Compound grease feed additive for improving breeding quality of channa maculata and application of compound grease feed additive
By adding arachidonic acid and phosphatidylcholine to the feed of snakehead fish, the problems of slow gonadal development and inconsistent oocyte maturation during the breeding process of snakehead fish were solved, thereby improving the reproductive performance and larval quality of snakehead fish and achieving efficient aquaculture results.
Patent Information
- Application Number
- CN202610257686.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-05-26
AI Technical Summary
In the artificial breeding of snakehead fish, there are problems such as slow gonadal development, asynchronous oocyte maturation, low fertilization rate and poor seedling quality. These problems are mainly due to the unbalanced nutritional supply of the parent fish and the lagging development of specialized feed.
Adding arachidonic acid (ARA) and phosphatidylcholine (PC) to the feed of snakehead fish can promote ovarian development and improve reproductive performance and larval quality by regulating the secretion of sex hormones.
It significantly improves the reproductive performance and larval quality of female snakehead, increases fertilization and hatching rates, and improves the aquaculture efficiency of snakehead fry.
Smart Images

Figure CN122081464A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of breeding technology and feed nutrition for snakehead, and particularly to a method and application of a compound oil feed additive for improving the breeding quality of snakehead. Background Technology
[0002] Gonadal development and reproductive performance in fish are core determinants of aquaculture production efficiency, influenced by multiple factors including genetics, nutrition, and feeding management. Among these, the quality of oocyte development directly relates to embryonic developmental potential and reproductive efficiency. Therefore, promoting ovarian development to obtain high-quality gametes is a crucial prerequisite for the sustainable development of aquaculture. The nutritional status of broodstock can regulate metabolic pathways and influence offspring phenotypes, causing permanent or long-term physiological effects on aquatic offspring.
[0003] Arachidonic acid (ARA) is an essential fatty acid for aquatic animals. It is not only an important component of phospholipids in cell membranes, but its metabolites also participate extensively in physiological processes such as growth, reproduction, and immune regulation. It has been proven that ARA can affect the reproductive performance of broodstock by regulating the secretion of sex steroid hormones.
[0004] Phosphatidylcholine (PC) is a novel functional additive for aquatic feed. It can promote the growth and survival of juvenile aquatic animals, improve feed conversion rate, regulate lipid metabolism, protect the liver, reduce hepatic lipid deposition, and enhance the stress resistance and immunity of aquatic animals. In the future, it can be used as a green additive to replace some fats and antibiotics; it can also contribute to the production of high-quality aquatic products, increase product added value, and achieve resource recycling through extraction from aquatic by-products. Future research should focus on optimizing the dosage and developing compound formulations to promote its precise application in green aquaculture.
[0005] Snakehead fish, an important freshwater economic fish species with an annual output of over 600,000 tons in my country, is highly favored by the market due to its tender and delicious flesh, as well as its tolerance to low oxygen levels and ease of cultivation.
[0006] In recent years, the artificial breeding of snakehead fish has faced prominent industry problems, including slow gonadal development, asynchronous oocyte maturation, low fertilization rates, and poor seedling quality. The core issue behind these problems lies in the unbalanced nutritional supply to the parent stock and the relatively lagging development of specialized feeds.
[0007] Therefore, in order to solve the above-mentioned existing technical problems, it is an urgent technical problem for those skilled in the art to solve the problem of providing a special feed method that promotes gonadal development and improves reproductive performance. Summary of the Invention
[0008] In view of this, the present invention provides a method and application of a compound oil feed additive for improving the reproductive quality of snakehead. By adding arachidonic acid (ARA) and phosphatidylcholine (PC) to the feed, the reproductive performance and larval quality of snakehead are improved, which is of great significance for improving the aquaculture efficiency of high-quality snakehead fry in aquaculture.
