DNA methylation rate detection method based on QPCR (Quantitative Polymerase Chain Reaction)
By combining bisulfite treatment and PCR amplification of parallel samples with fluorescence signal analysis, the problems of high cost, complex operation and low accuracy in existing DNA methylation detection methods have been solved, and high sensitivity and high accuracy of DNA methylation rate detection have been achieved.
Patent Information
- Application Number
- CN202610052963.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-15
- Publication Date
- 2026-05-15
AI Technical Summary
Existing DNA methylation detection methods struggle to balance cost, ease of operation, and detection accuracy, especially when quantifying differences in low methylation rates. Furthermore, primer design is highly sequence-dependent, resulting in uneven amplification efficiency and leading to deviations in quantitative results.
After treating the DNA samples to be tested with bisulfite, they were divided into two parallel samples, A and B. PCR amplification was performed using the same amplification primers and conditions. Methylated and non-methylated templates were detected independently by depleting dATP or dGTP. The methylation rate was directly calculated by combining fluorescence signal analysis.
It achieves high-precision and low-cost DNA methylation rate detection, reduces the sequence dependence of primer design, ensures consistent amplification efficiency, improves detection sensitivity and accuracy, and avoids non-specific amplification interference.
Smart Images
Figure CN122038548A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology technology, specifically relating to a qPCR method for detecting methylation rate, which can use qPCR technology to quantify DNA methylation rate with high precision. Background Technology
[0002] Quantitative polymerase chain reaction (qPCR) is a highly sensitive molecular biology detection method developed based on traditional PCR technology. Unlike traditional PCR, qPCR can monitor the accumulation of amplified products in real time through fluorescence signals, directly obtaining quantitative information of DNA or RNA during the reaction. Therefore, it is widely used in gene expression analysis, pathogen detection, mutation detection, transgenic detection, and clinical molecular diagnostics. This technology has high sensitivity and specificity, capable of detecting target nucleic acids with low copy numbers, making it suitable for micro-sample analysis. Furthermore, qPCR's real-time quantification capability eliminates the need for subsequent gel electrophoresis to obtain the quantity information of target molecules, and it covers a wide detection range from low to high copy numbers. In addition, combined with automated platforms, qPCR can achieve rapid, high-throughput detection, greatly improving experimental efficiency.
[0003] DNA methylation, as an important epigenetic modification, plays a crucial role in gene expression regulation, cell differentiation, and disease development. Abnormal methylation patterns are closely associated with a variety of diseases, including cancer, genetic diseases, and metabolic and immune-related disorders. For example, hypermethylation of promoters of certain tumor-specific genes often leads to gene silencing, serving as an important biomarker for early cancer diagnosis. Simultaneously, dynamic changes in methylation levels can be used for disease prognosis assessment and treatment monitoring. Therefore, accurate and rapid detection of DNA methylation status is of great significance for early disease diagnosis, subtyping, and the development of personalized treatment plans. With the increasing clinical demand for molecular markers, highly sensitive, quantitatively accurate methylation detection technologies suitable for large-scale sample analysis have become a key link in promoting the development of precision medicine and molecular diagnostics.
[0004] In the field of DNA methylation detection, sequencing-based methods offer high accuracy and resolution, enabling quantitative analysis of methylation levels at individual CpG sites, making them suitable for in-depth basic research. However, these methods are typically costly, complex to operate, and time-consuming, making them unsuitable for large-scale clinical sample screening.
[0005] Quantitative real-time fluorescence microscopy (qMSP) is a molecular biology method for detecting DNA methylation levels by combining real-time fluorescence quantitative technology with traditional methylation-specific PCR (MSP). This method involves treating DNA with bisulfite, which converts unmethylated cytosine to uracil, while methylated cytosine remains unchanged. Two sets of specifically designed primers and fluorescent probe systems are used to detect methylated and unmethylated sequences respectively. Fluorescence signals are monitored in real-time during PCR amplification, and the methylation ratio is calculated using a standard curve or Ct value to achieve quantitative analysis.
[0006] While real-time quantitative MSP (qMSP) has achieved quantitative detection of methylation, it still has the following main drawbacks:
[0007] (1) MSP requires the design of two pairs of specific primers (methylated and unmethylated). Primer design is highly sequence-dependent and must cover multiple CpG sites to ensure specificity, making the design difficult and costly. (2) The amplification efficiency of methylated and unmethylated DNA may differ, leading to deviations in quantitative results, requiring optimization of reaction conditions. (3) Although qMSP has improved sensitivity compared to traditional MSP, it still faces difficulties in quantifying differences in low methylation rates. (4) qMSP requires the construction of a standard curve for quantification. The preparation and dilution of standards may introduce errors, and the amplification efficiency of standards and test samples may differ, affecting the accuracy of quantification.
