Application of S100A11 as diagnostic marker and therapeutic target of acute liver injury caused by acetaminophen
By utilizing the S100A11 gene or protein as a diagnostic biomarker and therapeutic target, non-invasive diagnostic kits and inhibitors have been developed, solving the challenges of early diagnosis and treatment of APAP liver injury and achieving highly sensitive diagnosis and effective treatment.
Patent Information
- Application Number
- CN202610134695.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-05-12
AI Technical Summary
Existing technologies are insufficient for early, non-invasive, and highly sensitive diagnosis of acute liver injury caused by acetaminophen (APAP), and existing treatments such as N-acetylcysteine (NAC) have a narrow treatment window and limited efficacy.
By using the S100A11 gene or protein as a diagnostic biomarker, non-invasive diagnostic kits can be developed by detecting its expression level. Furthermore, novel therapeutic drugs can be developed by using S100A11 inhibitors, such as siRNA, antibodies, or small molecule compounds, to inhibit its activity and serve as therapeutic targets.
It enables early, non-invasive, and specific diagnosis of APAP liver injury, significantly reduces serum transaminase levels, alleviates pathological damage to liver tissue, and provides a new treatment strategy.
Smart Images

Figure CN122012691A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the S100A11 gene or protein as a diagnostic marker and therapeutic target for acute liver injury caused by acetaminophen. Background Technology
[0002] Acetaminophen (APAP) is a widely used antipyretic and analgesic, but its overdose is one of the main causes of acute liver failure. Currently, the clinical diagnosis of drug-induced liver injury (DILI), especially APAP-induced liver injury, mainly relies on the detection of serum biochemical markers (such as alanine aminotransferase (ALT) and aspartate aminotransferase (AST)) and medical history assessment, with liver biopsy being the gold standard for diagnosis. However, liver biopsy is invasive, may cause complications, and is not suitable for dynamic monitoring. Therefore, the search for novel non-invasive biomarkers with high specificity and sensitivity is of great significance for the early diagnosis, disease assessment, and prognosis of APAP-induced liver injury.
[0003] In terms of treatment, the main clinical approach to treating APAP poisoning is the early administration of N-acetylcysteine (NAC), but its therapeutic window is narrow and its effectiveness is limited for some patients. Therefore, developing new therapeutic targets and drugs that address the novel mechanisms of APAP-induced liver injury is a pressing clinical challenge.
[0004] S100A11 is a member of the S100 calcium-binding protein family and is involved in various pathophysiological processes. Its role in acute liver injury caused by acute liver injury (APAP) has not been reported, and it has not been proposed as a biodiagnostic marker or therapeutic target for this disease. Summary of the Invention
[0005] In view of the problems of the prior art, the purpose of this invention is to provide a new application of the S100A11 gene or protein as a diagnostic biomarker and therapeutic target for acetaminophen-induced acute liver injury.
[0006] In a first aspect, the present invention provides the use of the S100A11 gene or protein in the preparation of products for diagnosing acute liver injury caused by acetaminophen. The products include reagents or kits for detecting the expression level of the S100A11 gene.
[0007] Preferably, the reagent or kit includes primers or probes for detecting S100A11 mRNA, or antibodies for detecting S100A11 protein.
[0008] Secondly, the present invention provides the use of the S100A11 gene or protein as a target in the preparation of medicaments for the prevention and / or treatment of acute liver injury caused by acetaminophen.
[0009] Thirdly, the present invention provides the use of S100A11 inhibitors in the preparation of medicaments for the prevention and / or treatment of acute liver injury caused by acetaminophen.
[0010] Preferably, the S100A11 inhibitor is selected from:
[0011] siRNA, antibody, or small molecule compound that specifically inhibits the expression or activity of S100A11.
[0012] The drug can significantly reduce serum alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST) levels in an acetaminophen-induced liver injury model, and alleviate liver histopathological damage, including reducing hepatocellular necrosis and inflammatory cell infiltration.
[0013] Fourthly, this invention provides the application of the S100A11 gene or protein in screening drugs for treating acute liver injury caused by acetaminophen.
[0014] Compared with the prior art, the present invention has the following significant advantages: This invention reveals for the first time that S100A11 is significantly upregulated in both cell and animal models of APAP liver injury, and its expression level is positively correlated with the degree of injury, showing potential to become an ideal diagnostic marker.
