Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for total RNA (ribonucleic acid) residual quantity of escherichia coli
By designing a real-time quantitative PCR method with specific primers and probes, the problem of high sensitivity and wide linear range detection of residual E. coli RNA in plasmids was solved, achieving accurate quantification of E. coli RNA in plasmid production, meeting safety requirements and reducing detection costs.
Patent Information
- Application Number
- CN202610042418.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-13
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are difficult to achieve accurate quantification of residual E. coli RNA in plasmids with high sensitivity, low detection limit, and wide linear range. Moreover, the operation is cumbersome and cannot meet the requirements for plasmid production process optimization and product release.
A real-time quantitative PCR method using specific primers and probes, combined with an optimized reaction system and procedure, including Taqman RT-PCR Buffer, TaqMan Enzyme Mix, ROX Reference Dye, specific primers and probes, was used for detection via one-step RT-qPCR.
It enables accurate and convenient detection of residual total RNA in Escherichia coli, with a detection limit as low as 2 pg/mL, a wide linear range, meets the safety requirements for plasmid production, and reduces detection costs.
Smart Images

Figure CN122012677A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of total RNA detection in Escherichia coli, and specifically to a real-time quantitative PCR method for detecting residual total RNA in Escherichia coli. Background Technology
[0002] In recent years, with the rapid development of gene and cell therapy and the widespread application of mRNA vaccine technology, plasmids, as core raw materials for gene delivery vectors, mRNA vaccine templates, and viral vector production, have shown broad prospects in gene therapy, cell therapy, vaccine development, infectious disease control, agriculture, and environmental protection. The US FDA explicitly stipulates that residual bacterial RNA in plasmid materials must be less than 1%. (Escherichia coli...) E. coli RNA residues from this source may activate the interferon pathway, triggering unwanted immune responses or inflammation, posing a potential threat to the safety of gene therapy or cell therapy products. Therefore, E. coli RNA residue detection has become an indispensable key indicator in plasmid production process optimization and finished product release.
[0003] Currently, common methods for detecting residual E. coli host RNA in plasmids include agarose gel electrophoresis, high-performance liquid chromatography (HPLC), and quantitative real-time PCR (qPCR). Agarose gel electrophoresis has low sensitivity, making precise quantification difficult, and is easily affected by DNA or protein contamination. HPLC is generally inferior to qPCR in terms of sequence specificity and sensitivity. Patent application CN201210202181.7 discloses a method for quantitative detection of E. coli RNA using a qPCR dye method, but its specificity is lower than the probe method, and it is a two-step RT-qPCR method, which is relatively cumbersome. Patent CN202310733025.1 reports a detection limit of 10 pg / mL, and its linear range and detection sensitivity still have room for improvement. Patent CN202410125081.1 achieves direct detection through optimization of the pretreatment system, but the experimental procedure is difficult to reproduce in other experimental environments.
[0004] Therefore, it is of great significance to develop a one-step RT-qPCR detection method with a wider linear range, lower detection limit, and the ability to effectively monitor the residual amount of E. coli RNA in plasmid products. Summary of the Invention
[0005] The purpose of this invention is to provide a real-time quantitative PCR method for detecting total RNA residues in Escherichia coli with a wider linear range and a lower detection limit.
[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides a real-time quantitative PCR method for detecting residual total RNA in *E. coli*. The reaction system of the real-time quantitative PCR method includes: 3-5 μL TaqMan RT-PCR Buffer (5×), 1-3 μL TaqManEnzyme Mix (10×), 0.3-0.5 μL ROX Reference Dye (50×), 1-1.5 μL 8-12 μM forward specific primer, 1-1.5 μL 8-12 μM reverse specific primer, 0.5-0.8 μL 8-12 μM specific probe, 4-6 μL standard or test sample, and RT-PCR grade water to a final volume of 20 μL. The reaction program of the real-time quantitative PCR method is: 52-54℃ for 4-6 min; 94-96℃ for 18-22 s; 94-96℃ for 4-6 s; 56-58℃ for 38-42 s, for 44-46 cycles.