[0008] While real-time quantitative methylation (MSP) reduces experimental costs and simplifies procedures compared to sequencing, its quantitative capabilities are limited, and it has certain limitations in accurately detecting methylation rates, making it difficult to provide precise information on methylation levels. Therefore, existing methylation detection methods involve a trade-off between cost, ease of operation, and detection accuracy, and still struggle to simultaneously achieve high throughput, accuracy, and cost-effectiveness. This leaves room for the development of novel, highly sensitive, quantitatively accurate methods suitable for large-scale sample testing. Summary of the Invention
[0009] This invention addresses the shortcomings of existing technologies by providing a qPCR-based method for detecting DNA methylation rate. Unlike traditional methylation-specific PCR methods that rely on Ct values to calculate DNA substrate methylation rate, this method involves treating the DNA sample with bisulfite and then dividing it into two parallel samples, A and B. Using the same amplification primers and under identical conditions, PCR amplification first amplifies the methylated and unmethylated DNA templates in the samples. Then, using templates and primers with thymine deoxyribonucleotide repeat sequences or cytosine deoxyribonucleotide repeat sequences, the dATP in the reaction system of sample A and the dGTP in the reaction system of sample B are depleted, respectively. The independent detection of methylated and unmethylated templates is controlled by the d3TP system lacking either dATP or dGTP. Finally, the methylation rate of the DNA sample is calculated directly by analyzing the fluorescence signals of the methylated and unmethylated templates using a methylation rate calculation function.
[0010] The specific technical solution of this invention is as follows:
[0011] A method for detecting DNA methylation rate based on qPCR includes the following steps:
[0012] (1) DNA batch template construction: After the DNA sample to be tested was treated with bisulfite, it was divided into two parallel samples, A and B. The same pair of specific pre-amplification primers Pre-F and Pre-R were used for PCR pre-amplification of samples A and B respectively. Pre-amplification primer Pre-R amplified the DNA template with the methylation site to be tested, and pre-amplification primer Pre-F amplified the complementary strand of the DNA template with the methylation site to be tested. The amplification system contained excess dNTPs, and the pre-amplification primer Pre-R did not cover the methylation site to be tested.
[0013] (2) Construction of d3TP system: PCR amplification was performed in sample A system using an excess of (a) DNA template SRT-M containing thymine deoxyribonucleic acid repeat sequence and amplification primer SRF-1, and PCR amplification was performed in sample B system using an excess of (b) DNA template SRT-U containing cytosine deoxyribonucleic acid repeat sequence and amplification primer SRF-2. The PCR reaction conditions were the same for both systems, with the annealing temperature lower than that in step (1). The reaction was carried out until the dATP in sample A and the dGTP in sample B were completely consumed.
[0014] (3) Methylation / Nonmethylation Signal Collection: PCR amplification was performed on samples A and B under the same conditions using an excess of the formal amplification primer F and fluorescent probe P for the methylation sites to be tested. The formal amplification primer F and fluorescent probe P were complementary upstream and downstream molecules closely adjacent to the methylation sites to be tested on the same DNA template, separated only by the methylation sites to be tested. The annealing temperature was lower than that in step (2). The fluorescence signals of samples A and B were monitored. The fluorescence signal of sample A represented the detection of methylated DNA template, and the fluorescence signal of sample B represented the detection of nonmethylated DNA template. The methylation rate of the DNA samples to be tested was calculated using a methylation rate calculation function. , where β is the methylation rate, Fm is the maximum fluorescence amplification value of the methylated signal channel, and Fu is the maximum fluorescence amplification value of the unmethylated signal channel. The fluorescence signal amplification value is calculated by subtracting the fluorescence signal value of the amplification system from the fluorescence signal value of the amplification system with blank background from the fluorescence signal value of the DNA sample amplification system to be tested.
[0015] This invention employs bisulfite treatment of the DNA sample as a conventional method for methylation detection. The purpose is to distinguish between methylated and unmethylated DNA templates. Under acidic conditions, bisulfite (usually bisulfite) deamination of unmethylated cytosine in the DNA template, converting it into uracil. In subsequent PCR amplification, uracil (U) is treated as thymine and paired for replication. The methylated cytosine in the methylated DNA template remains unchanged during bisulfite treatment and continues to pair with guanine as cytosine in subsequent PCR amplification.
[0016] In step (2) of this invention, SRT-M is a DNA sequence containing a thymine deoxyribonucleotide repeat sequence. Using it as a template, a DNA sequence containing an adenine deoxyribonucleotide repeat sequence is synthesized by amplification primer SRF-1. This depletes the adenine deoxyribonucleotide (dATP) in the dNTP system (dATP, dTTP, dCTP, dGTP) used in the reaction system of sample A, so as to ensure that the unmethylated DNA template in sample A cannot be amplified due to the lack of adenine deoxyribonucleotide (dATP) during PCR amplification in step (3), thus making the methylation signal purer.