[0015] The liver-specific knockout of S100A11 directly demonstrated that inhibiting S100A11 can significantly reduce serum ALT / AST levels and alleviate liver tissue pathological damage, thus clarifying its effectiveness as a therapeutic target.
[0016] Diagnostic products based on S100A11 can achieve non-invasive, early, and specific diagnosis; therapeutic strategies based on this target (such as gene silencing, antibodies, or small molecule inhibitors) provide a clear direction for developing novel therapeutics for APAP liver injury.
[0017] Constructing S100A11 knockout and overexpression cell models can provide an effective tool for further research on the mechanism of action of S100A11 in APAP-induced liver injury, large-scale screening of drugs to improve APAP-induced liver injury, or assessment of whether drugs have potential liver injury risk. Attached Figure Description
[0018] Figure 1 The experimental results of the acetaminophen-induced cell damage model are shown in Figure A, which is a schematic diagram of the construction process of the acetaminophen-induced cell damage model; Figure B shows the photos taken 24 hours after administration of different concentrations of acetaminophen; Figure C shows the cell viability measured by CCK8; Figure D shows the mRNA level; Figure E shows the protein immunoblotting; and Figure F shows the quantitative map of the protein immunoblotting.
[0019] Figure 2 Experimental results of an acetaminophen-induced acute liver injury model in mice, where A is a schematic diagram of the process for constructing the mouse acetaminophen-induced liver injury model, B is an image of a mouse liver, C is immunoblotting of mouse liver tissue, D is HE staining of mouse liver tissue, E is the measurement of serum alanine aminotransferase and aspartate aminotransferase in mice, F is the mRNA level, and G is the quantitative map of protein immunoblotting.
[0020] Figure 3 The experimental results of liver-specific knockout of S100A11 can alleviate APAP-induced liver injury in mice are shown in Figure A, which is a schematic diagram of the process of constructing a liver-specific knockout S100A11 mouse model of acetaminophen-induced liver injury; Figure B is a quantitative diagram of the proportion of damaged area in HE-stained sections; Figure C is HE staining of mouse liver tissue; Figure D is mouse serum alanine aminotransferase; and Figure E is aspartate aminotransferase. Detailed Implementation
[0021] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0022] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.
[0023] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.
[0024] Example 1: S100A11 expression is upregulated in APAP-damaged hepatocytes 1 Experimental Methods Cell culture and processing: The human hepatocellular carcinoma cell line Huh7 was cultured in DMEM high-glucose medium containing 10% fetal bovine serum. Cells were seeded in 6-well plates (2 × 10⁶ cells / well). 5 Cells / well were cultured for 24 hours, then treated with medium containing 0 (control), 2.5, 5, 10, 20, and 40 mmol / L (mM) acetaminophen (APAP), respectively, with three replicates per group. Treatment continued for 24 hours. See the experimental procedure below. Figure 1 A.
[0025] Cell morphology and viability assay: After treatment, cell morphology was observed and recorded under an inverted microscope. Cell viability was assessed using the CCK-8 assay: after incubation with CCK-8 reagent in each well for 2 hours, absorbance (OD value) was measured at 450 nm using a microplate reader, and cell viability relative to the control group was calculated.
[0026] RNA extraction and qPCR: Total RNA extraction (based on RNAiso Plus method): Discard the culture medium, wash cells once with pre-chilled PBS, add 1 ml of RNAiso Plus to each well of a 6-well plate, incubate for 5 minutes, and collect the lysis buffer into RNase-free 1.5 ml centrifuge tubes. Add 200 μl of chloroform to each tube, vortex vigorously for 15 seconds, and incubate at room temperature for 3 minutes. Centrifuge at 12,000×g for 15 minutes at 4°C, the sample will separate into three layers. Carefully aspirate the colorless aqueous phase to a new RNase-free centrifuge tube. Add 500 μl of isopropanol to each tube, gently invert to mix, and incubate at room temperature for 10 minutes. Centrifuge at 12,000 rpm for 10 minutes at 4°C, and discard the supernatant (white RNA precipitate will be visible on the sides and bottom of the tube). Add 1 ml of 75% ethanol (prepared with anhydrous ethanol and DEPC water), and wash vigorously by vortexing. Centrifuge at 7,500 rpm for 5 minutes at 4°C, and discard the supernatant. Dissolve the RNA precipitate in 100 μl of DEPC water and store at -80°C for later use.
