Application of ACSS2 as target spot in screening or preparing medicine for treating virus-induced vascular remodeling
By targeting ACSS2, specific siRNA molecules were developed, solving the treatment challenge of vascular remodeling diseases caused by Zika virus infection. This achieved effective intervention in virus-induced phenotypic transformation of vascular smooth muscle cells and provided an innovative drug basis for vascular remodeling diseases caused by Zika virus and other related viral infections.
Patent Information
- Application Number
- CN202610188734.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-05-12
AI Technical Summary
Current technologies lack specific therapeutic targets and effective drugs for viral (especially Zika virus)-induced vascular remodeling diseases, and cannot effectively intervene in the phenotypic transformation of vascular smooth muscle cells caused by viral infection.
Using ACSS2 as a target, we developed specific siRNA molecules (such as SEQ ID NO. 1-2) and related drug compositions to reverse virus-induced synthetic phenotype transformation of vascular smooth muscle cells by inhibiting ACSS2 expression or activity, restore the expression of contractile markers, and inhibit abnormally upregulated synthetic markers.
Significantly reducing ACSS2 expression, restoring α-SMA and SM22α expression, inhibiting abnormal upregulation of OPN, and effectively reversing Zika virus-induced pathological phenotypic transformation of vascular smooth muscle cells provide an innovative drug basis for treating vascular remodeling diseases caused by Zika virus and other related viral infections.
Smart Images

Figure CN122012694A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, specifically to the application of ACSS2 as a target in screening or preparing drugs for the prevention or treatment of virus-induced vascular remodeling diseases, as well as related inhibitors, nucleic acid molecules and pharmaceutical compositions. Background Technology
[0002] Vascular remodeling is a common pathological basis for many vascular diseases. Essentially, it is the adaptive adjustment of the vascular wall's structure and function in response to changes in the internal and external environment, specifically manifested as dynamic changes in wall thickness, lumen diameter, and vascular function. Vascular smooth muscle cells (VSMCs), as the main cellular component of the arterial wall, exhibit a contractile phenotype under physiological conditions and are crucial for maintaining normal vascular structure and function. However, under pathological conditions, the abnormal phenotypic transformation of VSMCs from a contractile to an anabolic phenotype has become a core pathological feature of vascular remodeling. This imbalance in phenotypic transformation participates in the occurrence and development of various cardiovascular diseases, such as aortic aneurysm and aortic dissection. Therefore, intervening in the phenotypic transformation of VSMCs is considered a potential strategy to inhibit vascular remodeling.
[0003] In recent years, studies have found that certain viral infections, such as Zika virus (ZIKV), not only cause neurological lesions but may also invade the vascular system and participate in inducing vascular remodeling. However, the specific mechanisms are unclear, and targeted intervention strategies are lacking. Therefore, exploring the key molecular targets of virus-induced vascular remodeling and developing corresponding therapeutic drugs is of significant clinical importance and urgency.
[0004] ACSS2 (member 2 of the short-chain acetyl-CoA synthase family) is a key enzyme catalyzing the conversion of acetic acid to acetyl-CoA, participating in cellular metabolism and epigenetic regulation. In existing technologies, ACSS2 has been reported to be associated with tumors and metabolic diseases, and some studies suggest a possible link to certain cardiovascular pathological processes. However, no publicly available technology currently demonstrates that ACSS2 plays a crucial role in viral (especially Zika virus)-induced vascular remodeling, nor has it been proposed as a therapeutic target for this specific disease, and no effective treatment targeting this target has been developed. Summary of the Invention
[0005] This invention addresses the technical problem of the lack of specific therapeutic targets and effective drugs for viral (especially Zika virus)-induced vascular remodeling diseases in existing technologies. It provides the application of ACSS2 as a target in screening or preparing drugs for the prevention or treatment of virus-induced vascular remodeling diseases, as well as related inhibitors, nucleic acid molecules, and pharmaceutical compositions.
[0006] This invention is achieved through the following technical solution: In a first aspect, the present invention provides the use of ACSS2 as a target in screening or preparing drugs for the prevention or treatment of virus-induced vascular remodeling diseases.
[0007] Preferably, the application is an application of a method for screening candidate substances that can regulate ACSS2 expression or activity.