[0017] Correspondingly, SRT-U is a DNA sequence containing a cytosine deoxyribonucleotide repeat sequence. Using it as a template, a DNA sequence containing a guanine deoxyribonucleotide repeat sequence is synthesized by amplification primer SRF-2. This depletes the guanine deoxyribonucleotide (dGTP) in the dNTP system (dATP, dTTP, dCTP, dGTP) used in the reaction system of sample B, so as to ensure that the methylated DNA template in sample B cannot be amplified due to the lack of guanine deoxyribonucleotide (dGTP) during PCR amplification in step (3), making the unmethylated signal purer.
[0018] In the detection method of the present invention, the template SRT-M with a thymine deoxyribonucleic acid repeat sequence and the amplification primer SRF-1 and the template SRT-U with a cytosine deoxyribonucleic acid repeat sequence and the amplification primer SRF-2 can be added to sample A and sample B respectively in step (1) or step (2).
[0019] In the detection method of the present invention, the formal amplification primer F and fluorescent probe P of the methylation site to be tested can be added to sample system A and sample B respectively in step (1), step (2) or step (3).
[0020] In a specific example, in step (1), the template SRT-M with the thymine deoxyribonucleic acid repeat sequence, the amplification primer SRF-1, the formal amplification primer F for the methylation site to be tested, and the fluorescent probe P are all added to sample A; in step (1), the template SRT-U with the cytosine deoxyribonucleic acid repeat sequence, the amplification primer SRF-2, the formal amplification primer F for the methylation site to be tested, and the fluorescent probe P are all added to sample B. To ensure that deoxyribonucleotides are accurately depleted after pre-amplification (step (1)) and before formal amplification (step (3)), the pre-amplification primers Pre-F and Pre-R, the amplification primers SRF-1 and SRF-2 for the single nucleotide repeat DNA sequence, and the formal amplification primer F should meet the necessary annealing temperature differences. Specifically, the annealing temperature of the pre-amplification primers Pre-F and Pre-R should be higher than that of the amplification primers SRF-1 and SRF-2, the annealing temperature of the amplification primers SRF-1 and SRF-2 should be higher than that of the formal amplification primer F, and the annealing temperature of the fluorescent probe P should be higher than that of the formal amplification primer F. Preferably, the PCR annealing temperature in step (1) is 10°C or higher than the PCR annealing temperature in step (2); the PCR annealing temperature in step (2) is 10°C or higher than the PCR annealing temperature in step (3); and the annealing temperature of the fluorescent probe in step (3) is 10°C or higher than the annealing temperature of the amplification primers. A strict amplification sequence is achieved through successive annealing from high to low temperature.
[0021] Pre-amplification primers Pre-F and Pre-R, amplification primers SRF-1 and SRF-2 for single nucleotide repeat DNA sequences, and formal amplification primers F and fluorescent probes can be designed using methods recognized in the art. The desired annealing temperatures or hybridization characteristics can be achieved by adjusting the sequence characteristics of these primers and probes. For example, this can be achieved by adjusting primer length, GC content, adding modified bases or base analogs (such as locked nucleic acids (LNA), inosine (I), phosphate thioester modifications), or adding tail sequences or special sequences (such as restriction enzyme sites, promoter sequences, etc.) to the 5′ end of the primers.
[0022] A specific example of the detection method described in this invention,
[0023] Step (1) PCR program:
[0024] 1) At the denaturing temperature, the DNA templates in samples A and B denature to obtain single-stranded DNA templates;
[0025] 2) At the annealing temperature, the pre-amplification primers Pre-F and Pre-R bind to the DNA single-strand template;
[0026] 3) At the extension temperature, Taq enzyme extends the primers and amplifies to obtain a new DNA template strand;
[0027] 4) Repeat steps 1) to 3) to obtain a large quantity of DNA templates;
[0028] Step (2) PCR program:
[0029] 1) At denaturing temperature, the template SRT-M and amplification primer SRF-1 with thymine deoxyribonucleotide repeat sequence in sample A are unchained, and the template SRT-U and amplification primer SRF-2 with cytosine deoxyribonucleotide repeat sequence in sample B are unchained.
[0030] 2) At the annealing temperature, the amplification primer SRF-1 binds to the template SRT-M and the amplification primer SRF-2 to the template SRT-U in a complementary pairing.
[0031] 3) At the extension temperature, the Taq enzyme extends to the 5' end of the template SRT-M or template SRT-U;
[0032] 4) Repeat steps 1) to 3) to deplete the dATP in sample A and the dGTP in sample B.
[0033] Step (3) PCR program:
[0034] 1) At denaturing temperature, a large amount of DNA template double strands in samples A and B are unstranded;
[0035] 2) At the primer annealing temperature, the formal amplification primer F binds to the DNA single-stranded template with the methylation site to be tested, and at the probe annealing temperature, the fluorescent probe P binds to the DNA single-stranded template. The formal amplification primer F and the fluorescent probe P are separated by the methylation site to be tested.
