OsWRKY30, a gene for resistance to southern rice black-streaked dwarf disease, and its application.

Abstract

This invention discloses a gene for rice resistance to Southern Rice Black-Streaked Dwarf Disease. OsWRKY30 Its application belongs to the fields of plant genetic engineering and molecular breeding technology. OsWRKY30 The gene encodes a WRKY family transcription factor, the nucleotide sequence of which is shown in SEQ ID NO:1, and the amino acid sequence of which is shown in SEQ ID NO:2. Experiments showed that knocking out this gene significantly reduced rice resistance to SRBSDV and exacerbated disease symptoms. This gene enhances rice's antiviral defense by positively regulating jasmonic acid biosynthesis and signaling pathways and activating the expression of a series of downstream disease resistance-related genes. Furthermore, in resistant and susceptible varieties... OsWRKY30 Natural variations associated with resistance were discovered in the promoter region, which can be used as molecular markers for disease resistance breeding. This invention provides important genetic resources and molecular tools for breeding new rice varieties resistant to SRBSDV.

Description

Technical Field

[0001] This invention belongs to the fields of plant genetic engineering and molecular breeding technology, specifically relating to a transcription factor protein OsWRKY30 related to rice resistance to viral diseases and its encoding gene, as well as the application of this gene in regulating rice resistance to Southern Rice Black-Streaked Dwarf Disease. Background Technology

[0002] Rice, a staple food crop for more than half the world's population, is frequently threatened by various viral diseases. Among them, Southern Rice Black-streaked Dwarf Virus (SRBSDV) has been one of the major viral diseases severely impacting rice production in southern China and the Indochina Peninsula over the past decade. This disease is transmitted by the white-backed planthopper (WBPH). Infected plants typically exhibit dark green leaves, severe stunting, and increased tillering, leading to plant death and even total crop failure in severe cases, posing a significant threat to rice yield and food security. Currently, control measures for this disease primarily rely on chemical pesticides to kill the white-backed planthopper. However, the long-term and excessive use of pesticides not only increases production costs but also potentially causes environmental pollution, ecological imbalance, and other problems, hindering sustainable agricultural development. Therefore, exploring safer, more economical, and environmentally friendly control strategies is of significant practical importance.

[0003] Rice germplasm resources contain abundant genetic variations related to disease resistance, and utilizing the host plant's own resistance is considered the most economical, effective, and ecologically sustainable approach to controlling SRBSDV. Studies have shown that rice resistance to SRBSDV is a quantitative trait controlled by multiple genes, with a complex genetic mechanism. Although scholars both domestically and internationally have identified several genes or quantitative trait loci (QTLs) associated with SRBSDV resistance, the number of known SRBSDV resistance genes / QTLs remains limited compared to other rice diseases such as rice blast, sheath blight, and bacterial leaf blight. Furthermore, the resistance mechanism, particularly the upstream transcriptional regulatory network, still requires further in-depth analysis.

[0004] Therefore, systematically exploring and utilizing rice resistance germplasm resources, and discovering new regulatory genes (such as transcription factors) located upstream of key disease resistance signaling pathways, will not only help deepen the understanding of the molecular mechanism of rice-SRBSDV interaction, but also provide important gene resources and theoretical basis for breeding rice varieties with broad-spectrum and durable resistance through molecular breeding technology, which is of profound significance for promoting green and safe rice production. Summary of the Invention

[0005] This invention aims to provide a protein related to resistance to southern rice black-streaked dwarf disease, its encoding gene, and its applications. Specifically, it relates to transcription factors. OsWRKY30 Proteins and their encoding genes OsWRKY30 The study included recombinant vectors containing the gene, genetically engineered host cells, and their application in regulating rice resistance to SRBSDV, particularly in the breeding of SRBSDV-resistant rice varieties.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A protein possessing resistance to southern rice black-streaked dwarf virus, wherein the protein is... OsWRKY30 The protein has the amino acid sequence shown in SEQ ID NO.2.

[0008] The present invention also provides a nucleic acid molecule encoding the protein described above, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides a recombinant vector containing the nucleic acid molecules described above.

[0010] The present invention also provides a host cell comprising the nucleic acid molecules described above or the recombinant vector described above.