[0009] To solve the above-mentioned technical problems, the present invention adopts the following technical solution: A method for using a compound oil feed additive to improve the reproductive quality of snakehead fish includes the following steps: (1) Preparation of experimental feed: Using white fish meal, corn gluten meal, fermented soybean meal and wheat flour as protein sources, arachidonic acid, phosphatidylcholine and soybean oil as fat sources, and cassava starch as sugar source, three isolipid experimental feeds were designed; among them, the basic feed formula was used as the control group, and experimental groups ARA1.5 with 1.5% arachidonic acid and ARA+PC with 1.5% arachidonic acid + 1.5% phosphatidylcholine were prepared respectively. The feeds of each group were adjusted to isolipidity with stearylglycerol; (2) Rearing process: Healthy female snakeheads with the same genetic background were selected and raised in net cages in the same pond. The female snakeheads were randomly divided into three treatment groups: control group, ARA1.5 group and ARA+PC group. Each treatment was set up with three replicates. Each net cage was stocked with healthy female snakeheads without injury or disease. (3) After the aquaculture experiment, the snakehead fish were processed and tested: all fish were fasted for 24 hours, and the fish in each net cage were taken out, anesthetized, counted and weighed; some snakehead fish were randomly selected from each net cage, and their body length and weight were measured respectively. Then, the internal organs and liver were dissected, weighed, and the ratio of viscera to body weight and the ratio of liver to body weight were calculated; blood samples were collected from the tail vein, centrifuged, and plasma was separated for biochemical index analysis. (4) Artificial breeding experiment: Male snakehead fish with the same genetic background were used as the father; some female fish were randomly selected from each treatment group to evaluate their reproductive performance; (5) Detection of ovarian steroid synthesis-related gene expression: Total RNA was extracted from the liver of snakehead fish using the Trizol method, and cDNA was synthesized using the TransScript® One-Step gDNA removal and cDNA Synthesis SuperMix kit; The cDNA template was diluted 10-fold using real-time PCR. Based on the Ct value of the target gene, the expression level of mRNA was calculated using the 2-ΔΔCt method, and the relative expression level was calculated with the control group as the baseline. (6) Statistical analysis of data: One-way ANOVA was performed using statistical analysis software. When P < 0.05, the difference was considered significant, and when P < 0.01, it was considered highly significant.
[0010] Preferably, in step (1), the feed ingredients are accurately weighed according to the ratio, put into a mixer and mixed evenly, and an appropriate amount of pure water is slowly sprayed onto the crushed ingredients and stirred evenly to obtain a mixture. Then, arachidonic acid oil and stearic acid glycerin are added separately and stirred for 15 minutes. The mixture is then processed into pellet feed with a diameter of 4mm using an aquatic extrusion pellet mill, dried, and then sprayed with an accurately weighed amount of soybean oil.
[0011] Preferably, in step (2), during the feeding period, the corresponding feed prepared in step (1) is fed to each treatment group respectively, and the apparent satiety feeding is carried out daily, and the feeding amount is recorded daily.
[0012] Preferably, in step (3), the centrifugation is performed at 3000 g for 10 min at 4°C.
[0013] Preferably, in step (4), artificial insemination uses two hormones: human chorionic gonadotropin (HCG) and luteinizing hormone-releasing hormone (LHRH-A2). The female fish is injected twice, with an interval of 10 hours between the two injections. The initial injection dose for the female is 3 µg / kg body weight of LHRH-A2, and the second injection is 500 IU of HCG + 10 µg / kg body weight of LHRH-A2. The fertilized eggs of each female fish are placed in a square incubator for incubation, and the water temperature is kept constant at 29°C during incubation. The fertilization rate is calculated by randomly selecting about 300 eggs from each female fish and incubating them under still water conditions. After the eggs develop to the gastrula stage, the number of fertilized eggs is counted. After the larvae hatch, the number of hatched eggs is recorded to calculate the hatching rate.