[0036] 3) At the extension temperature, in sample A, the F primer bound to the methylated DNA template, in the presence of dGTP, extends with Taq polymerase. The DNA polymerase's 5'-3' end DNA exonuclease activity cleaves probe P, releasing the fluorescent group. In sample A, the F primer bound to the unmethylated DNA template cannot extend due to the lack of dATP. In sample B, the F primer bound to the unmethylated DNA template, in the presence of dATP, extends with Taq polymerase. The DNA polymerase's 5'-3' end DNA exonuclease activity cleaves probe P, releasing the fluorescent group. In sample B, the F primer bound to the methylated DNA template cannot extend due to the lack of dGTP.
[0037] A specific qPCR procedure includes:
[0038] Step (1) PCR program is as follows: (i) Denaturation, 95~98℃, 5 seconds~30 seconds; (ii) Annealing, 80~90℃, 10 seconds~30 seconds; (iii) Extension, 72~75℃, 10 seconds~30 seconds; repeat steps (i)~(iii) 40~50 times.
[0039] The PCR program for step (2) is as follows: (iv) denaturation, 95~98℃, 5 seconds~30 seconds; (v) annealing, 70~80℃, 10 seconds~30 seconds; (vi) extension, 72~75℃, 10 seconds~30 seconds; repeat steps (iv)~(vi) 5~10 times.
[0040] Step (3) PCR program is as follows: (vii) denaturation, 95~98℃, 5 seconds~30 seconds; (vii) primer annealing, 60~70℃, 10 seconds~30 seconds; (probe annealing, 70~80℃, 10 seconds~30 seconds); (ix) extension, 72~75℃, 10 seconds~30 seconds; repeat steps (vii)~(ix) 5~10 times.
[0041] The cycling procedure for depleting specific deoxyribonucleic acid should be calculated based on the molecular weight of the actual initial feedstock and optimized experimentally.
[0042] To avoid the remaining pre-amplification primers Pre-R competing with the formal amplification primer F during template amplification in step (3) after PCR amplification in step (1), thus hindering formal amplification, it is preferable that the formal amplification primer F is closer to the methylation site to be tested than the pre-amplification primers Pre-R, and that the binding positions of the pre-amplification primers Pre-R and the formal amplification primer F with the DNA template containing the methylation site to be tested do not overlap.
[0043] Another objective of this invention is to provide a qPCR amplification system for detecting DNA methylation rate, used to implement the method described in this invention.
[0044] Specifically, the qPCR amplification system includes a methylated template amplification system and an unmethylated template amplification system. The methylated template amplification system includes primers Pre-F and Pre-R for pre-amplifying double-stranded DNA templates, a template SRT-M with thymine deoxyribonucleotide repeat sequences and its corresponding amplification primer SRF-1, a formal amplification primer F for the methylation site to be tested, and a fluorescent probe P. The unmethylated amplification system includes primers Pre-F and Pre-R for amplifying double-stranded DNA templates, a template SRT-U with cytosine deoxyribonucleotide repeat sequences and its corresponding amplification primer SRF-2, a formal amplification primer F for the methylation site to be tested, and a fluorescent probe P. The methylated template amplification system and the unmethylated template amplification system also include amplification reaction buffer, magnesium ions, DNA polymerase, and dNTPs. Each component in the methylated template amplification system is present in equal amounts as the corresponding component in the unmethylated template amplification system.
[0045] The qPCR amplification system described in this invention can be used as a detection reagent for qPCR reactions that detect methylation characteristics of CpG sites in specific DNA sequences, and can be applied to disease diagnosis. These diseases include, but are not limited to, diseases caused by abnormal DNA methylation due to tumors, genetic abnormalities, metabolic abnormalities, or infections with drug-resistant pathogens. Examples include hematologic malignancies, solid tumors such as colorectal cancer, congenital genetic diseases such as thalassemia, multidrug-resistant tuberculosis complex infection, and drug-resistant human immunodeficiency virus infection.
[0046] Advantages of this invention:
[0047] This invention establishes a high-precision, high-sensitivity, and low-cost qPCR method for detecting DNA methylation rate.
[0048] (1) Unlike traditional MSP which requires the design of two pairs of specific primers (methylated and unmethylated), this invention uses the same amplification primers and the same conditions for both methylated and unmethylated DNA templates in the pre-amplification program to achieve exponential amplification without difference. This not only reduces the high dependence of primer design on sequence, but also ensures that the amplification efficiency of methylated and unmethylated DNA is the same, thus avoiding deviations in quantitative results.
[0049] (2) The present invention ingeniously utilizes templates and primers with thymine deoxyribonucleotide repeat sequences and templates and primers with cytosine deoxyribonucleotide repeat sequences to deplete dATP in the methylated DNA template amplification system and dGTP in the non-methylated DNA template amplification system, respectively. The amplification of non-methylated templates in the methylated DNA template amplification system is avoided by the d3TP environment lacking dATP, and the amplification of methylated templates in the non-methylated DNA template amplification system is avoided by the d3TP environment lacking dGTP, thereby achieving independent amplification of methylated and non-methylated DNA templates and making the detected methylation rate more accurate.
