Chicken FMNL1 gene promoter region molecular marker, detection reagent and application thereof

By identifying SNP sites in the promoter region of the chicken FMNL1 gene and designing molecular markers and detection reagents, the problem of lack of breeding basis in existing technologies has been solved, enabling accurate identification and efficient breeding of egg production traits in hens.

CN122012755AActive Publication Date: 2026-05-12SHANDONG AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202610499367.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-16
Publication Date
2026-05-12
Estimated Expiration
2046-04-16

AI Technical Summary

Technical Problem

Currently, there are no reports on the association between SNPs in the promoter region of the FMNL1 gene and egg production performance in chickens, and there is a lack of effective molecular markers for breeding high-producing hens.

Method used

Two SNP sites (SNP1 and SNP2) that are significantly associated with egg production performance in chickens were identified and characterized in the promoter region of the chicken FMNL1 gene. Corresponding molecular markers and detection reagents were designed and identified by PCR amplification and sequencing technology to achieve accurate identification of egg production traits in hens.

Benefits of technology

It enables early and accurate identification of the age at which hens begin laying and the number of eggs laid, providing a basis for molecular marker-assisted breeding of high-producing hens and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122012755A_ABST
    Figure CN122012755A_ABST
Patent Text Reader

Abstract

The invention discloses a chicken FMNL1 gene promoter region molecular marker, a detection reagent and application thereof, and belongs to the technical field of molecular genetics. According to the invention, two SNP loci significantly associated with egg laying performance are identified in a chicken FMNL1 gene promoter region, and the two SNP loci generally exist in a plurality of different varieties of chickens and present a consistent effect trend between different genotypes. Based on the SNP locus identified by the invention, the invention develops and designs a chicken FMNL1 gene promoter region molecular marker and a corresponding detection reagent. The method can be used for accurately identifying the laying day age and egg laying traits of the chickens in the early stage, and has important significance on breeding of high-yield laying hens.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular genetics, specifically to a molecular marker and detection reagent for the promoter region of the chicken FMNL1 gene and its application. Background Technology

[0002] Egg production performance is a core indicator for measuring the efficiency of poultry production and is directly related to the economic benefits of the livestock industry. The development, maturation, and ovulation of follicles are regulated by a complex network of multiple genes. In-depth research on the functional genes and their genetic variations related to egg production traits in chickens will help accelerate the molecular marker-assisted breeding process for high-producing egg-laying chicken breeds.

[0003] FMNL1 (Formin-like protein 1) is an important member of the Formin family, widely involved in cellular processes such as cytoskeleton remodeling, cell migration, cell polarization, and cell division. Studies have shown that FMNL1 is highly expressed in immune cells and participates in processes such as immune synapse formation, phagocytosis, and migration. Furthermore, research has found that FMNL1 co-localizes with the Golgi complex, maintaining the structure of the Golgi apparatus (Colón-Franco et al., 2011). In mice, FMNL1 participates in oocyte maturation by regulating dynamic changes in the cytoskeleton (Wang Fei, 2015). However, current research on the role of FMNL1 in chicken follicle development, granulosa cell function, and egg production performance remains very limited.

[0004] Single nucleotide polymorphisms (SNPs) refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, and are an important source of genetic differences between individuals. The main forms of SNPs include base transversions, insertions, transitions, and deletions, and these variations play a crucial role in biological evolution (Brookes et al., 1999). SNPs may be located in coding regions, affecting amino acid sequences and protein function, or in non-coding regions such as promoter regions, affecting gene expression. Although SNPs are numerous and widely distributed, only a few SNPs that are significantly associated with biological traits have breeding application value. Currently, there are no reports on the association between SNPs in the promoter region of the FMNL1 gene and egg production performance in chickens. Therefore, studying SNPs in the promoter region of the FMNL1 gene will help screen for molecular markers with breeding value, providing a theoretical basis and technical support for marker-assisted breeding of high-laying hens. Summary of the Invention

[0005] In view of the above-mentioned prior art, the purpose of this invention is to provide a molecular marker, detection reagent and application of the chicken FMNL1 gene promoter region.