[0014] Preferably, in step (5), primers for the cyp17a1, cyp19a1, er, foxo1, pr, and foxo3 genes are synthesized, with β-actin as an internal reference gene. The primer sequences for each gene are as follows: β-actin : Forward sequences (5′–3′): AGCAAGCAGGAGTATGATGA, Reverse sequences (5′–3′): AGCAAGCAGGAGTATGATGA; cyp17a1 : Forward sequences (5′–3′): CAGTCACTTACCTCATCCATTATCC, Reversesequence (5′–3′): TTTTTCCATTCCTTCTCGTCAT; cyp19a1: Forward sequences (5′–3′): AATACCCCTCGTCGTTACTT, Reversesequence (5′–3′): AAACCCTTATGGAGGCAAA; er : Forward sequences (5′–3′): AGGTCCCGCGTCCTCTGTAT, Reverse sequences (5′–3′): CCTGTTGAACCCGTGAATGTG; foxo1 : Forward sequences (5′–3′): CACAACTTATCACACCTC, Reverse sequences (5′–3′): TTAGTATTACCGTATCCA; pr : Forward sequences (5′–3′): AACCCATCACCTTTTCCC, Reverse sequences (5′–3′): GACCTTCAACTGCTCTTT; foxo3 : Forward sequences (5′–3′): CAAATCCACAATCTCTAC, Reverse sequences (5′–3′): GTCACATTCCAACCTCTC.
[0015] Preferably, in step (5), the reaction system for detection using the real-time PCR method is as follows: 1 µL of cDNA, 1 µL each of 10 µM upstream and downstream primers, 12.5 µL of 2×TransTaq® HiFi PCR SuperMix II, and water added to 25 µL; PCR amplification program: 94℃ pre-denaturation for 2 min, 1 cycle; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min, 1 cycle; storage at 4℃.
[0016] Application of a compound oil feed additive method for improving the reproductive quality of snakehead in snakehead farming.
[0017] The present invention achieves the following technical effects compared to the prior art: This invention improves the reproductive performance and larval quality of snakehead by adding arachidonic acid (ARA) and phosphatidylcholine (PC) to the feed, which is of great significance for improving the aquaculture efficiency of high-quality snakehead fry in aquaculture. Attached Figure Description
[0018] Figure 1 This is a comparison chart showing the effects of the present invention. Detailed Implementation
[0019] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0020] Example 1 The feed addition method of the present invention improves the reproductive performance and egg quality of the female snakehead by adding ARA+PC mixed oil to the compound feed, thereby increasing the expression of steroid synthesis-related genes and promoting the secretion of snakehead sex hormones.
[0021] (1) Experimental diet: Three isolipid experimental diets were designed with white fish meal, corn protein meal, fermented soybean meal and wheat flour as the main protein sources, arachidonic acid, phosphatidylcholine and soybean oil as fat sources, and cassava starch as sugar source. The results are shown in Table 1. Using the basic feed formula as the control group, experimental groups were prepared by adding 1.5% arachidonic acid (ARA1.5) and 1.5% ARA + 1.5% PC (ARA + PC), respectively, and were balanced with stearylglycerin.
[0022] Weigh the feed ingredients precisely according to the formula, then put them into a mixer and mix them evenly. Slowly spray an appropriate amount of pure water onto the crushed ingredients and stir evenly to obtain a mixture. Then add arachidonic acid oil and stearic acid glycerin separately and stir for another 15 minutes. Use an aquatic extrusion pellet mill to process it into pellet feed with a diameter of 4mm, dry it, and then spray it with precisely weighed soybean oil.
[0023] Table 1: Feed Formulation and Nutrient Components (g / 1000g)
[0024] (2) Rearing process: The present invention uses the same genetic background of the spotted snakehead parent and conducts a 12-week rearing experiment in the same pond of the Pearl River Fisheries Research Institute breeding base. 360 healthy spotted snakehead females (initial average weight: 850.5±34 g) were randomly divided into 3 treatment groups, with 3 replicates for each treatment. 40 healthy spotted snakehead females without injury or disease were raised in each net cage. During the feeding period, the control group, ARA group and ARA+PC group were fed respectively. Apparent satiety feeding was carried out at 8:00 and 17:00 every day, and the feeding amount was recorded daily.