[0007] According to some specific and preferred embodiments of the present invention, the reaction system of the real-time quantitative PCR detection method includes: 4 μL Taqman RT-PCR Buffer (5×), 2 μL TaqMan Enzyme Mix, 0.4 μL ROXReference Dye (50×), 1.2 μL 10 μM forward specific primer, 1.2 μL 10 μM reverse specific primer, 0.6 μL 10 μM specific probe, 5 μL standard or test sample, and RT-PCR grade water to a final volume of 20 μL. The reaction program of the real-time quantitative PCR detection method is: 53℃ for 5 min; 95℃ for 20 s; 95℃ for 5 s; 57℃ for 40 s, for 45 cycles.
[0008] In embodiments of the present invention, the forward specific primer, the reverse specific primer, and the specific probe are designed based on the Escherichia coli 16S rRNA sequence.
[0009] According to some specific and preferred embodiments of the present invention, the nucleotide sequences of the amplification fragments of the forward specific primer and the reverse specific primer are: CGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGG.
[0010] According to some specific and preferred embodiments of the present invention, the nucleotide sequence of the forward specific primer is: 5′-CGTGTTGTGAAATGTTGGGTTAA-3′, the nucleotide sequence of the reverse specific primer is: 5′-CCGCTGGCAACAAAGGATA-3′, and the nucleotide sequence of the specific probe is: 5′-TCCCGCAACGAGCGCAACC-3′.
[0011] In embodiments of the present invention, the two ends of the specific probe are labeled with fluorescent groups and / or fluorescent quenching groups. Preferably, the 5′ end is labeled with a fluorescent group and the 3′ end is labeled with a fluorescent quenching group. The fluorescent group and the fluorescent quenching group can be any fluorescent group and fluorescent quenching group commonly used in the art.
[0012] According to some specific and preferred embodiments of the present invention, the 5′ end of the specific probe is labeled with the fluorescent group FAM, and the 3′ end is labeled with the quenching fluorescent group TAMRA.
[0013] In embodiments of the present invention, the standard includes Escherichia coli total RNA reference solutions or self-made Escherichia coli total RNA solutions with concentrations of 2 pg / mL, 20 pg / mL, 200 pg / mL, 2000 pg / mL and 20000 pg / mL.
[0014] According to some embodiments of the present invention, the sample to be tested is a pretreated plasmid solution, the pretreatment including DNA elimination reaction and RT-PCR grade water dilution.
[0015] In some embodiments of the present invention, the reaction system for the DNA elimination reaction comprises: 18-22 μL plasmid sample, 8-12 μL 10×DNase I Buffer, 38-42 μL DNase I, and RNase-free water to a final volume of 100 μL, wherein the concentration of DNase I is 4-6 U / μL. The reaction system for the DNA elimination reaction is incubated at 36-38°C for 50-70 min, heated at 74-76°C for 8-12 min, cooled on ice, centrifuged and mixed, and diluted with RT-PCR grade water to a plasmid concentration of 500-2000 ng / mL.
[0016] According to some specific embodiments of the present invention, the reaction system for the DNA elimination reaction comprises: 20 μL plasmid sample, 10 μL 10×DNase I Buffer, 40 μL DNase I, and RNase-free water to a final volume of 100 μL, wherein the concentration of DNase I is 5 U / μL. The reaction system for the DNA elimination reaction is incubated at 37°C for 60 min, heated at 75°C for 10 min, cooled on ice, centrifuged and mixed, and diluted with RT-PCR grade water to a plasmid concentration of 1000 ng / mL.
[0017] This invention also provides a real-time quantitative PCR detection kit for total RNA residue in Escherichia coli, comprising Taqman RT-PCR Buffer (5×), TaqManEnzyme Mix (10×), ROX Reference Dye (50×), 8-12 μM forward specific primers, 8-12 μM reverse specific primers, 8-12 μM specific probes, standards, and RT-PCR grade water, as described in the reaction system of the real-time quantitative PCR detection method above.