[0027] Genomic DNA Removal and cDNA Synthesis: Reverse transcription was performed using the Takara PrimeScript RT reagent Kit.
[0028] (1) DNA removal reaction system:
[0029] Reaction conditions: 42℃ for 2 minutes.
[0030] (2) Reverse transcription reaction system:
[0031] Reaction conditions: 37℃ for 15 minutes, 85℃ for 5 seconds.
[0032] (3) qPCR detection: Reaction system:
[0033] Amplification program: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 60°C annealing / extension for 1 minute, for a total of 40 cycles. Relative expression levels were calculated using the 2^(-ΔΔCt) method.
[0034] Primer sequences: h-s100a11-QF: TCTCCAGCCCTACAGAGACTGAG (SEQ ID No. 1) h-s100a11-QR: GTTGGTGTCCAGTTTCTTCATCAT (SEQ ID No. 2) h-actin-QF:CATGTACGTTGCTATCCAGGC (SEQ ID No. 3) h-actin-QR: CTCCTTAATGTCACGCACGAT (SEQ ID No.4) Protein extraction and Western blot detection: Total protein extraction: Discard the culture medium, wash cells once with pre-chilled PBS, add 200 μl of RIPA lysis buffer to each 6 cm culture dish, and incubate on ice for 10 minutes. Collect cells into 1.5 ml centrifuge tubes using a cell scraper, and sonicate (60 Hz, 3 seconds / cycle, 5 cycles). Centrifuge at 12,000 rpm for 15 minutes at 4°C, and transfer the supernatant to a new centrifuge tube. Quantify protein using the BCA method, and adjust the concentration accordingly for later use.
[0035] Western Blot experimental procedure: Prepare SDS-PAGE gels (stacking and separating gels), load samples (20-40 μg protein per well) and perform electrophoresis separation. Transfer proteins to PVDF membranes using wet transfer and block with 5% skim milk powder at room temperature for 1 hour. Add S100A11 primary antibody (1:1000 dilution) and incubate overnight at 4°C. After washing three times with TBST, add HRP-labeled secondary antibody (1:10000 dilution) and incubate at room temperature for 1 hour. Develop with ECL and acquire images; perform grayscale analysis using ImageJ software.
[0036] 2. Experimental Results The experimental results are shown in Figure 1 Microscopic observation showed that as the concentration of APAP treatment increased, the shrinkage and shedding of Huh7 cells intensified. Figure 1 B). CCK-8 assay results showed that APAP significantly reduced Huh7 cell viability in a concentration-dependent manner. Figure 1 C). qPCR results showed that, compared with the control group, the mRNA expression level of S100A11 in APAP-treated cells was significantly upregulated, and the degree of upregulation was positively correlated with APAP concentration (C). Figure 1 D). Western blot analysis further confirmed that the expression level of S100A11 protein also increased significantly with increasing APAP concentration (D). Figure 1E, F). The above results indicate that in the APAP-induced Huh7 cell damage model, S100A11 was significantly upregulated at both the mRNA and protein levels in a concentration-dependent manner.
[0037] Example 2: Upregulation of S100A11 expression in an APAP-induced mouse model of acute liver injury. 1 Experimental Methods Animal model construction (see) Figure 2 A): Eight-week-old male C57BL / 6J mice were randomly divided into a control group and a model group. Mice in the model group were fasted for 16 hours and then intraperitoneally injected with APAP solution (300 mg / kg body weight, dissolved in sterile saline, preheated to 37°C). Mice in the control group were fasted for 16 hours and then intraperitoneally injected with an equal volume of saline. Serum and liver tissue were collected 24 hours after injection.
[0038] (1) Liver function index detection: The levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were detected using a fully automated biochemical analyzer.