[0011] The above-described nucleic acid molecules, recombinant vectors, or host cells are used in any of the following applications:

[0012] (a) Developing rice varieties resistant to Southern Rice Black-Streaked Dwarf Disease;

[0013] (b) Improve rice resistance to Southern Rice Black-Streaked Dwarf Disease.

[0014] To further clarify, the plant in question is rice.

[0015] This invention also provides a method for cultivating plants resistant to Southern Rice Black-Streaked Dwarf Disease, comprising introducing the aforementioned nucleic acid molecules or the aforementioned recombinant vector into the plant to enhance... OsWRKY30 The steps of expression.

[0016] To further explain, the steps to increase expression levels include: activating or enhancing endogenous plant genes using gene editing technology. OsWRKY30 Gene expression or the introduction of the aforementioned nucleic acid molecules or recombinant vectors into plants.

[0017] This invention also provides the application of isolated nucleic acid molecules in the cultivation of plant varieties resistant to Southern Rice Black-Streaked Dwarf Disease, wherein the application includes detecting whether the promoter region of the nucleic acid molecule contains at least one of the following variations:

[0018] (1) Based on the sequence information of the nucleic acid molecules, develop molecular markers for identifying or assisting in the identification of rice resistance to SRBSDV;

[0019] (2) Using the nucleic acid molecule or its regulatory sequence as a target, regulate its expression in plants through gene editing or transgenic manipulation;

[0020] Wherein, the nucleic acid molecule is encoding OsWRKY30 The nucleic acid molecule of the protein, the OsWRKY30 The amino acid sequence of the protein is shown in SEQ ID NO: 2; and the promoter region of the nucleic acid molecule targeted by the application contains at least one of the following variations:

[0021] ( A T→C single nucleotide polymorphism occurring at the position corresponding to the AT-HOOK transcription factor binding motif in the disease-resistant variety GR216;

[0022] ( In the susceptible TN1 variety, a T-base insertion occurs at the position corresponding to the Prolamin-box transcription factor binding motif.

[0023] The present invention also provides a kit for identifying or assisting in the identification of rice resistance to Southern Rice Black-Streaked Dwarf Disease, comprising primer pairs or probes for detecting the aforementioned molecular markers.

[0024] The present invention has the following beneficial effects:

[0025] 1. This invention is the first to identify and confirm transcription factor genes. OsWRKY30 Positive regulation of rice resistance to Southern Rice Black-Streaked Dwarf Virus (SRBSDV) provides a novel and important genetic resource for rice disease resistance breeding. Experiments revealed that... OsWRKY30 This study suggests that jasmonic acid (JA) may enhance the antiviral defense response of rice by promoting its biosynthesis and signaling pathways and regulating the expression of a series of downstream disease resistance-related genes, thus deepening our understanding of the molecular mechanism of rice resistance to SRBSDV.

[0026] 2. This invention relates to resistant and susceptible varieties. OsWRKY30 Natural variations (such as single nucleotide polymorphisms (SNPs) and insertions / deletions (Indels) were found in the promoter region located within transcription factor binding motifs. These variations can serve as potential molecular markers to assist in screening rice germplasm resources or breeding materials resistant to SRBSDV.

[0027] 3. Utilizing technologies such as gene editing, transgenics, or marker-assisted selection. OsWRKY30 The gene can effectively improve the resistance of rice varieties to SRBSDV, which helps reduce the use of chemical pesticides and has important economic, ecological and social benefits. Attached Figure Description

[0028] Figure 1 Phenotypic comparison and virus RT-PCR detection results of rice varieties GR216 (resistant) and TN1 (susceptible) after inoculation with SRBSDV.

[0029] Figure 2 for OsHDA706 Disease phenotype of gene knockout mutants after inoculation with SRBSDV in the GR216 background.

[0030] Figure 3 For bioinformatics-based prediction OsHDA706 Network diagram of upstream potential transcriptional regulators.

[0031] Figure 4 Heatmap of cluster analysis of expression patterns of WRKY family genes in different rice tissues.

[0032] Figure 5 A heatmap showing the clustering analysis of expression patterns of WRKY family genes under biological stress.

[0033] Figure 6 Heatmap of cluster analysis of expression patterns of WRKY family genes under hormone treatment.

