed into the complete culture medium for cell culture to promote homologous recombination. In step S1, the content of each component to be added needs to be determined for the HDR enhancer and complete culture medium to be mixed, specifically corresponding to the working concentration requirements of each component. Specifically, according to the converted concentration requirements, the four components are mixed to form the HDR enhancer and then added to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. Cell electroporation allows the added components to enter the cells and exert their effects. The HDR enhancer exerts its effects after cell electroporation.

[0050] Preferably, in step S2, the steps prior to cultivation are as follows: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 -4×10 5 Transfer each cell to a centrifuge tube, centrifuge, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add the required sgRNA, donor template and cas9 protein, and add electroporation buffer to make up to 10ul, mix well to obtain the premixed complex, and let stand for later use; (4) Mix the premixed complex thoroughly with the centrifuged cells and set the electroporation parameters for electroporation.

[0051] Specifically, the premixed complex in step (3) is a mixture of all components required for CRISPR / Cas9 system-based cell gene point mutation technology or gene knock-in technology. In specific applications, the corresponding sgRNA, oligonucleotides, Cas9 protein, and electroporation buffer can be selected and used according to the needs of gene editing. In addition, the electroporation parameters can also be set according to the gene editing requirements. Among them, the oligonucleotides are the corresponding donor templates, which serve as templates for homologous recombination.

[0052] In step (1), the confluence of cells is limited to ensure that the cells are in the logarithmic growth phase, which can improve the electroporation efficiency. At the same time, in step (2), the number of cells is limited to ensure that the cell density distribution in the electroporation system is uniform and to guarantee the transfection efficiency.

[0053] It is worth noting that during steps (3) and (4), it is necessary to avoid the generation of bubbles.

[0054] Preferably, in step S1, the pre-prepared cell culture medium containing HDR enhancer needs to be preheated in an incubator at 37°C.

[0055] Specifically, preheating the cell culture medium containing the HDR enhancer reduces cell stress when it is taken out for use, and preheating can maintain the activity of the HDR enhancer.

[0056] Preferably, in step (2), the centrifugation conditions are 300g centrifugation for 3min.

[0057] Specifically, under these centrifugation conditions, ensure that the cell pellet obtained by centrifugation is easily dispersed. When mixing the premixed complex and cells in step (4), avoid the formation of cell clumps, ensure uniform mixing, and guarantee transfection efficiency.

[0058] The technical solution of the present invention will be further illustrated below through specific embodiments.

[0059] Example Group 1 Example 1-1 S1. According to the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. The HDR enhancers are SCR-7, Romidepsin, M3814, and L755507. In the cell culture medium containing the HDR enhancer, the concentration of SCR-7 is 10 μM, the concentration of Romidepsin is 0.2 μM, the concentration of M3814 is 10 μM, and the concentration of L7555507 is 50 μM. S2, Cell electroporation: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 Transfer each cell to a centrifuge tube, centrifuge at 300×g for 3 minutes, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add 50 pmol of sgRNA, 40 pmol of oligonucleotide sequence and cas9 protein, and add electroporation buffer to make up to 10 μL. Mix well to obtain a premixed complex and let it stand for later use. (4) Thoroughly mix the premixed complex with the centrifuged cells, set the electroporation parameters for electroporation, and seed the cells after electroporation into cell culture medium containing HDR enhancer. Incubate at 37°C and 5% CO2 for 48 hours, and observe the cell status. Figure 1 As shown.

[0060] Cell editing efficiency assay: Cultured cells were collected, and the cellular genome was extracted. Appropriate amplification primers were designed at the genomic mutation sites for PCR amplification. The PCR amplification products were then subjected to first-generation sequencing, and the efficiency of homologous recombination was analyzed and compared using the EZ-editor™ intelligent sequencing result analysis system (UBIGENE | Red Cotton™). The analysis results are as follows: Figure 2 As shown, the homologous recombination efficiency is 28%.

[0061] Comparative Example 1 Comparative Example 1-1 Compared with Example 1-1, the difference in Comparative Example 1-1 is that no HDR enhancer is required. In step (4), the cells after electroporation are seeded into a complete culture medium without the HDR enhancer for improving homologous recombination efficiency of this application. Other specific operations and cell editing efficiency detection methods are the same as in Example 1-1. The cultured cell state is as follows: Figure 3 As shown, the analysis results are as follows: Figure 4 As shown, the homologous recombination efficiency is 10%.