[0039] (2) Liver histopathological analysis (H&E staining): Paraffin embedding and sectioning preparation: Fixation: A portion of liver tissue was taken and fixed with 4% paraformaldehyde. After rinsing the fixative thoroughly, dehydrate the solution sequentially with ethanol in a gradient manner: -70% ethanol for 1 hour -80% ethanol for 1 hour -90% ethanol for 40 minutes -95% ethanol for 15 minutes -100% ethanol for 15 minutes (twice).
[0040] Transparent: Soak in xylene for 20 minutes.
[0041] Paraffin embedding: Immerse in paraffin I for 20 minutes and then in paraffin II for 40 minutes, followed by paraffin embedding. Section thickness is 4 μm, and the sections are baked for later use.
[0042] Hematoxylin-eosin staining (H&E staining) Experimental Principle: Hematoxylin-Eosin staining (H&E staining) is the most classic and widely used staining method in histology. Its core principle is to utilize the difference in affinity between the two dyes for different tissue components, so that structures such as cell nuclei and cytoplasm present a clear contrast, which is convenient for observation under a microscope.
[0043] Staining steps: Dewaxing and rehydration: xylene I and II for 5-10 minutes each; 100% ethanol for 1 minute; 95% ethanol for 3 minutes; 80% ethanol for 2-3 minutes; 70% ethanol for 2 minutes; rinse with distilled water.
[0044] dyeing: - Stain with hematoxylin for 3-5 minutes Rinse with running water for 30-60 seconds. -Separation solution I (1% hydrochloric acid ethanol) 30-60 seconds - Rinse with running water -Separation solution II (ammonia) 30-60 seconds - Rinse with running water -Return to blue: Rinse with tap water for 10-30 minutes -Stain with eosin for 3 minutes - Dehydration: 50%, 70%, and 80% ethanol for 1-2 minutes each; 95% ethanol for 30-50 seconds; 100% ethanol for 1-2 minutes.
[0045] Transparent: Soak in xylene for 5-10 minutes.
[0046] Sealing: Add a drop of neutral resin glue, cover with a glass slide (to avoid air bubbles), and air dry in a fume hood.
[0047] (3) Detection of S100A11 expression in liver tissue: Total RNA extraction: A liver tissue sample (approximately 50 mg) stored at -80℃ was placed in a grinding tube, and two large grinding beads and two small grinding beads were added. Then, 1 ml of RNAiso Plus was added, and the sample was ground using a tissue homogenizer at 60 Hz for 60 seconds. This process was repeated 5 times (with 30-second intervals). Subsequent steps were the same as the cellular RNA extraction method in Example 1.
[0048] Protein extraction: Liver tissue samples (approximately 30 mg) were ground as described above, and 300 μl of RIPA lysis buffer was added to each tube. Subsequent steps were the same as the cell protein extraction method in Example 1.
[0049] qPCR and Western Blot: The detection method is the same as in Example 1, using mouse-specific primers and antibodies (S100A11 primary antibody diluted 1:1000).
[0050] Primer sequences: m-s100a11-QF: GCATTGAGTCCCTGATTGCT (SEQ ID No. 5) m-s100a11-QR: ATCTAGCTGCCCGTCACAGT (SEQ ID No.6) m-actin-QF:GGCTGTATTCCCCTCCATCG (SEQ ID No7) m-actin-QR: CCAGTTGGTAACAATGCCATGT (SEQ ID No.8) 2. Experimental Results The experimental results are shown in Figure 2 The autopsy photos of the mouse livers show that the APAP group mice exhibited liver cell death. Figure 2 B). Compared with the control group, the serum ALT and AST activities of mice in the APAP model group were significantly increased ( Figure 2 E), indicating severely impaired liver function. HE staining showed typical hepatocellular necrosis in the liver tissue of the model group mice (E). Figure 2 D). qPCR and Western Blot analysis showed that S100A11 mRNA (D) was present in the liver tissue of model group mice. Figure 2 F) and protein ( Figure 2 The expression levels of C and G were significantly upregulated compared to the control group. APAP successfully induced acute liver injury in mice, and during this process, the expression of S100A11 in liver tissue was significantly increased, consistent with the results of in vitro cell experiments.