[0006] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a molecular marker for the promoter region of the chicken FMNL1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1; the 136th base from the 5' end of the sequence is an SNP1 site with a base polymorphism of T or G; the 538th base from the 5' end of the sequence is an SNP2 site with a base polymorphism of G or A.

[0007] The specific nucleotides of the molecular markers in the promoter region of the chicken FMNL1 gene are as follows: TACAGAGCTGTGCCAGCGACCTGCGGGCAGAGCTGTGCCGCTCTGTGTCGCGTTGACAGCTCAGCCCTGCGAGTGGCGGCCCCAGGGCCCAGCTTATACCCCAGATCACGTGAAACGCTGCTCTGTGCAAAAGG T / G (SNP1)ACACAGCCCAGTGCACGGCCCTCACTTGGTGCCGTGCTGCCATTGCTCTCCTCCCATCATCATTGCCCTCCCTATGGCCAGGAATCGGGAGCACGGGCCTCATCTCTGCCTTTCCTGGTGGTTGAGGCTCTCAGCTTTCCCCTGTGTCACCTCCCTGCTCTGCCCTGGTCAGCACACTGCTCTGCTGGCACTTGGCC TTGATGTGGGGCATCCTTCAAGGGATGGCACTTCTCCTTGGTGTGGGGCACCCCACAGCCAGGAGAGCCCCTCTGGCTCCTTGGGGTCACAGCCTGGCCCAGTGGGCAGCCTGGGGCTCATCTTTGGGCCTGTTTTCCATGCTGGGTCTCCTGCACAGGCAGACTCTGTTCTCGTCCTGTACCCCAGCTGGGATCAAGGCAAGC G / A (SNP2)GATCTGTTCAAACAGGATCTTAGGGAATTGCATGCAAAATATTTAGTGAAATGATGAAATATTTAGTGAAACTAAGATATTTAAACTGCAAAGTCAAGCTCTGGAATGTCAGAATGTACTGTAATGTGGGTGACCCCA.

[0008] Note: The nucleotides in bold italics in the sequence are SNP sites, represented in the sequence listing as corresponding degenerate bases. Specifically: the degenerate base for T / G is K; the degenerate base for G / A is R.

[0009] This invention discovered two SNP sites in the promoter region of the chicken FMNL1 gene (Gene ID: 419965) that are significantly associated with egg production performance in hens.

[0010] The physical locations corresponding to the two SNP sites mentioned above are as follows: The physical location of SNP1 is 27_3773331; its base polymorphism is T or G. The dominant allele associated with age at first laying (AFE), number of eggs laid during the rising laying period (EN1), and total number of eggs laid at 43 weeks of age (E43) is G. The GG genotype corresponds to an earlier age at first laying and a higher number of eggs laid.

[0011] The physical location of SNP2 is 27_3773733; its base polymorphism is G or A. The dominant allele associated with age at first laying (AFE), number of eggs laid during the rising laying period (EN1), and total number of eggs laid at 43 weeks of age (E43) is A. The AA genotype corresponds to an earlier age at first laying and a higher number of eggs laid.

[0012] The reference genome for the above physical location is Gallus gallus 6.0.

[0013] Based on these two SNP sites, this invention developed molecular markers related to hen egg production performance for the breeding of hens with traits such as early onset of egg production and high egg production.

[0014] A second aspect of the present invention provides a detection reagent comprising: a primer pair for detecting the molecular marker in the promoter region of the chicken FMNL1 gene, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3. Specifically: FMNL1-F: TACAGAGCTGTGCCAGCGAC; (SEQ ID NO.2) FMNL1-R: TGGGGTCACCACATTACAGTAC. (SEQ ID NO.3) Preferably, the detection reagent is a PCR sequencing kit or a KASP typing kit.