[0062] Comparative Examples 1-2 Compared to Examples 1-1, Comparative Examples 1-2 differ in that the HDR enhancer consists of SCR-7 and Romidepsin. The cell culture medium containing the HDR enhancer has a SCR-7 concentration of 10 μM and a Romidepsin concentration of 0.2 μM, and does not contain other HDR-promoting components. Other specific operations and cell editing efficiency detection methods are consistent with Examples 1-1, and the cultured cell state is as follows: Figure 5 As shown, the analysis results are as follows: Figure 6 As shown, the homologous recombination efficiency is 18%.

[0063] Comparative Examples 1-3 Compared with Examples 1-1, the difference between Comparative Examples 1-3 and Examples 1-3 is that the cell culture medium containing the HDR enhancer contains 10 μM of SCR-7 and 10 μM of M3814, but does not contain other HDR-promoting components. Other specific operations and cell editing efficiency detection methods are consistent with Examples 1-1, and the cultured cell states are as follows: Figure 7 As shown, the analysis results are as follows: Figure 8 As shown, the homologous recombination efficiency is 16%.

[0064] Comparative Examples 1-4 Compared with Examples 1-1, the difference between Comparative Examples 1-4 and Examples 1-4 is that the cell culture medium containing the HDR enhancer contains 10 μM of SCR-7 and 50 μM of L755507, but does not contain other HDR-promoting components. Other specific operations and cell editing efficiency detection methods are consistent with Examples 1-1, and the cultured cell states are as follows: Figure 9 As shown, the analysis results are as follows: Figure 10 As shown, the homologous recombination efficiency is 17%.

[0065] Example Group 2 Example 2-1 S1. According to the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. The HDR enhancer components are SCR-7, Romidepsin, M3814 and L755507; In the cell culture medium containing the HDR enhancer, the concentration of SCR-7 is 5 μM, the concentration of Romidepsin is 0.1 μM, the concentration of M3814 is 5 μM, and the concentration of L7555507 is 20 μM. S2, Cell electroporation: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5Transfer each cell to a centrifuge tube, centrifuge at 300×g for 3 minutes, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add 50 pmol of sgRNA, 40 pmol of oligonucleotide sequence and cas9 protein, and add electroporation buffer to make up to 10 μL. Mix well to obtain a premixed complex and let it stand for later use. (4) Thoroughly mix the premixed complex with the centrifuged cells, set the electroporation parameters, and perform electroporation. After electroporation, seed the cells into cell culture medium containing HDR enhancer and incubate them statically at 37°C and 5% CO2 for 48 hours. The cultured cells are in the following state: Figure 11 As shown.

[0066] Cell editing efficiency assay: Cultured cells were collected, and the cellular genome was extracted. Appropriate amplification primers were designed at the genomic mutation sites for PCR amplification. The PCR amplification products were then subjected to first-generation sequencing, and the efficiency of homologous recombination was analyzed and compared using the EZ-editor™ intelligent sequencing result analysis system (UBIGENE | Red Cotton™). The analysis results are as follows: Figure 12 As shown, the homologous recombination efficiency is 74%.

[0067] Example 2-2 S1. According to the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. The HDR enhancer components are SCR-7, Romidepsin, M3814 and L755507; In the cell culture medium containing the HDR enhancer, the concentration of SCR-7 is 3 μM, the concentration of Romidepsin is 0.1 μM, the concentration of M3814 is 3 μM, and the concentration of L7555507 is 10 μM. S2, Cell electroporation: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 Transfer each cell to a centrifuge tube, centrifuge at 300×g for 3 minutes, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add 50 pmol of sgRNA, 40 pmol of oligonucleotide sequence and cas9 protein, and add electroporation buffer to make up to 10 μL. Mix well to obtain a premixed complex and let it stand for later use. (4) Thoroughly mix the premixed complex with the centrifuged cells, set the electroporation parameters, and perform electroporation. After electroporation, seed the cells into cell culture medium containing HDR enhancer and incubate them statically at 37°C and 5% CO2 for 48 hours. The cultured cells are in the following state: Figure 13 As shown.