[0050] (3) Existing qMSP technology relies on the design of highly specific primers. However, during PCR amplification, even with highly specific primer design, non-specific amplification and primer dimer formation still occur. These background signals can mask small differences in methylation rate. Furthermore, although MSP primer design covers multiple CpG sites to improve specificity, the implementation of this invention does not rely on the high specificity of primers. Even with extremely small differences in methylation rate, the generation of conditional fluorescence signals controlled by the absence of dATP or dGTP can be achieved, resulting in higher sensitivity and accuracy.
[0051] (4) The present invention achieves independent detection of methylated and non-methylated templates through parallel samples. It directly analyzes the fluorescence signals of methylated and non-methylated templates without relying on Ct values to calculate the methylation rate of DNA substrates. Compared with qMSP, which requires the construction of a standard curve for quantification, the method of the present invention has higher quantitative accuracy. Attached Figure Description
[0052] To more clearly illustrate the technical solution of the present invention, the accompanying drawings used in the embodiments of the present invention will be briefly described below.
[0053] Obviously, the accompanying drawings described below are only some of the drawings of the embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort, but these other drawings are also within the scope of the drawings required for the embodiments of the present invention.
[0054] Figure 1This is a schematic diagram illustrating the mechanism of the DNA methylation rate detection method of the present invention. Detailed Implementation
[0055] To make the objectives, technical solutions, beneficial effects, and significant advancements of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings provided in the embodiments of the present invention.
[0056] Obviously, all the embodiments described are only some embodiments of the present invention, and not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0057] Those skilled in the art can understand the specific meaning of the above terms in this invention according to the specific circumstances.
[0058] In this invention, the term "forward primer" refers to a primer positioned upstream or downstream of the DNA double helix. For sequencing purposes, the sequence of the positive strand of DNA is read from 5′ to 3′.
[0059] In this invention, the term "reverse primer" refers to a primer (downstream primer) that extends along the forward strand. In in vitro DNA amplification, the double helix is partially or completely open; there is no Okazaki fragment, and it does not extend in segments. Theoretically, both forward and reverse primers extend continuously, which differs from in vivo DNA self-replication.
[0060] In this invention, the term "probe" refers to a nucleic acid sequence (DNA or RNA) complementary to the target gene, carrying a detection marker and having a known sequence. Gene probes bind to the target gene through molecular hybridization, generating a hybridization signal that reveals the target gene from the vast genome. Based on the principle of hybridization, the nucleic acid sequence used as a probe must meet at least the following two conditions: ① It should be single-stranded; if double-stranded, it must be denatured first. ② It should carry an easily detectable marker. It can include the entire gene or only a part of it; it can be DNA itself or RNA transcribed from it.
[0061] In this invention, the term "QPCR" refers to Real-time Quantitative PCR Detecting System, also known as Real-time Quantitative Gene Amplification Fluorescence Detection System.
[0062] It should also be noted that the following specific embodiments can be combined with each other, and the same or similar concepts or processes may not be described again in some embodiments.
[0063] The technical solution of the present invention will now be described in detail with reference to specific embodiments.
[0064] Example 1: Comparison of the DNA methylation rate detection method of the present invention with the traditional qMSP
[0065] The purpose of this embodiment is to demonstrate that the DNA methylation rate detection method described in this invention has higher precision and sensitivity than the traditional qMSP method. Therefore, this embodiment conducts two sets of experiments: one set uses the traditional qMSP method to detect and analyze the methylation rate of multiple DNA samples with known methylation rates, and the other set uses the DNA methylation rate detection method described in this invention to detect and analyze the methylation rate of the same DNA sample. The final evaluation criterion for methylation rate detection capability is the absolute value of the difference between the analyzed methylation rate and the true methylation rate. The closer the absolute value of the difference is to 0, the stronger the methylation rate detection capability of the corresponding method.
[0066] 1.1 Sample Preparation
[0067] To compare the detection capabilities of different methylation rate detection methods for DNA methylation rate, mixtures of DNA samples with methylation rates of 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 100% were prepared. Specifically, a DNA sequence with methylated CpG sites and a DNA sequence with unmethylated CpG sites were first synthesized. The methylated DNA sequence refers to the methylated DNA sequence after complete heavy-pressure sulfate conversion, and the unmethylated DNA sequence refers to the unmethylated DNA sequence after complete heavy-pressure sulfate conversion. The synthesized DNA fragments were diluted to a concentration of 2.4 × 10⁻⁶. -6 The concentration was set at ng / μL, and then mixed in a certain proportion to obtain DNA sample mixtures with different methylation rates. The sequence information of the synthesized methylated DNA sequence DNA1 and the unmethylated DNA sequence DNA2 are as follows:
[0068] DNA1:
[0069] 5'-TTGGGTTGGTAGTTATGGATTAGAAAGGTTTATGGTATTAGGGTATAATGGGATAGGTATAAGGTATAATATATATTGGGGTTGGTTGGGATTATGAATTTAGTAGTA CG GGTGTATTGTTAGTTTTTTAAGTTTTGTTTGGGTATTTGGTTTGGATTTATTTTTGGTTTATGGGAGGGGTGATAATTTATTGAGGGGGGAG-3'.