[0015] In a third aspect, the present invention provides the application of the above-mentioned molecular markers of the chicken FMNL1 gene promoter region in the breeding of hens with traits of early onset of egg production and high egg production.

[0016] A fourth aspect of the present invention provides the use of the above-described detection reagent in the following (1) or (2): (1) Identify the egg-laying traits of hens; (2) Select and breed hens with traits of early onset of egg production and high egg production.

[0017] In the above applications, the egg production traits include: age at first laying, number of eggs laid during the rising egg production period, or total number of eggs laid at 43 weeks of age.

[0018] In the above applications, the method for selecting hens with traits of early onset of egg production and high egg quantity is as follows: Using the genomic DNA of the hen to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the egg production traits of the hens were identified based on the sequencing results, and hens with early onset of egg production and high egg production were selected.

[0019] Specifically, if the sequencing results of the amplified product correspond to the GG genotype at position 136 and the AA genotype at position 538 of the sequence shown in SEQ ID NO.1, then it is identified as having the traits of early onset of egg production and high egg quantity.

[0020] Preferably, the PCR amplification system is as follows: 2 μL genomic DNA, 25 μL 2×Phanta UniFi Master Mix, 2 μL (10 μM) each of upstream and downstream primers, and ddH2O to a final volume of 50 μL.

[0021] The PCR amplification program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 10 seconds, 72℃ extension for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes.

[0022] The beneficial effects of this invention are: (1) In this invention, two SNP sites that are significantly associated with egg production performance were identified in the promoter region of the chicken FMNL1 gene. These two SNP sites are common in many different breeds of chickens and show a consistent effect trend among different genotypes.

[0023] (2) Based on the SNP sites identified in this invention, molecular markers for the promoter region of the chicken FMNL1 gene and corresponding detection reagents were developed and designed. This enables accurate early identification of the age at first egg production and egg-laying traits in chickens, which is of great significance for the breeding of high-producing hens. Attached Figure Description

[0024] Figure 1: Expression level of FMNL1 gene in follicular tissues at different stages. In the figure, SW: small white follicle; LW: large white follicle; SY: small yellow follicle; F5-F1: graded follicles; POF: post-ovulatory follicles; different lowercase letters indicate significant differences (P<0.05).

[0025] Figure 2 The expression level of the FMNL1 gene in chicken follicular granulosa cells and theca cells. In the figure, Pre-GCs: pre-grade granulosa cells; Pre-TCs: pre-grade theca cells; Post-GCs: graded granulosa cells; Post-TCs: graded theca cells; different lowercase letters indicate significant differences (P<0.05).

[0026] Figure 3 Polymorphisms in the key promoter region of the FMNL1 gene in different chicken breeds.

[0027] Figure 4 Gel electrophoresis results of molecular marker amplification products of chicken FMNL1 gene promoter region; in the figure, M: Marker; lanes 1-5 are the amplification products of the Langya chickens to be tested in Example 3. Detailed Implementation

[0028] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0029] Terminology Explanation: SW: Small white follicles are white, immature early follicles less than 4 mm in size in the chicken ovary. They represent the initial form of egg development and are a key indicator for assessing the fertility of hens.

[0030] LW: Large white follicle, 4-6 mm in diameter, is a pre-grade follicle that develops from SW.

[0031] SY: Small yellow follicle, 6-8 mm in diameter, is the next stage after the large white follicle and is about to enter the critical node of ovulation.

[0032] F5-F1: Graded follicles, F1 to F5 are arranged from largest to smallest in diameter, with F1 being the largest and the follicle that will ovulate the next day.

[0033] POF: Post-ovulatory follicle. After the follicle releases the egg, the original follicle wall collapses, leaving behind a residual structure, which is called POF.

[0034] Pre-GCs: Pre-grade granulosa cells; refers to granulosa cells from follicles such as SW, LW, and SY that have not yet entered the F1–F5 ovulation sequence.

[0035] Pre-TCs: Graded prefollicular membrane cells; refers to membrane cells isolated from SW, LW, and SY graded prefollicles.