[0034] Figure 7 for Figure 7 for OsWRKY30 A schematic diagram of the CRISPR / Cas9 target design and genome structure of the gene (LOC_Os08g38990), a sequencing chromatogram of the gene editing site, and an amino acid sequence diagram of the knockout mutant.

[0035] Figure 8 for OsWRKY30 Disease resistance phenotype analysis and key gene expression validation of knockout mutants. AC represents the phenotype of the mutants after inoculation with SRBSDV; D represents the phenotype in roots and leaves. OsWRKY30 The relative expression level.

[0036] Figure 9 Transcriptome differential analysis of WT and oswrky30 mutant responses to SRBSDV infection. In the diagram, AB is a volcano plot of differentially expressed genes; C is a Venn diagram of specifically differentially expressed genes; DE is a bubble plot of GO enrichment analysis; and F is a heatmap of disease resistance-related gene expression.

[0037] Figure 10 The results show the determination of jasmonic acid (JA) content in the leaves of WT and oswrky30 mutants.

[0038] Figure 11 for OsWRKY30Sequence alignment of gene promoter regions between varieties GR216 and TN1, and natural variant sites. In the diagram, A is a schematic of the alignment; B and C represent the sequencing sequence comparisons of the two variant sites, respectively.

[0039] Figure 12 for Figure 11 A schematic diagram of the predicted transcription factor binding motifs (AT-HOOK and Prolamin-box) where the two naturally occurring variant sites are located. Detailed Implementation

[0040] All features disclosed in this specification, or steps in all methods or processes disclosed herein, may be combined in any way, except for mutually exclusive features and / or steps.

[0041] Unless otherwise stated, each feature disclosed in this specification (including any appended claims and abstract) is merely one example of a series of equivalent or similar features.

[0042] Example 1: Identification of SRBSDV resistance in disease-resistant rice germplasm GR216

[0043] The resistance of rice variety GR216 to SRBSDV was evaluated using an indoor artificial inoculation method, with the highly susceptible variety TN1 as a control. Figure 1 As shown in AC, TN1 plants exhibited typical symptoms of disease after inoculation, including severe stunting, dark green and wrinkled leaves, and downward-growing fibrous roots at the stem nodes, while GR216 plants showed no obvious symptoms. Using SRBSDV-specific primers, RT-PCR was employed to detect SRBSDV-specific nucleic acid fragments in GR216 plants inoculated with WBPH. The amplified fragment using SRBSDV primers was 680 bp. Figure 1 D). The results indicate that GR216's resistance to SRBSDV is a direct resistance to the virus itself, rather than resistance to the vector insect.

[0044] Example 2: Disease Resistance Gene OsHDA706 Functional verification in the GR216 context

[0045] Using rice variety GR216 as the background material, CRISPR-Cas9 technology was used to design target sites Target1 (AAGCTCTACCTCGACGTCCCGGG) and Target2 (CGTACGACATCGCCTTCCTCGGG) in exons 1 and 3 of OsHDA706, respectively. Two OsHDA706 knockout mutants (oshda706-1 and oshda706-2) were constructed. After the mutants were stably inherited to the T2 generation, they were artificially inoculated with SRBSDV, and the viral symptom phenotype of the plants was observed 15 days after inoculation. The results showed that compared with wild-type (WT) GR216 plants, both oshda706-1 and oshda706-2 plants showed more severe SRBSDV infection symptoms. Figure 2 These results are consistent with previous findings, confirming that OsHDA706 can still stably regulate rice resistance to SRBSDV in the GR216 background.

[0046] Example 3: OsHDA706 Upstream regulatory factors OsWRKY30 Prediction and screening

[0047] Using the RiceTarget database (https: / / cbi.njau.edu.cn / RiceTFtarget / ), OsHDA706 A systematic search was conducted for target genes, with the following screening criteria: PCC > 0.6, correlation including both positive and negative correlation, and at least one transcription factor binding site in the promoter region. The results showed that a total of 9 transcription factors were predicted as [target genes]. OsHDA706 Potential upstream regulatory factors (see) Figure 3 Further analysis revealed that, compared to the other eight transcription factors, OsWRKY30 It has been reported in existing studies to be closely related to rice disease resistance. Previous studies have demonstrated that... OsWRKY30 and OsHDA706 Both can affect the immune function of rice by regulating the biosynthesis of JA. This strong functional similarity strongly suggests that... OsHDA706 It is very likely that OsWRKY30 It plays a role downstream. Therefore, we chose OsWRKY30 As a subject for further functional research.