[0068] Cell editing efficiency assay: Cultured cells were collected, and the cellular genome was extracted. Appropriate amplification primers were designed at the genomic mutation sites for PCR amplification. The PCR amplification products were then subjected to first-generation sequencing, and the efficiency of homologous recombination was analyzed and compared using the EZ-editor™ intelligent sequencing result analysis system (UBIGENE | Red Cotton™). The analysis results are as follows: Figure 14 As shown, the homologous recombination efficiency is 62%.

[0069] Comparative Example 2 Comparative Example 2-1 Compared with Example 2-1, the difference in Comparative Example 2-1 is that no HDR enhancer is required. In step (4), the cells after electroporation are seeded into a complete culture medium without the HDR enhancer for improving homologous recombination efficiency of this application. Other specific operations and cell editing efficiency detection methods are the same as in Example 2-1. The cultured cell state is as follows: Figure 15 As shown, the analysis results are as follows: Figure 16 As shown, the homologous recombination efficiency is 3%.

[0070] Comparative Example 2-2 S1. According to the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. The HDR enhancer components are SCR-7, Romidepsin, M3814 and L755507; In the cell culture medium containing the HDR enhancer, the concentration of SCR-7 is 10 μM, the concentration of Romidepsin is 0.2 μM, the concentration of M3814 is 10 μM, and the concentration of L7555507 is 50 μM. S2, Cell electroporation: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 Transfer each cell to a centrifuge tube, centrifuge at 300×g for 3 minutes, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add 50 pmol of sgRNA, 40 pmol of oligonucleotide sequence and cas9 protein, and add electroporation buffer to make up to 10 μL. Mix well to obtain a premixed complex and let it stand for later use. (4) Thoroughly mix the premixed complex with the centrifuged cells, set the electroporation parameters, and perform electroporation. After electroporation, seed the cells into cell culture medium containing HDR enhancer and incubate them statically at 37°C and 5% CO2 for 48 hours. The cultured cells are in the following state: Figure 17 As shown.

[0071] Cell editing efficiency assay: Cultured cells were collected, and the cellular genome was extracted. Appropriate amplification primers were designed at the genomic mutation sites for PCR amplification. The PCR amplification products were then subjected to first-generation sequencing, and the efficiency of homologous recombination was analyzed and compared using the EZ-editor™ intelligent sequencing result analysis system (UBIGENE | Red Cotton™). The analysis results are as follows: Figure 18 As shown, the homologous recombination efficiency is 32%.

[0072] Comparative Examples 2-3 Compared to Example 2-1, the difference in Comparative Examples 2-3 lies in the concentration of each component in the cell culture medium containing the HDR enhancer. Specifically, the concentration of SCR-7 is 20 μM, the concentration of Romidepsin is 0.5 μM, the concentration of M3814 is 20 μM, and the concentration of L755507 is 100 μM. Other specific operations and cell editing efficiency detection methods are consistent with Example 2-1, and the cultured cell state is as follows: Figure 19 As shown, the analysis results are as follows: Figure 20 As shown, the homologous recombination efficiency is 2%.

[0073] It is worth noting that the premixed complex and cells used in Example Group 1 and Comparative Example Group 1 are the same. The sgRNA sequence used in Example Group 1 and Comparative Example Group 1 is ACTGGACACAGCTGGACAAG, the cell type is B16-F10, and the oligonucleotide sequence is: ACACAGAGGAACCCTTCGCCTGTCCTCATGTACTGGTCTCTCATGGCACTGTACTCCTCTTTTCCAGCTGTGTCCAGTATGTCCAGCAGGCAGGTCTCACCATCAATCACCACTTGCTTTC; The premixed complex and cells used in Example Group 2 and Comparative Example Group 2 were the same. The sgRNA sequence used in Example Group 2 and Comparative Example Group 2 was GAAGGGCATGTTGTGCTGTG, the cell type was HeLa, and the oligonucleotide sequence was: TCTCTCCATGCCTCATTCCTTCCCCTTCTCTCTCCCATCCCTCCTTCTCCTAACCACACAACACAACATGCCCTTCTGGAGGATATCCAGTCACTCAGACCTCCTGGCTCTCCACCAAGCAC.