[0008] The method includes: providing a virus-infected vascular smooth muscle cell model expressing ACSS2, adding candidate substances to the model, detecting changes in phenotypic markers of vascular smooth muscle cells, and screening candidate substances that can reverse virus-induced synthetic phenotypic transformation as potential drugs.
[0009] Secondly, based on the above-mentioned targets, the present invention provides the application of ACSS2 inhibitors in the preparation of drugs for the prevention and / or treatment of virus-induced vascular remodeling diseases.
[0010] Preferably, the virus is Zika virus or dengue virus. The vascular remodeling diseases include, but are not limited to, intimal hyperplasia, aortic aneurysm, aortic dissection, atherosclerosis, and restenosis. The ACSS2 inhibitor is a substance capable of inhibiting ACSS2 gene expression or protein activity, such as nucleic acid inhibitors, small molecule compounds, or antibodies.
[0011] Preferably, the nucleic acid inhibitor is siRNA (small interfering RNA).
[0012] Thirdly, the present invention specifically provides the use of an siRNA that specifically inhibits ACSS2 in the preparation of a medicament. The siRNA comprises a first strand as shown in SEQ ID NO: 1 and a second strand as shown in SEQ ID NO: 2. This medicament is used to prevent or treat vascular remodeling diseases induced by viral infection (such as Zika virus or dengue virus), particularly phenotypic transformation of vascular smooth muscle cells, and their further development into aortic aneurysms or aortic dissections.
[0013] The drug reduces ACSS2 expression in vascular smooth muscle cells, restores the expression levels of α-smooth muscle actin (α-SMA) and smooth muscle 22α (SM22α), and inhibits the abnormal upregulation of osteopontin (OPN).
[0014] Fourthly, the present invention provides a pharmaceutical composition comprising an effective dose of the above-described specific siRNA (sequences shown in SEQ ID NO. 1 and SEQ ID NO. 2) and a pharmaceutically acceptable carrier.
[0015] Preferably, the pharmaceutically acceptable carrier may be selected from, but is not limited to: liposomes, lipid nanoparticles (LNP), polymer nanoparticles (such as PLGA, chitosan nanoparticles), microspheres, microcapsules, nanoemulsions, or aqueous carrier solutions containing buffers, isotonic agents and stabilizers.
[0016] Compared with the prior art, the present invention has the following significant advantages and beneficial effects: This invention reveals for the first time that ACSS2 is a key molecular target mediating vascular remodeling induced by viral (Zika virus) infection, breaking through the existing understanding that ACSS2 is only associated with non-viral metabolic diseases, and providing a new target and theoretical basis for the prevention and treatment of such diseases.
[0017] This invention not only proposes a broad strategy for targeting ACSS2, but also provides an experimentally validated and highly effective specific siRNA molecule (SEQ ID NO. 1-2). This siRNA can precisely inhibit ACSS2 and effectively reverse Zika virus-induced harmful phenotypic transformation of vascular smooth muscle cells in cell models, specifically by significantly reducing ACSS2 expression, restoring the expression of contractile markers (α-SMA and SM22α), and inhibiting the abnormal upregulation of synthetic markers (such as OPN).
[0018] Unexpected technical results: Surprisingly, not all ACSS2 inhibitors are effective in this scenario. Experiments show that the specific siRNA of this invention is effective in treating Zika virus-induced vascular lesions, while some known small molecule inhibitors of ACSS2 (such as VY) do not have this effect.
[0019] The targets, inhibitors, and specific siRNAs of this invention lay a solid material foundation for the development of innovative drugs for treating various vascular remodeling diseases such as aortic aneurysm and aortic dissection caused by Zika virus and other related viral infections, and have broad prospects for clinical application. Attached Figure Description
[0020] Figure 1 The images show representative immunoblot diagrams and relative protein expression statistics of vascular smooth muscle cells after treatment with siACSS2 and siControl and infection with Zika virus in Example 1 of this invention.
[0021] Figure 2 This is a representative image of immunofluorescence staining of vascular smooth muscle cells after treatment with siACSS2 and siControl and infection with Zika virus in Example 1 of the present invention.
[0022] Figure 3This is a statistical graph showing the mRNA of the contractile marker genes Acta2 and Tagln in vascular smooth muscle cells after treatment with siACSS2 and siControl and infection with Zika virus in Example 1 of the present invention, detected by qPCR.