[0070] DNA2:
[0071] 5'-TTTTTTTTTAGTTATGGATTAGAAAGGTTTATGGTATTAGGGTATAATGGGATAGGTATAAGGTATAATATATATTGGGGTTGGTTGGGATTATGAATTTAGTAGTA TG GGTGTATTGTTAGTTTTTTAAGTTTTGTTTGGGTATTTGGTTTGGATTTATTTTTGGTTTATGGGAGGGGTGATAATTTATTGAGGGGGGAG-3'.
[0072] The synthesized DNA1 and DNA2 fragments were mixed in ratios of 0:10, 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1, and 10:0 to obtain DNA template samples with methylation rates of 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 100%, namely DNA-T0, DNA-T1, DNA-T2, DNA-T3, DNA-T4, DNA-T5, DNA-T6, DNA-T7, DNA-T8, DNA-T9, and DNA-T10.
[0073] 1.2 Primer and probe synthesis
[0074] 1.2.1 Primer and probe synthesis using the traditional qMSP method
[0075] To achieve the best results in detecting methylation rate using traditional MSP, the 3' ends of the primers were designed at the CpG site. The primer and probe sequences for the methylation template used in the traditional MSP method are F1, R1-1, and P1, respectively. The specific sequence information is as follows:
[0076] F1: 5'-GGTATTAGGGTATAATGGGATAGGTATAAGGT-3';
[0077] R1-1: 5'-ACAAAACTTAAAAAACTAACAATACACCCG-3';
[0078] P1: 5'-FAM-TTGGTTGGGATTATGAATTTAGTAG-MGB-3'.
[0079] The primer and probe sequences used for detecting unmethylated templates in the traditional qMSP method are F1, R1-2, and P1, respectively. The sequence information for F1 and P1 is as described above, and the sequence information for R1-2 is as follows:
[0080] R1-2: 5'-ACAAAACTTAAAAAACTAACAATACACCCA.
[0081] 1.2.2 Primer and probe synthesis based on the method described in this invention
[0082] The primer and probe sequences used for detecting methylated DNA templates using the method described in this invention are as follows:
[0083] Pre-amplification forward primers (Pre-F): 5'-TTGGGTTGGTLNA-AGTTLNA-ATGGLNA-ATTLNA-AGAALNA-AGGTTT-3';
[0084] Pre-amplification reverse primers (Pre-R): 5'-ATALNA-AACCAALNA-AAATAALNA-ATCCAALNA-ACCAALNA-ATACCC-3';
[0085] Single nucleotide repeat DNA sequence template SRT-M: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGACCGGTATTCGGAGGACCGATGA-3';
[0086] Single nucleotide repeat DNA sequence primers SRF-1 and SRF-2: 5'-TCATCGGTCCTCCGAATACCGGTCC-3';
[0087] Formal amplification primer F2: 5'-ATCCAAACCAAATACCCAAACAAA-3';
[0088] Formal amplification probe P2: 5'-FAM-AATTCATAATCCCAACCAAC-MGB-3'.
[0089] The primer and probe sequences used for detecting methylated DNA templates using the method described in this invention are as follows:
[0090] The pre-amplification forward primer Pre-F, the pre-amplification reverse primer Pre-R, the single nucleotide repeat DNA sequence primer SRF-2, the formal amplification primer F2, and the formal amplification probe P2 are all as described above.
[0091] Single nucleotide repeat DNA sequence template SRT-U: 5'-CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGGACCGGTATTCGGAGGACCGATGA-3'.
[0092] 1.3 Experiment 1
[0093] Prepare the qPCR reaction solution according to the formulas described in Table 1 below, and run the qPCR program according to the procedure described in Table 2. Finally, obtain the Ct values of all DNA samples, and then calculate the methylation rate of each DNA sample using the following formula:
[0094] , where β is the methylation rate and ΔCt is the difference between the Ct value of the unmethylated signal channel and the Ct value of the methylated signal channel.