[0025] (3) After the aquaculture experiment, all fish were fasted for 24 hours. Fish from each net cage were removed, anesthetized, counted, and weighed. Six snakehead fish were randomly selected from each net cage, and their body length and weight were measured. Then, their internal organs and livers were dissected and weighed to calculate the viscera-to-body ratio and liver-to-body ratio. Blood samples were collected from the tail vein and centrifuged at 3000 g for 10 min at 4 ℃ to obtain plasma for subsequent biochemical analysis.
[0026] (4) Eight male snakehead fish with the same genetic background were used as sires for artificial breeding experiments. Six female fish were randomly selected from each pond to evaluate their reproductive performance; Artificial insemination was performed using two hormones: human chorionic gonadotropin (HCG) and luteinizing hormone-releasing hormone A2 (LHRH-A2) (from Ningbo No. 2 Hormone Factory, Zhejiang, China). Female fish were injected twice, 10 hours apart. The initial injection dose was 3 µg / kg body weight of LHRH-A2. The second injection was 500 IU of HCG + 10 µg / kg body weight of LHRH-A2. Fertilized eggs from each female were placed in an 80×40×40 cm square incubator and incubated at a constant water temperature of 29 °C. The fertilization rate was calculated by randomly selecting approximately 300 eggs from each female and incubating them in still water until they reached the gastrula stage, at which point the number of fertilized eggs was counted. The hatching number of larvae was recorded after hatching to calculate the hatching rate. Then, the same batch of fertilized eggs was hatched into larvae, and the hatching rate was calculated based on the number of larvae hatched.
[0027] (5) Detection of expression of genes related to ovarian steroid synthesis Total RNA was extracted from snakehead liver using the Trizol method. cDNA was synthesized using the TransScript® One-Step gDNA removal and cDNA Synthesis SuperMix kit (TransGen, Beijing). cyp17a1、 cyp19a1、er、foxo1、pr、foxo3 Gene primers were used, with β-actin as an internal reference gene. Detection was performed using quantitative real-time PCR.
[0028] The cDNA template was diluted 10-fold. The reaction mixture consisted of 1 µL of cDNA, 1 µL each of 10 µM forward and reverse primers, and 12.5 µL of 2×TransTaq® HiFi PCR SuperMix II, diluted to 25 µL with water. The PCR amplification program was as follows: 94℃ pre-denaturation for 2 min (1 cycle); 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min (35 cycles); 72℃ extension for 5 min (1 cycle); and storage at 4℃. Based on the Ct value of the target gene, a 2... -∆∆CtThe expression level of mRNA was calculated using a method that uses the positive control group as the baseline to calculate the relative expression level.
[0029] The primers are as follows:
[0030] (6) One-way ANOVA was performed using SPSS 22 statistical analysis software. P A difference of <0.05 is considered significant. P <0.01 indicates highly significant.
[0031] Experimental results: As shown in Table 2, the liver-to-body ratio of female snakehead in the ARA+PC group was significantly higher than that in the control group. P < 0.05). The fertilization rates in the ARA and ARA+PC groups were now higher than those in the control group ( P < 0.05); The hatching rate of the ARA+PC group was now higher than that of the control group and the ARA group, while the fertilization rate of the ARA group was significantly higher than that of the control group. P < 0.05); The malformation rate in the control group and the ARA group was significantly higher than that in the ARA+PC group. P < 0.05); During the endogenous nutrition stage, the body length of 3-day-old juveniles in the ARA group was significantly larger than that in the control group. P < 0.05); Furthermore, the body length and weight of the larvae in the ARA+PC group and the ARA group were significantly greater than those in the control group 7 days after hatching. P The value was <0.05, indicating that adding ARA and PC to the feed can significantly improve the reproductive performance of female snakehead and the quality of fry.