[0074] In Example Group 1, the component concentration of the HDR enhancer in Comparative Example Group 1 was the same as that in Example 1-1. However, since the HDR enhancer used in each comparative example in Comparative Example Group 1 did not completely include all four components, it was impossible to jointly regulate multiple signaling pathways to improve homologous recombination efficiency. Therefore, the analysis results show that the homologous recombination efficiency of Example 1-1 was higher than that of Comparative Example Group 1, while the homologous recombination efficiencies of Comparative Examples 1-2, 1-3, and 1-4 were all higher than those of Comparative Example 1-1. This indicates that the use of HDR enhancer is beneficial to promoting homologous recombination and improving homologous recombination efficiency.

[0075] In Example Group 2, the concentrations of each component in the HDR enhancer used in Examples 2-1 and 2-2 were all within the working concentration ranges of 1-20 μM for SCR-7, 0.001-0.2 μM for Romidepsin, 0.1-10 μM for M3814, and 0.1-20 μM for L7555507. Although Comparative Example Group 2 also used an HDR enhancer composed of four components, the homologous recombination efficiency was not as high as that of Example Group 2. The working concentration of the HDR enhancer in Comparative Example 2-2 was the same as that in Example 1-1. The homologous recombination efficiency of Comparative Example 2-2 was higher than that of Comparative Example 2-1 without the addition of the HDR enhancer, but due to the cytotoxic effect, the increase was not as great as that in Example Group 2.

[0076] The technical principles of the present invention have been described above with reference to specific embodiments. These descriptions are merely for explaining the principles of the invention and should not be construed as limiting the scope of protection of the invention in any way. Based on this explanation, those skilled in the art can readily conceive of other specific embodiments of the invention without inventive effort, and these embodiments will all fall within the scope of protection of the present invention.

Claims

1. An HDR enhancer for improving the efficiency of homologous recombination in cells, characterized in that: Including inhibitors of the non-homologous end junction repair pathway and promoters of intracellular homologous recombination; The inhibitors of the non-homologous end junction repair pathway are SCR-7 and M3814, and the intracellular homologous recombination promoters are L755507 and Romidepsin.

2. The HDR enhancer for improving the efficiency of homologous recombination in cells according to claim 1, characterized in that: The working concentrations for SCR-7 are 1-20 μM, for Romidepsin 0.001-0.2 μM, for M3814 0.1-10 μM, and for L7555507 0.1-20 μM.

3. The HDR enhancer for improving the efficiency of homologous recombination in cells according to claim 1, characterized in that: The HDR enhancer consists of SCR-7, Romidepsin, M3814, and L755507; The working concentrations of SCR-7 are 1-20 μM, Romidepsin is 0.001-0.2 μM, M3814 is 0.1-10 μM, and L7555507 is 0.1-20 μM.

4. The HDR enhancer for improving the efficiency of homologous recombination in cells according to claim 3, characterized in that: The HDR enhancer consists of SCR-7, Romidepsin, M3814, and L755507; The working concentrations of SCR-7 and Romidepsin are 5 μM, 0.1 μM, 5 μM, and 20 μM, respectively.

5. A method for improving the efficiency of homologous recombination in cells, characterized in that, Using the HDR enhancer according to any one of claims 2-4 includes the following steps: S1. Based on the required volume of complete culture medium and the corresponding working concentration requirements, add the HDR enhancer to the complete culture medium to prepare a cell culture medium containing the HDR enhancer. S2. Prepare a premixed complex for gene editing, mix it with cells for electroporation, and transfer the cells after electroporation to a cell culture medium containing HDR enhancer for further culture.

6. The method for improving the efficiency of homologous recombination in cells according to claim 5, characterized in that, In step S2, the steps prior to cultivation are as follows: (1) When the cells reach a confluence of 70-80%, discard the culture medium, digest the cells with trypsin and count them; (2) Take 3×10 5 -4×10 5 Transfer each cell to a centrifuge tube, centrifuge, discard the supernatant, and obtain the centrifuged cells; (3) Take another centrifuge tube, add the required sgRNA, donor template and cas9 protein, and add electroporation buffer to make up to 10ul, mix well to obtain the premixed complex, and let stand for later use; (4) Mix the premixed complex thoroughly with the centrifuged cells and set the electroporation parameters for electroporation.

7. The method for improving the efficiency of homologous recombination in cells according to claim 5, characterized in that: In step S1, the pre-prepared cell culture medium containing HDR enhancer needs to be preheated in an incubator at 37°C.

8. The method for improving the efficiency of homologous recombination in cells according to claim 6, characterized in that: In step (2), the centrifugation conditions are 300g for 3 minutes.