[0023] Figure 4 The images show representative immunoblot diagrams and relative protein expression statistics of vascular smooth muscle cells treated with ACSS2 inhibitors and infected with Zika virus in Comparative Example 1 of this invention.
[0024] Figure 5 This is a representative ultrasound image of the aorta after treatment with Ang II / BAPN in wild-type mice and ACSS2 knockout mice in Example 2 of the present invention.
[0025] Figure 6 This is a representative EVG staining image and a statistical chart of the percentage of elastin-positive area in the aorta of wild-type mice and ACSS2 knockout mice treated with Ang II / BAPN in Example 2 of the present invention.
[0026] Figure 7 This is a representative immunoblot image and a statistical graph of relative protein expression from the aorta of in vitro cultured wild-type mice and ACSS2 knockout mice infected with Zika virus in Example 2 of the present invention. Detailed Implementation
[0027] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments, but this does not limit the present invention in any way. Any modifications or improvements made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0028] The processes, conditions, reagents, and experimental methods used in implementing this invention, except as specifically mentioned below, are all common knowledge and general knowledge in the field, and this invention does not have any particular limitations. Experimental methods in the embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer.
[0029] Unless otherwise stated, all technical terms and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. However, in the event of any conflict, the specification containing the definitions shall prevail.
[0030] Example 1: Specific siRNA reverses Zika virus-induced vascular smooth muscle cell phenotypic transformation 1. Experimental Objective To verify whether the specific siRNA of this invention can reverse the pathological phenotype transformation of vascular smooth muscle cells from contractile to synthetic types induced by Zika virus infection.
[0031] 2. Experimental Materials Cells: Primary vascular smooth muscle cells isolated from the rat aorta using the tissue block adhesion method.
[0032] Virus: Zika virus, with a multiplicity of infection (MOI) of 0.5.
[0033] siRNA design and synthesis: A specific siRNA (named siACSS2) was designed and chemically synthesized targeting the rat Acss2 gene (NCBI reference sequence: NM_001107793.1). Its sense strand sequence is shown in SEQ ID NO: 1, and its antisense strand sequence is shown in SEQ ID NO: 2.
[0034] The sense strand sequence of the negative control siRNA (siControl) is shown in SEQ ID NO: 3, and the antisense strand sequence is shown in SEQ ID NO: 4. All siRNAs were synthesized by Shanghai Hanheng Gene Technology Co., Ltd.
[0035] siACSS2: Chain of Justice (5' - 3'): CCACAAACAUCUGCUACAA(SEQ ID NO.1); Antonym chain (5' - 3'): UUGUAGCAGAUGUUUGUGG (SEQ ID NO.2).
[0036] siControl: Chain of Justice (5' - 3'): UUCUCCGAACGUGUCACGU (SEQ ID NO.3); Antonym chain (5' - 3'): ACGUGACACGUUCGGAGAA (SEQ ID NO.4).
[0037] 3. Experimental Methods (1) Cell plating and transfection Vascular smooth muscle cells were divided into groups of 1.5 × 10⁻⁶. 5 Cells were seeded per well in 6-well plates and cultured at 37°C with 5% CO2 for 24 hours until cell confluence reached 70-80%. Using Lipofectamine 3000 transfection reagent, siACSS2 or siControl was transfected into vascular smooth muscle cells according to the reagent instructions, with a final siRNA concentration of 50 nM. Six hours after transfection, the medium was replaced with DMEM complete medium containing 10% fetal bovine serum, and cultured for another 24 hours.
[0038] (2) Zika virus infection and group treatment The experiment was set up with 4 groups (n=6 holes in each group): siControl+Mock group: only siControl was transfected, and 1640 medium was used as a control treatment, and no virus infection was observed.
[0039] siACSS2+Mock group: only siACSS2 was transfected, and 1640 medium was used as a control treatment, and no virus infection was observed.
[0040] siControl+ZIKV group: Zika virus infection after siControl transfection; siACSS2+ZIKV group: Zika virus infection after siACSS2 transfection; Infection was performed using Zika virus (MOI=0.5) and incubated at 37°C for 48 hours.