[0032] The effects of adding ARA and PC to the feed on the morphology and reproductive performance of snakehead are shown in Table 2. Table 2: Effects of ARA and PC supplementation in feed on body shape and reproductive performance of snakehead fish
[0033] Different lowercase letters in the shoulder labels of peer data indicate significant differences. P <0.05).
[0034] Table 3 shows that the addition of ARA+PC to the feed significantly affected the plasma steroid hormone and prostaglandin levels of female snakehead fish. Compared with the control group, the ARA+PC group had significantly higher levels of luteinizing hormone and estradiol. P < 0.05. Plasma prostaglandin F2α levels were significantly higher in the ARA and ARA+PC groups than in the control group ( P< 0.05); Furthermore, the levels of 11-ketotestosterone (11-KT) and prostaglandin E2 (PGE2) in the ARA+PC group were significantly higher than those in the control group and the ARA group. P < 0.05); This indicates that adding ARA to the feed can increase the secretion of plasma steroid hormones, while adding ARA+PC can achieve higher prostaglandin levels, which is more conducive to the maturation and ovulation of female snakehead ovaries.
[0035] The effects of adding ARA+PC to the feed on plasma steroid hormones in female snakehead (n=6) are shown in Table 3; Table 3: Effects of ARA+PC supplementation in feed on plasma steroid hormones in female snakehead (n=6)
[0036] Different lowercase letters in the shoulder labels of peer data indicate significant differences. P <0.05).
[0037] Depend on Figure 1 The results showed that, compared with the control group, the addition of ARA to the diet significantly upregulated the relative expression level of the ovarian cyp17a1 gene, while the ARA+PC group significantly upregulated [the expression level of the cyp17a1 gene]. cyp19a1, er, pr, foxo1 and foxo3 Gene expression levels. This indicates that adding ARA+PC to the feed promotes gonadal development and reproductive activity by upregulating the expression of genes related to sex hormone synthesis.
[0038] The above description is merely a preferred embodiment of the present invention and does not constitute any limitation on the technical scope of the present invention. Therefore, any minor modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention shall still fall within the scope of the technical solution of the present invention.
Claims
1. A method for using a compound oil feed additive to improve the reproductive quality of snakehead fish, characterized in that, Includes the following steps: (1) Preparation of experimental feed: Using white fish meal, corn gluten meal, fermented soybean meal and wheat flour as protein sources, arachidonic acid, phosphatidylcholine and soybean oil as fat sources, and cassava starch as sugar source, three isolipid experimental feeds were designed; among them, the basic feed formula was used as the control group, and experimental groups ARA1.5 with 1.5% arachidonic acid and ARA+PC with 1.5% arachidonic acid + 1.5% phosphatidylcholine were prepared respectively. The feeds of each group were adjusted to isolipidity with stearylglycerol; (2) Rearing process: Healthy female snakeheads with the same genetic background were selected and raised in net cages in the same pond. The female snakeheads were randomly divided into three treatment groups: control group, ARA1.5 group and ARA+PC group. Each treatment was set up with three replicates. Each net cage was stocked with healthy female snakeheads without injury or disease. (3) After the aquaculture experiment, the snakehead fish were processed and tested: all fish were fasted for 24 hours, and the fish in each net cage were taken out, anesthetized, counted and weighed; some snakehead fish were randomly selected from each net cage, and their body length and weight were measured respectively. Then, the internal organs and liver were dissected, weighed, and the ratio of viscera to body weight and the ratio of liver to body weight were calculated; blood samples were collected from the tail vein, centrifuged, and plasma was separated for biochemical index analysis. (4) Artificial breeding experiment: Male snakehead fish with the same genetic background were used as the father; some female fish were randomly selected from each treatment group to evaluate their reproductive performance; (5) Detection of ovarian steroid synthesis-related gene expression: Total RNA was extracted from the liver of snakehead fish using the Trizol method, and cDNA was synthesized using the TransScript® One-Step gDNA removal and cDNA Synthesis SuperMix kit; The cDNA template was diluted 10-fold using real-time PCR. Based on the Ct value of the target gene, the expression level of mRNA was calculated using the 2-ΔΔCt method, and the relative expression level was calculated with the control group as the baseline. (6) Statistical analysis of data: One-way ANOVA was performed using statistical analysis software. When P < 0.05, the difference was considered significant, and when P < 0.01, it was considered highly significant.