[0095] Table 1: Traditional MSP reaction solution formulation
[0096]
[0097] Table 2: qPCR Procedure Table for Traditional MSP Method
[0098]
[0099] 1.4 Experiment 2
[0100] The qPCR reaction solution was prepared according to the reaction solution formulation described in Table 3 of the present invention. Sample water was used to calculate background fluorescence, and then the fluorescence signal amplification value of the target gene was calculated. The qPCR program was performed according to the qPCR procedure described in Table 4 of the present invention. Finally, the maximum fluorescence amplification of all DNA samples was obtained, and then the methylation rate of each DNA sample was calculated. The calculation formula is as follows:
[0101] , where β is the methylation rate, Fm is the maximum fluorescence amplification value of the methylated signal channel, Fu is the maximum fluorescence amplification value of the unmethylated signal channel, and the fluorescence signal amplification value is the fluorescence signal value of each amplification system of DNA-T0~DNA-T10 samples minus the fluorescence signal value of the amplification system corresponding to sample H2O.
[0102] Table 3: qPCR system configuration table based on the methylation rate detection method described in this invention
[0103]
[0104] Table 4: QPCR Procedure Table Based on the Methylation Rate Detection Method of the Present Invention
[0105]
[0106] 1.5 Experimental Results
[0107] The results of methylation rate detection experiments using the traditional qMSP method are shown in Table 5 below. The method only showed good quantitative ability for templates with 0% and 100% methylation rates; for all other DNA templates with different methylation rates, the difference between the quantified methylation rate and the true methylation rate was significant. Conversely, in the methylation rate detection method based on the present invention, as shown in Table 6 below, the difference between the quantified methylation rate and the true methylation rate for all DNA templates is almost negligible.
[0108] The average absolute value of the difference between the methylation rate detected by the traditional MSP detection method and the true methylation rate is as high as 11.4%, and the maximum value is as high as 28.4%. Moreover, the detection performance of DNA templates with different methylation rates varies greatly. However, in the methylation rate detection method of the present invention, the average absolute value of the difference in methylation rate is only 0.8%, and the maximum value does not exceed 3%. At the same time, it maintains stability in all repeated experiments. This example proves the feasibility and sensitivity of the DNA methylation rate detection method based on qPCR described in the present invention.
[0109] Table 5: Summary of detection results for DNA templates with different methylation rates using the traditional qMSP detection method
[0110]
[0111] Table 6: Summary of detection results for DNA templates with different methylation rates based on the method described in this invention.
[0112]
Claims
1. A method for detecting DNA methylation rate based on qPCR, characterized in that... Includes the following steps: (1) DNA batch template construction: After the DNA sample to be tested was treated with bisulfite, it was divided into two parallel samples, A and B. The same pair of specific pre-amplification primers Pre-F and Pre-R were used for PCR pre-amplification of samples A and B respectively. Pre-amplification primer Pre-R amplified the DNA template with the methylation site to be tested, and pre-amplification primer Pre-F amplified the complementary strand of the DNA template with the methylation site to be tested. The amplification system contained excess dNTPs, and the pre-amplification primer Pre-R did not cover the methylation site to be tested. (2) Construction of d3TP system: PCR amplification was performed in sample A system using an excess of (a) DNA template SRT-M containing thymine deoxyribonucleic acid repeat sequence and amplification primer SRF-1, and PCR amplification was performed in sample B system using an excess of (b) DNA template SRT-U containing cytosine deoxyribonucleic acid repeat sequence and amplification primer SRF-2. The PCR reaction conditions were the same for both systems, with the annealing temperature lower than that in step (1). The reaction was carried out until the dATP in sample A and the dGTP in sample B were completely consumed. (3) Methylation / Nonmethylation Signal Collection: PCR amplification was performed on samples A and B under the same conditions using an excess of the formal amplification primer F and fluorescent probe P for the methylation sites to be tested. The formal amplification primer F and fluorescent probe P were complementary upstream and downstream molecules closely adjacent to the methylation sites to be tested on the same DNA template, separated only by the methylation sites to be tested. The annealing temperature was lower than that in step (2). The fluorescence signals of samples A and B were monitored. The fluorescence signal of sample A represented the detection of methylated DNA template, and the fluorescence signal of sample B represented the detection of nonmethylated DNA template. The methylation rate of the DNA samples to be tested was calculated using a methylation rate calculation function. , where β is the methylation rate, Fm is the maximum fluorescence amplification value of the methylated signal channel, and Fu is the maximum fluorescence amplification value of the unmethylated signal channel. The fluorescence signal amplification value is calculated by subtracting the fluorescence signal value of the amplification system from the fluorescence signal value of the amplification system with blank background from the fluorescence signal value of the DNA sample amplification system to be tested.
2. The detection method as described in claim 1, characterized in that... The template SRT-M with a thymine deoxyribonucleic acid repeat sequence and the amplification primer SRF-1 and the template SRT-U with a cytosine deoxyribonucleic acid repeat sequence and the amplification primer SRF-2 are respectively added to sample A and sample B in step (1) or step (2).
3. The detection method as described in claim 1, characterized in that... The formal amplification primer F and fluorescent probe P for the methylation site to be tested are added to sample systems A and B respectively in step (1), step (2) or step (3).