[0041] 4. Detection Method (1) Protein level detection (Western Blot) Cells were washed twice with PBS, and then collected. The expression levels of ACSS2, OPN, α-SMA, and SM22α in the cells were determined by Western blotting. Total protein was extracted using RIPA lysis buffer (containing protease inhibitors) and quantified using the BCA method. 30 μg of protein was subjected to SDS-PAGE electrophoresis. After transfer, the following primary antibodies were added: rabbit anti-ACSS2 (1:1000), mouse anti-OPN (1:500), mouse anti-α-SMA (1:2000), rabbit anti-SM22α (1:1000), and rabbit anti-GAPDH (1:5000), and incubated overnight at 4°C. Horseradish peroxidase-labeled secondary antibody was incubated at room temperature for 1 hour, followed by ECL development. Gray-scale quantitative analysis was performed using ImageJ software.
[0042] (2) Gene expression detection (RT-qPCR) Discard the culture medium, wash twice with PBS, discard the culture medium, wash twice with PBS, and discard the PBS completely on the last wash. Add 1 mL of TRIZOL to each well to extract cellular RNA and perform reverse transcription. Reverse transcription was performed using the PrimeScript RT kit, and qPCR was performed using the SYBR Green method. Primer sequences: Acta2-F: GTCCCAGACACCAGGGAGTG(SEQ ID NO.5); Acta2-R: CGTTAGCAAGGTCGGATGCT(SEQ ID NO.6); Tagln-F: CATCCTATGGCATGAGCCGT(SEQ ID NO.7); Tagln-R: CAACTTGCTCAGAATCACGCC(SEQ ID NO.8); Internal reference gene GAPDH-F: CACCATCTTCCAGGAGCGAG (SEQ ID NO.9); Internal reference gene GAPDH-R: CTCGTGGTTCACACCCATCA (SEQ ID NO.10).
[0043] The relative expression level was calculated using the 2^(-ΔΔCt) method.
[0044] (3) Cytoskeleton staining (immunofluorescence) Cells were seeded on coverslips and treated as described above, then fixed with 4% paraformaldehyde for 30 minutes and permeabilized with 0.1% Triton X-100 for 15 minutes. Cells were then incubated with Alexa Fluor 488-labeled phalloidin (1:200) at room temperature for 1 hour to stain for F-actin, and the nuclei were stained with DAPI. Cells were observed and images were acquired using a laser confocal microscope.
[0045] 5. Experimental Results Effects on protein expression: such as Figure 1 As shown, compared with the siControl+Mock group, the expression of ACSS2 and OPN proteins was significantly increased in the model group (siControl+ZIKV), while the expression of α-SMA and SM22α proteins was significantly decreased. The treatment group (siACSS2 + ZIKV) could significantly reverse this change, effectively knocking down ACSS2 protein, restoring the expression of α-SMA and SM22α, and inhibiting the abnormal upregulation of OPN.
[0046] Effects on gene expression: such as Figure 3 As shown, the qPCR results were consistent with the protein levels. Zika virus infection significantly downregulated the mRNA expression of Acta2 and Tagln, while siACSS2 treatment significantly restored the transcriptional levels of these two contractile marker genes.
[0047] Effects on the cytoskeleton: such as Figure 2 As shown, vascular smooth muscle cells in the siControl+Mock group exhibited clear and orderly stress fibers. Zika virus infection led to cytoskeleton disorder and a reduction in stress fibers, with F-actin mainly distributed at the cell periphery. siACSS2 treatment significantly improved the cytoskeleton rearrangement induced by Zika virus and restored the normal actin fiber network structure of the cells.
[0048] The above experimental results demonstrate that the specific siRNA (siACSS2) of this invention can effectively inhibit ACSS2 expression and comprehensively reverse the pathological phenotypic transformation of vascular smooth muscle cells induced by Zika virus at the protein, gene, and cell morphology levels, proving that it is an effective intervention for virus-induced vascular remodeling.
[0049] Comparative Example 1: The ACSS2 small molecule inhibitor VY failed to reverse Zika virus-induced vascular smooth muscle cell phenotypic transformation. 1. Experimental Objective Comparative analysis showed that not all ACSS2 inhibitors are effective in treating Zika virus-induced vascular remodeling, highlighting the unique efficacy and inventiveness of the specific siRNA in this invention.
[0050] 2. Experimental Materials and Methods Cells and viruses: Same as in Example 1.
[0051] Inhibitor: ACSS2 small molecule inhibitor VY (purchased from Selleck, catalog number: E1147).
