DNA polymerase theta (pol theta) inhibitor compounds and uses thereof

By developing DNA polymerase theta (POLθ) inhibitor compounds, the problem of DNA repair pathway dysfunction caused by high expression of POLθ in tumor cells has been solved, enhancing the anti-tumor effects of chemotherapy, radiotherapy and immunotherapy, especially significantly improving treatment sensitivity in tumors with HRD or DDR deficiency.

CN122103121APending Publication Date: 2026-05-29SHENZHEN BAY LAB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411759059.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies are unable to effectively inhibit the high expression of DNA polymerase theta (POLθ) in tumor cells, leading to dysfunction of the DNA double-strand break repair pathway and affecting the efficacy of tumor treatment.

Method used

To develop a DNA polymerase theta (POLθ) inhibitor compound, including its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, for the treatment and/or prevention of tumors.

Benefits of technology

By inhibiting POLθ, the anti-tumor effects of chemotherapy, radiotherapy, and immunotherapy are enhanced, especially in tumors with HRD or DDR deficiency, such as breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer, significantly improving treatment sensitivity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122103121A_ABST
    Figure CN122103121A_ABST
Patent Text Reader

Abstract

The present application provides a DNA polymerase theta (Pol theta) inhibitor represented by structural formula (I) and its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterium compounds, nitroxides, metabolites or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds or prodrugs thereof, and corresponding preparation methods and applications. Biological experiments show that the compound of the present application has a Pol theta inhibitory effect, and can be used alone or in combination to treat tumors with high incidence of homologous recombination deficiency (HRD) or DNA damage response (DDR) deficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of medicinal chemistry, and in particular to a DNA polymerase theta (POLθ) inhibitor compound and its application. Background Technology

[0002] DNA damage and its repair play a crucial role in cancer treatment. Cells may suffer DNA damage when subjected to exogenous and endogenous stress. Tumor cells, due to their rapid proliferation, are more sensitive to DNA damage, especially when they lack functional DNA repair pathways. This sensitivity is also a key mechanism by which many anti-tumor drugs exert their effects, such as common chemotherapy drugs like cisplatin and 5-FU, and targeted cancer drugs like olaparib and niraparib.

[0003] Double-strand breaks (DSBs) are among the most serious types of DNA damage. Unrepaired DSBs can disrupt cellular functions such as transcription and replication, posing a serious threat to genome stability and cell survival. DSBs can be repaired through three main pathways: homologous recombination (HR), non-homologous end joining (NHEJ), and microhomologous end joining (MMEJ or TMEJ). HR primarily occurs in the G1 / S phase, relying on nucleases to excise DNA ends and generate a long single-stranded DNA template; it is a high-fidelity repair method. NHEJ occurs at various stages of the cell cycle, with the highest efficiency in the G2 / M phase. It does not require a DNA template and directly performs end joining; therefore, it is an error-prone repair method. MMEJ mainly functions in the M phase and requires 2-6 bp of microhomologous sequences; therefore, it is also an error-prone repair method.

[0004] DNA polymerase theta (Polθ) is a key protein in the MMEJ repair pathway. It is a multifunctional polymerase belonging to the DNA polymerase A family, composed of an N-terminal helicase domain, a C-terminal polymerase domain, and a central linker region. The polymerase domain can perform various DNA strand elongations, including cis-elongation, trans-elongation, and cross-damage synthesis, making it an essential functional domain for DNA strand elongation in the MMEJ repair pathway. The helicase domain competitively binds to damaged DNA with RAD51, thus inhibiting homologous recombination repair. Studies have found that the central linker region is related to substrate specificity.

[0005] Polθ is almost unexpressed or poorly expressed in normal tissues, and MMEJ is considered an alternative pathway for DSB repair. However, when HR or NHEJ are deficient, cells become highly dependent on the MMEJ pathway. A recent study found that knockout of up to 140 genes involved in DNA damage response pathways (DDR) increases cellular dependence on Polθ. Furthermore, Polθ is significantly overexpressed in 17 types of tumors, including esophageal cancer, cervical cancer, breast cancer, advanced serous ovarian cancer, and lung cancer, and is associated with poor prognosis in many cancers. Ovarian cancer, breast cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer also have the highest incidence of homologous recombination deficiency (HRD), suggesting that Polθ may be a specific target for HRD or other DDR gene-deficient tumors.