4. The detection method as described in claim 1, characterized in that, The PCR annealing temperature in step (1) is 10°C or higher than the PCR annealing temperature in step (2); the PCR annealing temperature in step (2) is 10°C or higher than the PCR annealing temperature in step (3).
5. The detection method as described in claim 1, characterized in that, Step (1) PCR program: 1) At the denaturing temperature, the DNA templates in samples A and B denature to obtain single-stranded DNA templates; 2) At the annealing temperature, the pre-amplification primers Pre-F and Pre-R bind to the DNA single-strand template; 3) At the extension temperature, Taq enzyme extends the primers and amplifies to obtain a new DNA template strand; 4) Repeat steps 1) to 3) to obtain a large quantity of DNA templates; Step (2) PCR program: 1) At denaturing temperature, the template SRT-M and amplification primer SRF-1 with thymine deoxyribonucleotide repeat sequence in sample A are unchained, and the template SRT-U and amplification primer SRF-2 with cytosine deoxyribonucleotide repeat sequence in sample B are unchained. 2) At the annealing temperature, the amplification primer SRF-1 binds to the template SRT-M and the amplification primer SRF-2 binds to the template SRT-U in a complementary pair; 3) At the extension temperature, the Taq enzyme extends to the 5' end of the template SRT-M or template SRT-U; 4) Repeat steps 1) to 3) to deplete the dATP in sample A and the dGTP in sample B. Step (3) PCR program: 1) At denaturing temperatures, a large amount of double-stranded DNA template in samples A and B is unstranded; 2) At the primer annealing temperature, the formal amplification primer F binds to the DNA single-stranded template with the methylation site to be tested, and at the probe annealing temperature, the fluorescent probe P binds to the DNA single-stranded template. The formal amplification primer F and the fluorescent probe P are separated by the methylation site to be tested. 3) At the extension temperature, in sample A, the F primer bound to the methylated DNA template, in the presence of dGTP, extends with Taq polymerase. The DNA polymerase's 5'-3' end DNA exonuclease activity cleaves probe P, releasing the fluorescent group. In sample A, the F primer bound to the unmethylated DNA template cannot extend due to the lack of dATP. In sample B, the F primer bound to the unmethylated DNA template, in the presence of dATP, extends with Taq polymerase. The DNA polymerase's 5'-3' end DNA exonuclease activity cleaves probe P, releasing the fluorescent group. In sample B, the F primer bound to the methylated DNA template cannot extend due to the lack of dGTP.
6. The detection method as described in claim 5, characterized in that, Step (1) PCR program is as follows: (i) Denaturation, 95~98℃, 5 seconds~30 seconds; (ii) Annealing, 80~90℃, 10 seconds~30 seconds; (iii) Extension, 72~75℃, 10 seconds~30 seconds; repeat steps (i)~(iii) 40~50 times. The PCR program for step (2) is as follows: (iv) denaturation, 95~98℃, 5 seconds~30 seconds; (v) annealing, 70~80℃, 10 seconds~30 seconds; (vi) extension, 72~75℃, 10 seconds~30 seconds; repeat steps (iv)~(vi) 5~10 times. Step (3) PCR program is as follows: (vii) denaturation, 95~98℃, 5 seconds~30 seconds; (vii) primer annealing, 60~70℃, 10 seconds~30 seconds; (ix) extension, 72~75℃, 10 seconds~30 seconds; repeat steps (vii)~(ix) 5~10 times.
7. The detection method as described in claim 1, characterized in that... The formal amplification primer F is closer to the methylation site to be tested than the pre-amplification primer Pre-R, and there is no overlap between the binding sites of the pre-amplification primer Pre-R and the formal amplification primer F and the DNA template with the methylation site to be tested.
8. A qPCR amplification system for detecting DNA methylation rate, characterized in that... The qPCR amplification system is used to implement the method described in any one of claims 1 to 7.
9. The qPCR amplification system as described in claim 8, characterized in that... The amplification system includes a methylated template amplification system and an unmethylated template amplification system. The methylated template amplification system includes primers Pre-F and Pre-R for pre-amplifying double-stranded DNA templates, a template SRT-M with a thymine deoxyribonucleotide repeat sequence and its corresponding amplification primer SRF-1, a formal amplification primer F for the methylation site to be tested, and a fluorescent probe P. The unmethylated amplification system includes primers Pre-F and Pre-R for amplifying double-stranded DNA templates, a template SRT-U with a cytosine deoxyribonucleotide repeat sequence and its corresponding amplification primer SRF-2, a formal amplification primer F for the methylation site to be tested, and a fluorescent probe P. The methylated template amplification system and the unmethylated template amplification system also include amplification reaction buffer, magnesium ions, DNA polymerase, and dNTPs. Each component in the methylated template amplification system is present in equal amounts as the corresponding component in the unmethylated template amplification system.