[0036] Post-GCs: Graded follicular granulosa cells; refers to granulosa cells isolated from F1 to F5 grade follicles.

[0037] Post-TCs: Graded theca cells; refers to the membrane cells isolated from F1 to F5 grade follicles.

[0038] AFE: Age at first egg; the age at which a hen lays its first egg.

[0039] EN1: Number of eggs produced during the rising egg production period; the rising egg production period refers to the period from AFE to 26 weeks of age.

[0040] EN2: Number of eggs laid during peak laying period; peak laying period refers to 27-36 weeks of age.

[0041] EN3: Number of eggs produced during the laying period; the laying period refers to 37-43 weeks of age.

[0042] E43: Total number of eggs laid at 43 weeks of age; refers to the total number of eggs laid by individuals from AFE to 43 weeks of age.

[0043] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0044] The test materials used in the embodiments of this invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without specified detailed conditions are performed according to conventional test methods or the supplier's recommended operating instructions. Wherein: Zaozhuang Sunzhi Chicken comes from Shandong Sunzhi Chicken Breeding Technology Co., Ltd.; Hy-Line Brown commercial laying chicken comes from Linxi Village, Daiyue District, Tai'an City, Shandong Province; Rizhao Langya Chicken comes from Shandong Jihua Poultry Breeding Co., Ltd.; Jinghong laying chicken comes from Li Shijun's research group at Huazhong Agricultural University; and Jining 100-day chicken comes from Jining Datang 100-day chicken conservation farm.

[0045] Example 1: Expression analysis of chicken FMNL1 gene in chicken follicular tissue and cells 1. Test method: 1.1 RNA extraction and concentration detection: RNA extraction was performed strictly according to the steps outlined in the RNA Simple Total RNA Kit (Tiangen). The extracted RNA was then subjected to quality testing via agarose gel electrophoresis and concentration analysis using a spectrophotometer to ensure that the extracted RNA was free from degradation and contamination.

[0046] 1.2 Real-time quantitative PCR: cDNA synthesis was performed using the Evo M-MLV reverse transcription kit (Aikerui). RT-qPCR was performed using the SYBR Green Premix ProTap HS qPCR Kit (Aikerui). Each sample contained three biological replicates and three technical replicates. The reaction mixture consisted of: 10 μL 2×SYBR Green Pro Taq HS Premix, 0.4 μL each of forward and reverse primers, 2 μL cDNA, and 7.2 μL RNase-free ddH2O. The reaction program was 95℃ for 30 s; 95℃ for 5 s, annealing for 30 s, for 40 cycles. The melting curve conditions were 95℃ for 1 s, 60℃ for 30 s, and 95℃ for 1 s. GAPDH was used as an internal control gene, and 2... −ΔΔCt The method was used to calculate the relative expression level of the FMNL1 gene in chicken follicular tissues and cells.

[0047] 2. Test Results: FMNL1 is expressed in follicular tissues at all stages, such as Figure 1 As shown, FMNL1 expression was highest in large white follicles (LW) and lowest in postovulatory follicles (POF). FMNL1 was expressed in both granulosa cells and theca cells of follicles, but showed different trends, such as... Figure 2 As shown, FMNL1 expression increases in membrane cells after follicle selection; however, FMNL1 expression decreases in granulosa cells after follicle selection.

[0048] Example 2: Identification and Association Analysis of SNP Markers in the Promoter Region of the Chicken FMNL1 Gene 1. Identification of SNP markers in the promoter region of the chicken FMNL1 gene: Twenty blood genomic DNA samples were randomly selected from each of the following chicken breeds: Zaozhuang Sunzhi Chicken, Hy-Line Brown Commercial Layer Chicken, Rizhao Langya Chicken, Jinghong Layer Chicken, and Jining Hundred-Day Chicken. Using these samples as templates, promoter regions containing SNP sites were amplified by PCR. These regions were then detected by 1% agarose gel electrophoresis. The gel samples were excised and sent to the company for sequencing. The sequenced sequences were then compared with the FMNL1 gene promoter region on the NCBI website to screen for SNP sites. Ultimately, two SNP sites present in all of the aforementioned chicken breeds were identified approximately 1 kb upstream of the transcription start site of the FMNL1 gene. Figure 3 They are respectively: The physical position of SNP1 is 27_3773331; its base polymorphism is T or G; The physical position of SNP2 is 27_3773733; its base polymorphism is G or A.