2. The method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (1), the feed ingredients are weighed precisely according to the ratio, put into a mixer and mixed evenly. A suitable amount of pure water is slowly sprayed onto the crushed ingredients and stirred evenly to obtain a mixture. Then, arachidonic acid oil and stearic acid glycerin are added separately and stirred for 15 minutes. The mixture is then processed into 4mm diameter pellet feed using an aquatic extrusion pellet mill, dried, and then coated with precisely weighed soybean oil.
3. The method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (2), during the feeding period, the corresponding feed prepared in step (1) is fed to each treatment group, and the apparent satiety is fed daily, and the feeding amount is recorded daily.
4. The method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (3), the centrifuge at 3000 g for 10 min at 4°C.
5. A method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (4), artificial insemination uses two hormones: human chorionic gonadotropin (HCG) and luteinizing hormone-releasing hormone (LHRH-A2). The female fish is injected twice, with an interval of 10 hours between the two injections. The initial injection dose for the female is 3 µg / kg body weight of LHRH-A2, and the second injection is 500 IU of HCG + 10 µg / kg body weight of LHRH-A2. The fertilized eggs of each female fish are placed in a square incubator for incubation, and the water temperature is kept constant at 29°C during incubation. The fertilization rate is calculated by randomly selecting about 300 eggs from each female fish and incubating them under still water conditions. After the eggs develop to the gastrula stage, the number of fertilized eggs is counted. After the larvae hatch, the number of hatched eggs is recorded to calculate the hatching rate.
6. A method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (5), primers for the cyp17a1, cyp19a1, er, foxo1, pr, and foxo3 genes are synthesized, with β-actin as an internal reference gene. The primer sequences for each gene are as follows: β-actin :Forward sequences (5′–3′):AGCAAGCAGGAGTATGATGA,Reverse sequence(5′–3′):AGCAAGCAGGAGTATGATGA; cyp17a1 :Forward sequences (5′–3′):CAGTCACTTACCTCATCCATTATCC,Reversesequence (5′–3′):TTTTTCCATTCCTTCTCGTCAT; cyp19a1 :Forward sequences (5′–3′):AATACCCCTCGTCGTTACTT,Reverse sequence(5′–3′):AAACCCTTATGGAGGCAAA; er :Forward sequences (5′–3′):AGGTCCCGCGTCCTCTGTAT,Reverse sequence (5′–3′):CCTGTTGAACCCGTGAATGTG; foxo1 :Forward sequences (5′–3′):CACAACTTATCACACCTC,Reverse sequence (5′–3′):TTAGTATTACCGTATCCA; pr :Forward sequences (5′–3′):AACCCATCACCTTTTCCC,Reverse sequence (5′–3′):GACCTTCAACTGCTCTTT; foxo3 :Forward sequences (5′–3′):CAAATCCACAATCTCTAC,Reverse sequence (5′–3′):GTCACATTCCAACCTCTC。 7. A method for using a compound oil feed additive to improve the reproductive quality of snakehead fish according to claim 1, characterized in that, In step (5), the reaction system for detection using the real-time PCR method is as follows: 1 µL of cDNA, 1 µL each of 10 µM upstream and downstream primers, 12.5 µL of 2×TransTaq® HiFi PCR SuperMix II, and water added to 25 µL; PCR amplification program: 94℃ pre-denaturation for 2 min, 1 cycle; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min, 1 cycle; store at 4℃.
8. The application of the compound oil feed additive method for improving the reproductive quality of snakehead according to claims 1-7 in snakehead farming.