[0048] Example 4: OsWRKY30 Gene expression patterns and family association analysis

[0049] In the Cafri-Rice database (CRISPR applicable functional redundancy inspector, Cafri-rice.khu.ac.kr), with LOC_Os08g38990 (OsWRKY30) Using this study as the research subject, a Pearson correlation coefficient (PCC) greater than 0.5 was used as the screening criterion for significant correlation. A systematic analysis was conducted on the WRKY gene family and its correlation with... OsWRKY30 Members with highly correlated expression patterns. Clustering results showed that within the rice WRKY transcription factor family, OsWRKY80 (LOC_Os09g30400) With O sWRKY30 The closest kinship ( Figure 4 (Genes marked with red triangles). In various tissues of rice, LOC_Os04g46060(OsWRKY36) and OsWRKY30 The expression patterns are most similar ( Figure 4 (Genes marked in orange). In response to biotic stress, [the genes]... OsWRKY30 The gene most relevant to expression pattern is LOC_Os01g62510 and OsWRKY33 (LOC_Os03g33012) ( Figure 5 (Genes marked in orange). Under hormone treatment conditions, there are two WRKY genes. OsWRKY30 The expression patterns are highly correlated, namely: OsWRKY102 (LOC_Os01g08710) and OsWRKY45 (LOC_Os05g25770) () Figure 6 (Genes marked in red and orange). These genes have all been reported in previous studies to be involved in rice disease resistance. These results indicate that... OsWRKY30 Possibly through with OsWRKY80, OsWRKY36, OsWRKY33, OsWRKY45 WRKY family members work together to participate in the rice's disease resistance response.

[0050] Example 5: OsWRKY30 Gene sequences and construction of knockout mutants

[0051] The OsWRKY30 gene is located on chromosome 8 of rice (locus identifier: LOC_Os08g38990 The sequence information is referenced from the Michigan State University Rice Genome Annotation Project (RGAP) database (http: / / rice.plantbiology.msu.edu / ), and its complete nucleotide sequence and encoded amino acid sequence are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0052] Select OsWRKY30Two 20bp nucleotide sequences within the first exon serve as editing targets for the CRISPR / Cas9 system (Target1: CTAGCTGAGCAGTTTCTTCCCGG and Target2: AGTTCCCTTGGACTCACACCGGG). Figure 7 A) The specific OsWRKY30 targeting sequence was amplified by PCR and inserted into the pEGCas9Pubi-H vector. Sequencing confirmed that the sgRNA sequence had been constructed into the expression vector. This vector was introduced into an *E. coli* strain, and plaques were picked for PCR identification. The bacterial culture corresponding to positive bands was sequenced. The CRISPR / Cas9 vector was then transformed into GR216 callus tissue via *E. coli*-mediated genetic transformation. Two [vectors / indications] were constructed. OsWRKY30 Homozygous knockout mutants were named as follows: oswrky30-1 and OsWRKY30-2 Sequence analysis results show that oswrky30-1 1bp and 6bp base deletions occurred at the two target sites, respectively; OsWRKY30-2 In the middle, a 188bp base deletion occurred on both targets and between the targets. Figure 7 A), these mutations all lead to frameshift mutations ( Figure 7 B).

[0053] Example 6: OsWRKY30 Knockout leads to increased susceptibility of rice to SRBSDV.

[0054] In the T2 generation plants, two OsWRKY30 SRBSDV resistance was evaluated in both plantlets and wild-type (WT) plants. (See figure) Figure 8 As shown in AC, phenotypic observation revealed that, compared to WT, both mutant plants exhibited severe SRBSDV susceptibility (dwarfism, leaf deformities, etc.) phenotypes. RT-qPCR analysis indicated that, compared to WT, OsWRKY30 Post-SRBSDV infection OsWRKY30 Significantly downregulated in the roots and leaves of the plant ( Figure 8 D). Indicates OsWRKY30 Knockout weakens rice's resistance to SRBSDV. OsWRKY30 It can positively regulate the defense response of rice to SRBSDV.