[0049] 2. Association analysis between two SNPs and egg production traits of Langya hens: Using the Langya chicken breeding population from Shandong Jihua Poultry Breeding Co., Ltd. as experimental animals, 1129 hens were randomly selected from the same batch and housed individually under the same environmental and feeding conditions. The age at first egg (AFE) of each hen was recorded, and individual egg production was recorded daily thereafter. An egg production curve was plotted based on the daily egg production of each hen from the date of first egg to 43 weeks of age. The number of eggs produced during the rising egg production period (EN1), the peak egg production period (EN2), the sustained egg production period (EN3), and the total number of eggs produced at 43 weeks of age (E43) were recorded. The longest continuous egg production period (MCL) for each hen was calculated based on the daily egg production records.

[0050] Blood was collected from the wing veins of 1129 hens after the egg production record was completed, and heparin sodium was used for anticoagulation. Genomic DNA was extracted from the chicken blood using the Tiangen DNA kit. The concentration and purity of the extracted DNA samples were determined by a Nano-500 micro spectrophotometer and verified by 1% agarose gel electrophoresis.

[0051] Genome sequencing was used to determine the genotypes of Langya chickens at loci 27_3773331 and 27_3773733, and association analysis was performed with laying traits, including: age at first laying (AFE), number of eggs laid during the rising laying period (EN1), number of eggs laid during peak laying period (EN2), number of eggs laid during the duration of laying (EN3), total number of eggs laid at 43 weeks of age (E43), and longest continuous laying days (MCL). The results are shown in Table 1.

[0052] Table 1: Association analysis of key promoter region SNP sites of the FMNL1 gene with egg production traits in Langya chickens Note: When P < 0.05, the association between each genotype and the egg production trait is significantly different; otherwise, it is not significant. The unit for AFE and MCL is "days," and the unit for EN1, EN2, EN3, and EN43 is "units."

[0053] The results showed that the 27_3773331 locus was significantly associated with age at first egg (AFE), number of eggs laid during the rising egg production period (EN1), and number of eggs laid at 43 weeks of age (E43), with the GG genotype corresponding to an earlier age at first egg and a higher number of eggs laid. The 27_3773733 locus was also significantly associated with age at first egg (AFE), number of eggs laid during the rising egg production period (EN1), and number of eggs laid at 43 weeks of age (E43), with the AA genotype corresponding to an earlier age at first egg and a higher number of eggs laid.

[0054] Example 3: Design and application verification of molecular markers and detection reagents for the chicken FMNL1 gene promoter region. 1. Design of molecular markers and detection reagents for the chicken FMNL1 gene promoter region: Based on the two SNP sites that were significantly associated with egg production traits in hens screened in Example 1, this example designed a molecular marker for the promoter region of the chicken FMNL1 gene.

[0055] The nucleotide sequence of the molecular marker of the promoter region of the chicken FMNL1 gene is shown in SEQ ID NO.1; the 136th base from the 5' end of the sequence is the SNP1 site, and its base polymorphism is T or G; the 538th base from the 5' end of the sequence is the SNP2 site, and its base polymorphism is G or A.