[0018] In this invention, the total RNA from *E. coli* used to prepare the standard can be a commercially available reference material, or it can be prepared in-house using the following methods: Before the experiment, wipe the centrifuge, lab bench, and clean work surface with DNase, RNase, and DNA AWAY reagent (from Beyotime, catalog number R0125) to remove potential RNase contamination. Transfer 0.5 mL of E. coli culture in Luria-Bertani medium (LB medium) incubated overnight for 16 hours to a centrifuge tube, centrifuge at 12000 rpm for 2 minutes, and discard the supernatant. Add 1 mL of TRIzol reagent (from Invitrogen, catalog number 15596026) to the bacterial pellet and repeatedly pipette to resuspend and mix the bacterial cells. Centrifuge at 12000×g for 5 minutes at 4°C, transfer the supernatant to a new centrifuge tube, and incubate at room temperature (15~30°C) for 5 minutes. Add 0.2 mL of chloroform (from Sinopharm, catalog number 10006818) to each tube and mix thoroughly. Incubate at room temperature (15~30°C) for 3 minutes. Centrifuge at 12000×g for 15 minutes at 4°C. Tilt the centrifuge tube at 45° and transfer the colorless aqueous supernatant containing RNA to a new centrifuge tube. Add 0.5 mL of isopropanol (from Fisher Chemicals, catalog number A461-4) to the centrifuge tube and incubate at room temperature (15–30°C) for 10 minutes. Centrifuge at 12000×g for 10 minutes at 4°C. Total RNA will form a white gel precipitate that adheres to the bottom of the tube. Carefully discard the supernatant using a pipette. Add 1 mL of 75% ethanol (prepared by diluting anhydrous ethanol with enzyme-free water; anhydrous ethanol from Sigma-Aldrich, catalog number 459828-2L; enzyme-free water from Invitrogen, catalog number AM9937) to resuspend the precipitate. After briefly vortexing to mix the sample, centrifuge at 7500×g for 5 minutes at 4°C. Carefully discard the supernatant using a pipette. Air dry the total RNA precipitate at room temperature (15–30°C) for 5 minutes in a clean operating room. The RNA precipitate was dissolved in 30 μL of enzyme-free water (Invitrogen, catalog number AM9937), which can be aided by repeated pipetting. The solution was incubated in a metal bath at 55–60 °C for 10 minutes. The total RNA content and purity were determined by UV spectrophotometry (260 nm / 280 nm) and agarose gel electrophoresis. The extracted RNA was then aliquoted and stored at -80 °C for later use.
[0019] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art: The real-time quantitative PCR method for detecting residual total RNA in *E. coli* of this invention, through the design of highly specific primers and probes and the systematic optimization of the RT-qPCR reaction system and procedure, has constructed a complete and reliable detection scheme. Validation has shown that this method exhibits excellent performance in key performance indicators such as accuracy, repeatability, linear range, and detection limit. The real-time quantitative PCR method for detecting residual total RNA in *E. coli* of this invention has a simple operation procedure and effectively reduces detection costs. Attached Figure Description
[0020] Figure 1 The amplification curve of the standard solution in Example 1 is shown. Figure 2 This is the standard curve for Example 1. Detailed Implementation
[0021] the term "Real-time quantitative PCR" refers to a method that adds fluorescent groups to the PCR amplification reaction system, detects the fluorescence signal of each cycle product in real time during the amplification reaction, and finally performs quantitative analysis of unknown templates using a standard curve. Real-time quantitative PCR is also known as Q-quantitative Real-time PCR, abbreviated as qPCR.
[0022] "ΔRn" refers to the increase in fluorescence signal generated under specific qPCR conditions.
[0023] "Cycle threshold" (Ct) refers to the number of cycles required for the fluorescence signal to reach a set threshold during qPCR amplification.
[0024] The "threshold" generally refers to 10 times the fluorescence signal after 3 to 15 cycles of qPCR, and can be set at any position during the exponential amplification phase of the fluorescence signal. The instrument software will automatically select the threshold for the exponential growth phase. In the embodiments and comparative examples of this invention, the threshold for Example 1 is 0.6, the threshold for Comparative Example 1 is 0.5, the threshold for Comparative Example 2 is 0.4, the threshold for Comparative Example 3 is 1.3, and the threshold for Comparative Example 4 is 0.1.
[0025] The full names of the companies that sourced the reagents mentioned in this application are as follows: Thermo Fisher: Thermo Fisher Scientific Inc.
[0026] HZSKBIO: Huzhou Shenke Biotechnology Co., Ltd.
[0027] Takara: Takara Biotechnology (Dalian) Co., Ltd.