[0052] Experimental grouping and treatment: PBS+Mock group: Vascular smooth muscle cells were pretreated with PBS and treated with 1640 medium as a control, and were not infected with Zika virus; PBS+ZIKV group: Vascular smooth muscle cells were pretreated with PBS and then infected with Zika virus; VY+Mock group: Vascular smooth muscle cells were pretreated with VY and treated with 1640 medium as a control, and were not infected with Zika virus. VY+ZIKV group: Vascular smooth muscle cells were pretreated with VY and infected with Zika virus; Vascular smooth muscle cells were pretreated with PBS or the inhibitor VY for 24 hours before being infected with Zika virus (MOI=0.5). Cells were collected 48 hours after treatment.
[0053] 3. Western Blot Detection Western blotting was used to detect the expression of ACSS2, OPN, α-SMA, and SM22α proteins, using the same method as in Example 1. 4. Experimental Results like Figure 4As shown, compared with the PBS+Mock group, the expression of ACSS2 and OPN proteins in the model group (PBS+ZIKV) cells was significantly increased, while the expression of α-SMA and SM22α proteins was significantly decreased. However, although pretreatment with the inhibitor VY significantly reduced the expression of ACSS2 in cells, VY itself also promoted the phenotypic transformation of vascular smooth muscle cells and failed to reverse the Zika virus-induced phenotypic transformation of vascular smooth muscle cells.
[0054] The results above indicate that although VY can effectively inhibit ACSS2 expression, it has no significant effect on Zika virus-induced vascular smooth muscle cell phenotypic transformation. This suggests that for virus infection-related vascular remodeling, a more thorough strategy of downregulating ACSS2 expression (such as gene silencing) is needed, rather than simply inhibiting enzyme activity.
[0055] Example 2: ACSS2 knockout mice resist vascular remodeling 1. Experimental Objective To validate the preventive and therapeutic effects of ACSS2 knockout on aortic aneurysm / dissection in vivo, and to assess the ability of ACSS2-deficient aortic tissue to resist Zika virus-induced phenotypic transformation.
[0056] 2. Experimental Materials Animals: SPF-grade male ACSS2 knockout and wild-type mice, 3–4 weeks old, weighing 12–16 g. ACSS2 knockout mice were constructed by Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. using CRISPR-Cas9 technology, targeting and knocking out exon 3 of the ACSS2 gene. ACSS2 knockout mice were backcrossed into a C57BL / 6J background for at least 6 generations. Wild-type mice served as littermate controls.
[0057] Inducing agents: angiotensin II (Ang II, Sigma-Aldrich), aminopropionitrile (BAPN, Sigma-Aldrich).
[0058] Slow-release pump: Alzet micro-osmotic pump (model 1004).
[0059] 3. Experimental Methods (1) Construction and grouping of aortic aneurysm / dissection model The experiment was divided into 4 groups (n=20 animals in each group): Wild-type mice + saline group: Wild-type mice were treated with saline. Wild-type mice + Ang II / BAPN group: Wild-type mice induced with angiotensin II and aminopropionitrile; ACSS2 knockout mice + saline group: ACSS2 knockout mice were treated with saline. ACSS2 knockout mice + Ang II / BAPN group: ACSS2 knockout mice were induced using angiotensin II and aminopropionitrile.
[0060] Model induction: Three-week-old mice were anesthetized with isoflurane, and a pre-filled sustained-release pump containing angiotensin II (1000 ng / kg / min) was implanted subcutaneously in the interscapular region of their backs for 28 days; aminopropionitrile (150 mg / kg / day) was added to their drinking water. After surgery, the mice were housed individually and their survival status was monitored daily.
[0061] (2) Ultrasound detection of aortic diameter On day 28, the maximum diameter of the abdominal aorta was measured via transthoracic ultrasound using a VisualSonics Vevo 2100 high-resolution small animal ultrasound system. After hair removal from the mouse chest, measurements were taken in a standard parasternal long-axis section using a 30 MHz linear array probe.
[0062] (3) Histopathological analysis of the aorta Mouse aortas were paraffin-embedded, sectioned, and stained with elastic fiber-collagen fiber (EVG) to assess the breakage and degradation of elastic fibers in the blood vessel wall.