[0051] Example 3: Liver-specific knockout of S100A11 alleviates APAP-induced liver injury in mice. Experimental Animals and Grouping: Liver-specific S100A11 gene knockout mice (HKO) and their littermate wild-type control mice (WT), both 8-week-old males weighing 20-25 g, were used. Mice were housed in an SPF-grade animal facility at a temperature of 22±2℃ and humidity of 50-60%, with a 12-hour diurnal cycle and free access to food and water. They were acclimatized for one week before the experiment. WT and LKO mice were randomly divided into control groups (WT-Control, LKO-Control) and APAP model groups (WT-APAP, LKO-APAP), with at least 6 mice in each group.
[0052] Validation of liver-specific knockout efficiency: Before the experiment, liver tissue samples (approximately 50 mg) were collected from two HKO mice and one WT mouse. RNA and protein were extracted from each sample, and the expression level of S100A11 was detected by qPCR and Western Blot to confirm the liver-specific knockout efficiency.
[0053] Establishment of APAP-induced acute liver injury model: All mice in the APAP model group were fasted for 16 hours (with free access to water) and then intraperitoneally injected with APAP solution (300 mg / kg body weight, dissolved in sterile saline, preheated to 37°C); the control group received an equal volume of saline. Mice were reintroduced to a feeding diet 24 hours after injection, and were sacrificed. Serum and liver tissue samples were collected (experimental procedure see below). Figure 3 A).
[0054] Serum liver function indicators were tested: Serum ALT and AST activity levels were detected using a fully automated biochemical analyzer, and the operation strictly followed the instrument's standard procedures.
[0055] Liver histopathological analysis and damage quantification: Tissue processing: The left lobe of the liver was taken, fixed with 4% paraformaldehyde for 24-48 hours, dehydrated, cleared, and embedded in paraffin to prepare 4 μm thick serial sections.
[0056] H&E staining: Sections were routinely dewaxed and rehydrated, stained with hematoxylin and eosin, dehydrated and cleared, and then mounted with neutral resin (specific steps are the same as in Example 2).
[0057] Quantitative analysis of pathological damage: A blinded assessment was used. ImageJ software was used to quantify the necrotic area in H&E-stained sections: whole liver tissue sections were scanned and photographed under low magnification, and necrotic areas (manifested as nuclear dissolution and disappearance, and destruction of cell structure) were manually delineated. The percentage of necrotic area to the total liver parenchyma area of the section was calculated, and the average value was used for statistical analysis.
[0058] Statistical methods: All data are expressed as mean ± standard deviation (Mean ± SD), and statistical analysis was performed using GraphPad Prism 9.0 software. One-way ANOVA combined with Tukey's post-hoc test was used for comparisons among multiple groups. A p-value < 0.05 was considered statistically significant.
[0059] The experimental results are shown in Figure 3 After administration of APAP, compared with the WT model group, the serum ALT level in the HKO model group mice was significantly lower. Figure 3 D) and AST Figure 3 E) levels were significantly reduced. Quantitative histopathological analysis of liver tissue showed that the percentage of hepatocyte necrosis area in the HKO model group was significantly smaller than that in the WT model group ( Figure 3 B). HE staining sections clearly showed that the degree of liver tissue necrosis in the HKO model group mice was significantly reduced compared with that in the WT model group. Figure 3C). Specific knockout of the S100A11 gene in the liver can significantly reduce the elevation of serum transaminases caused by APAP and effectively alleviate the degree of pathological damage to liver tissue, proving that S100A11 is a key pathogenic factor in APAP liver injury and that inhibiting its function has a therapeutic effect.
[0060] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The use of an S100A11 gene or protein in the preparation of a product for diagnosing acute liver injury caused by acetaminophen.
2. The application according to claim 1, characterized in that, The products include reagents or kits for detecting the expression level of the S100A11 gene.
3. The application according to claim 2, characterized in that, The reagents or kits include primers or probes for detecting S100A11 mRNA.
4. The application according to claim 2, characterized in that, The reagent or kit includes an antibody for detecting the S100A11 protein.
5. Application of the S100A11 gene or protein as a target in the preparation of drugs for the prevention and / or treatment of acute liver injury caused by acetaminophen.
6. Use of S100A11 inhibitors in the preparation of medicaments for the prevention and / or treatment of acute liver injury caused by acetaminophen.
7. Application of the S100A11 gene or protein in screening drugs for the treatment of acute liver injury caused by acetaminophen.