[0028] Vazyme: Nanjing Vazyme Biotech Co., Ltd.
[0029] NEB: New England Biolabs, Inc.
[0030] Novoprotein: Suzhou Novoprotein Scientific Inc.
[0031] The embodiments provided below are for illustrative purposes only and are not intended to limit the invention unless otherwise stated. Therefore, the invention should not be considered limited to the following embodiments, but should be understood to include any and all obvious variations as a result of the teachings provided herein.
[0032] It should be understood that modifications that do not materially affect the activity of various embodiments of the present invention may also be covered within the definition of the invention provided herein. Therefore, the following examples are intended to illustrate the invention but not to limit it.
[0033] Unless otherwise specified, the operating methods involved in the embodiments and comparative examples in this application are conventional methods in the art.
[0034] Example 1: This embodiment provides a real-time quantitative PCR method for detecting residual total RNA in Escherichia coli, including an RT-qPCR single-well reaction system (20 μL) and an RT-qPCR reaction program.
[0035] The composition of the RT-qPCR single-well reaction system (20 μL) is shown in Table 1.
[0036] Table 1 The nucleotide sequence of the forward specific primer is: 5′-CGTGTTGTGAAATGTTGGGTTAA-3′ (SEQ ID NO:1); The nucleotide sequence of the reverse specific primer is: 5′-CCGCTGGCAACAAAGGATA-3′ (SEQ ID NO:2); The nucleotide sequence of the specific probe is: 5′-TCCCGCAACGAGCGCAACC-3′ (SEQ ID NO:3), with the 5′ end labeled with the fluorescent group FAM and the 3′ end labeled with the quenching fluorescent group TAMRA; The RT-qPCR reaction procedure is shown in Table 2.
[0037] Table 2 Standards: Standard solutions with concentrations of 2 pg / mL, 20 pg / mL, 200 pg / mL, 2000 pg / mL, and 20000 pg / mL were prepared using positive control Escherichia coli total RNA reference (Thermo Fisher) and RT-PCR grade water (HZSKBIO: catalog number 1201203, sterile, DNase-free, RNase-free, and protease-free water).
[0038] Test samples: The plasmid samples were subjected to DNA elimination reaction, and then diluted with RT-PCR grade water to a plasmid concentration of approximately 1000 ng / mL. The DNA elimination reaction system (100 μL) is shown in Table 3.
[0039] Table 3 DNA elimination reaction: Incubate the above DNA elimination reaction system at 37°C for 60 min, heat at 75°C for 10 min, cool on ice, and centrifuge to mix.
[0040] Experimental instrument: ABI QuantStudio 5 real-time quantitative PCR instrument.
[0041] A standard curve was obtained by linearly fitting the logarithm of the standard concentration (LgX) to the x-axis and the cycle threshold (Ct) (the number of cycles required for the fluorescence signal to reach the exponential phase threshold of the sigmoid amplification curve) to the y-axis. The Ct value of the test sample was then substituted into the standard curve to calculate the total E. coli RNA concentration in the test sample. The residual total E. coli RNA in the plasmid sample was then calculated based on the dilution factor.
[0042] Comparative Example 1: This comparative example provides another real-time quantitative PCR method for detecting residual total RNA in Escherichia coli, which differs from Example 1 in that the RT-qPCR single-well reaction system (20 μL) and the RT-qPCR reaction procedure are different.
[0043] The composition of the RT-qPCR single-well reaction system (20 μL) for this comparative example is shown in Table 4.
[0044] Table 4 The forward specific primers, reverse specific primers, specific probes, and standards or test samples in Table 4 are the same as in Example 1.
[0045] The RT-qPCR reaction procedure for this comparative example is shown in Table 5.
[0046] Table 5 Comparative Example 2: This comparative example provides another real-time quantitative PCR method for detecting residual total RNA in Escherichia coli, which differs from Example 1 in that the RT-qPCR single-well reaction system (20 μL) and the RT-qPCR reaction procedure are different.
[0047] The composition of the RT-qPCR single-well reaction system (20 μL) for this comparative example is shown in Table 6.
[0048] Table 6 The forward specific primers, reverse specific primers, specific probes, and standards or test samples in Table 6 are the same as in Example 1.