[0063] (4) Zika virus infection experiment in isolated aorta Six wild-type and six ACSS2 knockout mice each, aged 4 weeks, were used to isolate the aorta under aseptic conditions. The aorta was cut into 3 mm long circular fragments and placed in DMEM medium containing 10% fetal bovine serum. The fragments were pre-incubated at 37°C and 5% CO2 for 4 hours. Zika virus (10...) was then added... 6 Infected with PFU / well for 3 days, while the control group received an equal volume of PBS. After infection, RNA was extracted from aortic tissue using the Trizol method, and the expression of contractile marker genes (Acta2, Tagln) was detected by RT-qPCR; simultaneously, RIPA lysis of a portion of the tissue was performed, and the protein levels of α-SMA and SM22α were detected by Western Blot.
[0064] 4. Experimental Results Impact on the development and progression of aortic aneurysm / dissection: such as Figure 5 As shown, compared with the wild-type mouse + saline group, Ang II / BAPN treatment significantly increased the maximum aortic diameter of wild-type mice. However, the degree of aortic dilation in Ang II / BAPN-treated ACSS2 knockout mice was significantly lower than that in wild-type mice. EVG staining results ( Figure 6 The results showed that the elastic fibers in the middle membrane of the aorta of wild-type mice treated with Ang II / BAPN were severely broken, degraded and disordered, while the elastic fiber structure of the aorta of ACSS2 knockout mice treated with Ang II / BAPN was relatively intact.
[0065] Resistance to direct viral attacks: such as Figure 7 As shown, Zika virus infection significantly reduced the protein expression of α-SMA and SM22α in the aortic tissue of wild-type mice in vitro cultured aorta. In contrast, the expression levels of these two contractile marker proteins in the aortic tissue of ACSS2 knockout mice were significantly higher than those in the infected wild-type mouse group after Zika virus infection, demonstrating resistance to virus-induced vascular phenotypic transformation.
[0066] The in vivo experiments above demonstrate that ACSS2 gene deletion significantly reduces the occurrence and development of aortic aneurysms / dissections induced by Ang II / BAPN. In vitro experiments further demonstrate that ACSS2 gene deletion enables aortic tissue itself to resist the loss of contractile proteins and phenotypic transformation directly induced by Zika virus infection. This fully confirms the effectiveness of ACSS2 as a key target for treating vascular remodeling diseases (especially virally induced ones) at both the whole animal and organ tissue levels, providing a solid preclinical basis for drug development based on this target.
[0067] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. The application of ACSS2 as a target in screening or preparing drugs for the prevention or treatment of virus-induced vascular remodeling diseases.
2. Application of ACSS2 inhibitors in the preparation of drugs for the prevention and / or treatment of virus-induced vascular remodeling diseases.
3. The application according to claim 2, characterized in that, The virus is Zika virus or dengue virus, and the vascular remodeling disease is vascular intimal hyperplasia, aortic aneurysm, aortic dissection, atherosclerosis, and restenosis.
4. The application according to claim 3, characterized in that, The ACSS2 inhibitor is a nucleic acid inhibitor, small molecule compound, or antibody that can inhibit ACSS2 gene expression or protein activity.
5. The application according to claim 4, characterized in that, The nucleic acid inhibitor is siRNA.
6. The application according to any one of claims 2-5, characterized in that, The drug reduces ACSS2 expression in vascular smooth muscle cells, restores the expression levels of α-smooth muscle actin and smooth muscle 22α, and inhibits the abnormal upregulation of osteopontin.
7. The use of a siRNA that specifically inhibits ACSS2 in the preparation of a drug, characterized in that, The siRNA comprises a first strand as shown in SEQ ID NO. 1 and a second strand as shown in SEQ ID NO. 2, and the drug is used to prevent or treat vascular remodeling diseases induced by viral infection.
8. The use according to claim 7, characterized in that, The drug is used to prevent or treat phenotypic transformation of vascular smooth muscle cells induced by Zika virus infection.
9. The use according to claim 8, characterized in that, The drug is used to prevent or treat aortic aneurysms or aortic dissections caused or exacerbated by phenotypic transformation of the vascular smooth muscle cells.
10. A pharmaceutical composition, characterized in that, The double-stranded nucleic acid molecule of claim 9 comprises an effective dose and a pharmaceutically acceptable carrier.