[0055] Example 7: OsWRKY30 Transcriptomic analysis of the regulation of disease resistance response

[0056] At the 2-leaf stage, GR216 (WT) and WBPH carrying SRBSDV virus were fed with the virus. OsWRKY30Rice seedlings were used as the experimental group, and the corresponding uninoculated materials were used as the control group. Each group had three biological replicates. We collected leaves at 30 dpi and 35 dpi after inoculation (0 dpi was recorded as 48 hours after inoculation) for RNA-seq analysis. The criteria for screening differentially expressed genes (DEGs) were P < 0.05 and |log2(Fold Change)| ≥ 1.

[0057] Bioinformatics analysis revealed 4286 differentially expressed genes (DEGs) between the WT virus-inoculated group and the control group (WT-V vs WT-CK) at 35 dpi, including 1975 downregulated and 2311 upregulated genes. OsWRKY30 In the plant ( OsWRKY30-V vs OsWRKY30-CK A total of 4428 DEGs were identified, of which 2197 were downregulated and 2231 were upregulated. Figure 9 (AB). Venn diagram analysis further showed that 1721 and 1605 genes in the two comparisons, respectively, were WT or WT. OsWRKY30 DEGs specifically expressed by mutants after SRBSDV infection Figure 9 C).

[0058] GO enrichment analysis of DEGs specifically expressed in WT revealed that these genes were significantly enriched in disease resistance-related biological processes such as defense responses, stress responses, salicylic acid responses, and phenylpropanoid metabolism. Furthermore, some pathways may be regulated by histone acetylation, involving plant growth and development as well as oxidoreductase activity. Specifically, pathways such as phyllotaxis, seed germination, and carpel development were enriched in the biological process category; histone acetyltransferase complexes were enriched in the cellular component category; and transcription factor activity and oxidoreductase activity were mainly enriched in the molecular function category. Figure 9 D). In OsWRKY30 In GO analysis of plant-specific DEGs, cell membrane and membrane-bound organelle-related pathways were significantly enriched. Figure 9 E).

[0059] exist OsWRKY30 In plants, the expression of OsMYB4P, a gene related to JA signal transduction, was significantly downregulated, while no significant change was observed in WT. Figure 9 F). Conversely, OsANN1 was significantly upregulated in WT, in OsWRKY30 No obvious changes were observed in the plants. JA synthesis and signal transduction-related genes. OsMYC3 and OsJAR1 Significantly upregulated in WT, but OsWRKY30 No significant changes were observed in the plants. Meanwhile, multiple rice disease resistance-related genes (such as...) LOC_Os01g06836, LOC_Os01g11810, LOC_Os02g18000 (etc.) in OsWRKY30The expression of disease resistance genes such as RGA1, NBS2, and RGA4 was significantly downregulated in WT, but remained stable in mutants. Figure 9 F). In summary, OsWRKY30 It can participate in the antiviral defense process of rice against SRBSDV by regulating the JA signaling pathway and the expression of multiple disease resistance-related genes.

[0060] Example 8: OsWRKY30 Positively regulates the accumulation of jasmonic acid (JA).

[0061] GR216, ground with liquid nitrogen oswrky30-1 and OsWRKY30-2 Plant leaf powder was added to 2 mL of acetonitrile, vortexed for 1 min, and then incubated overnight at 4°C. After centrifugation, the supernatant was collected, purified by solid-phase extraction, and the eluent was collected. The eluent was evaporated to dryness under nitrogen, reconstituted with methanol, filtered through a 0.22 μm organic filter membrane, and stored at -20°C. The JA content was then determined using liquid chromatography-tandem mass spectrometry, with all determinations performed in triplicate. Hormone results showed that, compared to wild-type plants, OsWRKY30 The concentration of JA in the plants was significantly lower (see Figure 10 This reduction in JA accumulation further proves OsWRKY30 It does indeed promote JA biosynthesis. These results, combined with RNA-seq analysis data, indicate that... OsWRKY30 Possibly through adjustment OsHDA706 And other JA-related genes, thereby enhancing the plant's antiviral defense response.