[0049] The RT-qPCR reaction procedure for this comparative example is shown in Table 7.
[0050] Table 7 Comparative Example 3: This comparative example provides another real-time quantitative PCR method for detecting residual total RNA in Escherichia coli, which differs from Example 1 in that the RT-qPCR single-well reaction system (20 μL) and the RT-qPCR reaction procedure are different.
[0051] The composition of the RT-qPCR single-well reaction system (20 μL) for this comparative example is shown in Table 8.
[0052] Table 8 The forward specific primers, reverse specific primers, specific probes, and standards or test samples in Table 8 are the same as in Example 1.
[0053] The RT-qPCR reaction procedure for this comparative example is shown in Table 9.
[0054] Table 9 Comparative Example 4: This comparative example provides another real-time quantitative PCR method for detecting residual total RNA in Escherichia coli, which differs from Example 1 in that the RT-qPCR single-well reaction system (20 μL) and the RT-qPCR reaction procedure are different.
[0055] The composition of the RT-qPCR single-well reaction system (20 μL) for this comparative example is shown in Table 10.
[0056] Table 10 The forward specific primers, reverse specific primers, specific probes, and standards or test samples in Table 10 are the same as in Example 1.
[0057] The RT-qPCR reaction procedure for this comparative example is shown in Table 11.
[0058] Table 11 Performance testing: The standard curves and r corresponding to the real-time fluorescence quantitative PCR detection methods for total RNA residue in Escherichia coli in Examples 1 and Comparative Examples 1-5 described above are as follows: 2 Amplification efficiency and the lowest point of the standard curve are shown in Table 12.
[0059] Table 12 Table 12 shows that the real-time fluorescence quantitative PCR detection method for total Escherichia coli RNA residue in Example 1 has the largest linear range, with a detection limit of 2 pg / mL, which is the lowest point of the standard curve. It can provide detection results for Escherichia coli RNA residue below 0.0002% (mass percentage), meeting the industry's quality standard of plasmid Escherichia coli RNA residue not exceeding 1.0%, as well as the detection requirements for process optimization and screening.
[0060] Accuracy and Repeatability: Accuracy refers to the degree to which the result determined by the established method closely approximates the true or reference value, expressed as recovery rate. Repeatability refers to the degree to which results determined by the same analyst under the same conditions are closely approximate. Accuracy was determined by examining samples with three different spiking concentrations (20000 pg / mL, 2000 pg / mL, and 200 pg / mL). Repeatability was determined by examining the RSD between three spiked samples with the same spiking concentration at three different spiking concentrations (20000 pg / mL, 2000 pg / mL, and 200 pg / mL). The accuracy and repeatability results of the real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* in Example 1 are shown in Table 13.
[0061] Table 13 According to Table 13, the real-time fluorescence quantitative PCR detection method for total RNA residue in Escherichia coli in Example 1 showed recoveries of 92%–100% for three different concentrations of spikes, and intragroup RSDs of 6%–12%, indicating good accuracy and repeatability.
[0062] The residual amount of E. coli RNA in samples from different plasmid purification processes was detected using the real-time fluorescence quantitative PCR method described in Example 1. Each sample was tested in duplicate, and the results are the mean values. The results are shown in Table 14.
[0063] Table 14 By accurately quantifying the residual amount of E. coli host RNA in samples from different processes and purification steps during plasmid production, it is possible to effectively guide process optimization and release plasmid products.
[0064] Stability test: Standard curve experiments were performed on 10 different experimental dates using the real-time fluorescence quantitative PCR method for detecting the total RNA residue in Escherichia coli in Example 1. The results are shown in Table 15.
[0065] Table 15 Table 15 shows that the amplification efficiency ranged from 94% to 103% and the slope ranged from -3.480 to -3.252 when detected on 10 different experimental dates. R0 2 All are greater than or equal to 0.996, satisfying the requirements of ChP 3407 and USP 509 for qPCR, where the slope is between -3.1 and -3.8, R 2 The value should be greater than 0.98, indicating that the detection method has good stability.
[0066] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.