[0056] A detection reagent was designed based on the molecular markers in the promoter region of the chicken FMNL1 gene. The detection reagent is a PCR sequencing kit, comprising primer pairs for detecting the molecular markers in the promoter region of the chicken FMNL1 gene, the specific nucleotide sequences of which are as follows: FMNL1-F: TACAGAGCTGTGCCAGCGAC; (SEQ ID NO.2) FMNL1-R: TGGGGTCACCACATTACAGTAC. (SEQ ID NO.3) 2. Application Validation: Another 300 Langya hens with egg production records were selected as test subjects. Genomic DNA was extracted from the test subjects and PCR amplification was performed using the above-mentioned detection primer pairs. The PCR reaction system was 50 μL: 2 μL genomic DNA, 25 μL 2×PhantaUniFi Master Mix, 2 μL each of upstream and downstream primers (10 μM), and ddH2O was added to make up to 50 μL.

[0057] The PCR amplification program was as follows: 98℃ pre-denaturation for 30 seconds; 98℃ denaturation for 10 seconds, 60℃ annealing for 10 seconds, 72℃ extension for 30 seconds, for 35 cycles; after the cycles, complete extension was performed and incubated at 72℃ for 5 minutes.

[0058] The gel electrophoresis results of the amplification products are as follows: Figure 4 As shown; sequencing analysis of the amplified products was performed, and the egg production trait of hens was predicted based on the base detection results at two SNP sites in the molecular marker of the chicken FMNL1 gene promoter region. Specifically: Hens with genotypes GG and AA at SNP1 and SNP2 loci respectively have an earlier age of laying eggs than hens with genotypes TG or TT at SNP1 locus and GA or GG at SNP2 locus. Hens with genotypes GG at SNP1 and AA at SNP2 have higher egg production during the rising egg production period (EN1) and higher egg production at 43 weeks of age (E43) than hens with genotypes TG or TT at SNP1 and GA or GG at SNP2.

[0059] Comparison of the marker-based predictions with the actual egg production records of the corresponding hens revealed consistency between the two results. This demonstrates that the marker-based molecular markers in the chicken FMNL1 gene promoter region of this invention can be used for accurate prediction of egg production traits in hens.

[0060] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. A molecular marker for the promoter region of the chicken FMNL1 gene, characterized in that, The nucleotide sequence of the molecular marker of the promoter region of the chicken FMNL1 gene is shown in SEQ ID NO.1; the 136th base from the 5' end of the sequence is the SNP1 site, and its base polymorphism is T or G; the 538th base from the 5' end of the sequence is the SNP2 site, and its base polymorphism is G or A.

2. The molecular marker for the chicken FMNL1 gene promoter region according to claim 1, characterized in that, SNP1 locus is for the GG genotype and SNP2 locus is for the AA genotype, corresponding to an earlier age at the start of egg production and a higher number of eggs laid.

3. A detection reagent, characterized in that, It comprises: a primer pair for detecting the molecular marker of the chicken FMNL1 gene promoter region as described in claim 1, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The detection reagent according to claim 3, characterized in that, The detection reagent is a PCR sequencing kit or a KASP typing kit.

5. The application of the molecular marker of the chicken FMNL1 gene promoter region as described in claim 1 or 2 in the breeding of hens with traits of early onset of egg production and high egg production.

6. The use of the detection reagent according to claim 3 in either (1) or (2) below: (1) Identify the egg-laying traits of hens; (2) Select and breed hens with traits of early onset of egg production and high egg production.

7. The application according to claim 6, characterized in that, The egg production traits include: age at first laying, number of eggs laid during the rising egg production period, or total number of eggs laid at 43 weeks of age.

8. The application according to claim 6, characterized in that, The method for selecting hens with traits of early onset of egg production and high egg quantity is as follows: Using the genomic DNA of the hen to be tested as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3 to obtain the amplification products; the amplification products were sequenced, and the egg production traits of the hens were identified based on the sequencing results, and hens with early onset of egg production and high egg production were selected.

9. The application according to claim 8, characterized in that, If the sequencing results of the amplified product correspond to the GG genotype at position 136 and the AA genotype at position 538 of the sequence shown in SEQ ID NO.1, then it is identified as having the traits of early onset of egg production and high egg quantity.