[0062] Example 9: OsWRKY30 Promoter region natural variation analysis

[0063] Genomic DNA was extracted from GR216 and TN1, and then... OsWRKY30 Gene-specific primers were used for PCR amplification, and the purified product was then subjected to Sanger sequencing. Sequence alignment analysis showed that... OsWRKY30 The coding region between GR216 and TN1 is sequence-conserved and shows no variation; however, there are inter-varietal sequence differences in the promoter region. Figure 11 A). Specifically, a T→C single nucleotide mutation was detected in the promoter region of GR216 (A). Figure 11 B) and a T-base insertion mutation in TN1 ( Figure 11 C), these two mutation sites are located in the AT-HOOK transcription factor binding motif and the Prolamin-box transcription factor binding motif, respectively. Figure 12 (AB). Combined with bioinformatics analysis, sequence variations in these promoter regions likely regulate transcription factors by affecting their binding. OsWRKY30 The expression level of [the substance] is potentially associated with differences in resistance to SRBSDV among varieties.

[0064] In summary, this invention, through systematic genetic, molecular biological, and biochemical experiments, has identified and confirmed the transcription factor gene. OsWRKY30 It is a positive regulator of SRBSDV resistance in rice. This gene establishes an effective antiviral defense response by promoting the biosynthesis and signal transduction of jasmonic acid and activating the expression of a series of downstream disease resistance-related genes. Furthermore, in OsWRKY30 The natural variations related to resistance discovered in the promoter region provide important evidence for breeding new disease-resistant rice varieties using molecular marker-assisted selection technology. Therefore, OsWRKY30 Genes and their molecular markers have important application value in improving rice resistance to SRBSDV and in breeding new green disease-resistant varieties.

[0065] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A protein having resistance to southern rice black-streaked dwarf disease, characterized in that, The protein is OsWRKY30 a protein whose amino acid sequence is shown as SEQ ID NO.

2.

2. A nucleic acid molecule encoding the protein of claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown as SEQ ID NO.

1.

3. A recombinant vector, characterized in that, The nucleic acid molecule of claim 2.

4. A host cell, characterized in that, The recombinant vector of claim 3. The host cell of claim 4.

5. Use of the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 or the host cell of claim 4 in any of the following: (a) breeding rice varieties resistant to Southern Rice Black-Streaked Dwarf Virus (SRBSDV); and 6. Use according to claim 5, characterized in that, (b) improving the resistance of rice to Southern Rice Black-Streaked Dwarf Virus (SRBSDV).

7. A method of breeding plants resistant to Southern Rice Black Streaked Dwarf Disease, characterized by, comprising introducing into a plant the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 to increase The plant is rice. the step of expressing.

8. The method of claim 7, wherein, The step of increasing the expression amount includes activating or enhancing expression of an endogenous gene in a plant using a gene editing technique or introducing the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 into a plant. OsWRKY30 The step of increasing the expression amount includes activating or enhancing expression of an endogenous gene in a plant using a gene editing technique or introducing the nucleic acid molecule of claim 2 or the recombinant vector of claim 3 into a plant.

9. Use of an isolated nucleic acid molecule in breeding a plant variety resistant to southern rice black-streaked dwarf disease, characterized in that, OsWRKY30 wherein, The use comprises detecting whether at least one of the following variations exists in the promoter region of the nucleic acid molecule: (1) developing a molecular marker for identifying or assisting in identifying the resistance of rice to SRBSDV based on the sequence information of the nucleic acid molecule; wherein the nucleic acid molecule is a nucleic acid molecule encoding (2) taking the nucleic acid molecule or its regulatory sequence as a target to regulate its expression in plants through gene editing or transgenic operation; a protein, the amino acid sequence of the protein is set forth in SEQ ID NO: 2; and, the promoter region of the nucleic acid molecule to which the use is directed comprises at least one variation of: OsWRKY30 a protein, the amino acid sequence of the protein is set forth in SEQ ID NO: 2; and, the promoter region of the nucleic acid molecule to which the use is directed comprises at least one variation of: OsWRKY30 (I) a T→C single nucleotide polymorphism occurring at a position corresponding to the AT-HOOK transcription factor binding motif in the resistant variety GR216; 10. A kit for identifying or aiding in the identification of resistance of rice to southern rice black-streaked dwarf disease, characterized by, (II) a T base insertion occurring at a position corresponding to the Prolamin-box transcription factor binding motif in the susceptible variety TN1. The primer pair or probe for detecting the molecular marker of claim 9.

Images