Claims
1. A real-time fluorescence quantitative PCR method for detecting residual total RNA in *Escherichia coli*, characterized in that, The reaction system for the real-time quantitative PCR detection method comprises: 3–5 μL TaqMan RT-PCR Buffer (5×), 1–3 μL TaqManEnzyme Mix (10×), 0.3–0.5 μL ROX Reference Dye (50×), 1–1.5 μL 8–12 μM forward specific primers, 1–1.5 μL 8–12 μM reverse specific primers, 0.5–0.8 μL 8–12 μM specific probes, 4–6 μL standards or test samples, and RT-PCR grade water to a final volume of 20 μL. The reaction procedure for the real-time quantitative PCR detection method is as follows: 52~54℃ for 4~6 min; 94~96℃ for 18~22 s; 94~96℃ for 4~6 s; 56~58℃ for 38~42 s; 44~46 cycles.
2. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 1, characterized in that, The reaction system for the real-time quantitative PCR detection method comprises: 4 μL TaqMan RT-PCR Buffer (5×), 2 μL TaqMan Enzyme Mix (10×), 0.4 μL ROX Reference Dye (50×), 1.2 μL 10 μM forward specific primer, 1.2 μL 10 μM reverse specific primer, 0.6 μL 10 μM specific probe, 5 μL standard or test sample, and RT-PCR grade water to a final volume of 20 μL. The reaction procedure for the real-time quantitative PCR detection method is as follows: 53℃ for 5 min; 95℃ for 20 s; 95℃ for 5 s, 57℃ for 40 s, for 45 cycles.
3. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 1, characterized in that, The nucleotide sequences of the amplified fragments from the forward and reverse specific primers are: CGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTATCCTTTGTTGCCAGCGG. The specific probe is labeled with fluorescent groups and / or quenching fluorescent groups at both ends.
4. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 1, characterized in that, The nucleotide sequence of the forward specific primer is: 5′-CGTGTTGTGAAATGTTGGGTTAA-3′. The nucleotide sequence of the reverse specific primer is: 5′-CCGCTGGCAACAAAGGATA-3′. The nucleotide sequence of the specific probe is: 5′-TCCCGCAACGAGCGCAACC-3′.
5. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 4, characterized in that, The specific probe is labeled with the fluorescent group FAM at its 5′ end and with the quenching fluorescent group TAMRA at its 3′ end.
6. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 1, characterized in that, The standards include Escherichia coli total RNA reference solutions or self-made Escherichia coli total RNA solutions with concentrations of 2 pg / mL, 20 pg / mL, 200 pg / mL, 2000 pg / mL and 20000 pg / mL.
7. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 1, characterized in that, The sample to be tested is a pretreated plasmid solution, the pretreatment including DNA elimination reaction and RT-PCR grade water dilution.
8. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 7, characterized in that, The reaction system for the DNA elimination reaction includes: 18-22 μL plasmid sample, 8-12 μL 10×DNase I Buffer, 38-42 μL DNase I, and RNase-free water to a final volume of 100 μL, wherein the concentration of DNase I is 4-6 U / μL. The reaction system for the DNA elimination reaction is incubated at 36-38℃ for 50-70 min, heated at 74-76℃ for 8-12 min, cooled on ice, centrifuged and mixed, and diluted with RT-PCR grade water to a plasmid concentration of 500-2000 ng / mL.
9. The real-time fluorescence quantitative PCR detection method for total RNA residue in *E. coli* according to claim 8, characterized in that, The reaction system for the DNA elimination reaction includes: 20 μL plasmid sample, 10 μL 10×DNase I Buffer, 40 μL LDNase I, and RNase-free water to a final volume of 100 μL, wherein the concentration of DNase I is 5 U / μL. The reaction system for the DNA elimination reaction is incubated at 37°C for 60 min, heated at 75°C for 10 min, cooled on ice, centrifuged and mixed, and diluted with RT-PCR grade water to a plasmid concentration of 1000 ng / mL.
10. A real-time fluorescence quantitative PCR detection kit for total RNA residue in *Escherichia coli*, characterized in that, It includes the following components in the reaction system of the real-time fluorescence quantitative PCR detection method according to claims 1 to 9: Taqman RT-PCR Buffer (5×), TaqMan Enzyme Mix (10×), ROX Reference Dye (50×), 8-12 μM forward specific primers, 8-12 μM reverse specific primers, 8-12 μM specific probes, standards, and RT-PCR grade water.