[0006] Previous studies have also found that Polθ inhibition or knockout has synergistic anti-tumor effects with various drugs. For example, it has a synergistic effect with PARP inhibitors in HRD tumors, and with DNA-PK inhibitors in TP53-mutant tumors. In addition, in pancreatic cancer, Polθ inhibition can activate the immune system through the cGAS-STING pathway; in lung cancer, Polθ inhibition can also increase the sensitivity of lung cancer cells to radiotherapy.

[0007] In summary, Polθ's high selectivity in both normal and tumor tissues makes its inhibitors highly promising for use as monotherapy or in combination with other DDR inhibitors in tumors with high HRD or DDR deficiency, such as breast cancer, ovarian cancer, pancreatic cancer, prostate cancer, esophageal cancer, and lung cancer, as well as for enhancing the efficacy of radiotherapy, chemotherapy, and immunotherapy. Summary of the Invention

[0008] The main objective of this invention is to provide a DNA polymerase theta (POLθ) inhibitor compound, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, and the use of such compounds or pharmaceutical compositions in the treatment and / or prevention of tumors.

[0009] In a first aspect of the invention, a compound of formula (I) or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated derivative, nitride, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug thereof is provided.

[0010]

[0011] in:

[0012] Ring A is selected from 6-10 aryl, 5-10 heteroaryl, 5-10 heterocyclic, C5-10 carbocyclic, and fused bicyclic heteroaryl composed of 8-18 ring atoms. Preferably, ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl composed of 8-18 ring atoms. Optionally, ring A is separated by one or more R atoms. A replace;

[0013] One or more R A They may be the same or different, and each is independently selected from deuterium, halogens (e.g., F, Cl, Br, or I), oxo (=O), -SF5, hydroxyl, cyano, nitro, C1-10 alkyl, C1-10 haloalkyl, C3-10 cycloalkyl, C3-10 cycloalkoxy, C1-10 alkoxy, C2-10 alkenyl, C2-10 alkynyl, -L 1 -C1-10 alkyl, -L 1 -C2-10 alkenyl, -L 1 -C2-10 Alkynyl, -NRaRb, -CONRaRb, -L 1 -NRaRb、-L 1 -CONRaRb, -CORa, -L 1 -CORa-, -COORa, -L 1 -COORa and -L 1 -C1-10 alkoxy group, where L 1 The components are selected from C1-10 alkylene groups, -SO2- and -CO- and any combination thereof, preferably selected from methylene, ethylene, propylene, butylene, -SO2- and -CO- and any combination thereof;

[0014] Q is a divalent linker, preferably selected from -O-, -SO-, -SO2-, -CO-, -NH-, -CH2-, and any combination thereof;

[0015] X, Y, and Z are each independently O, S, N, or CH, and Indicates a single bond or a double bond;

[0016] R1 is selected from -H, deuterium, halogen, hydroxyl, cyano, nitro, C1-10 alkyl, C1-10 haloalkyl, -NRaRb, CONRaRb, -C1-10 alkoxy, -C2-10 alkenoxy, -C2-10 alkynoxy, -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-10 alkoxy group, -L 2 -C1-10 alkyl, -L 2 -C2-10 alkenyl, -CORa, -L 2-CORa-, -COORa, -L 2 -COORa、-L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10-membered heteroaryl, C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10-membered heterocyclic and 5-10-membered heteroaryl, of which L 2 Selected from -O-, -NHCO-, -NHSO2-, C1-10 alkylene, C1-10 alkenylene, C1-10 ynylene, and any combination thereof; optionally, R1 is separated by one or more R B replace;

[0017] One or more R B They may be the same or different, and each is independently selected from -OH, -CN, -SF5, halogen, nitro, amino, C1-5 alkyl, C1-5 alkoxy, C1-5 haloalkyl, C1-5 haloalkoxy, hydroxy-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy and C3-10 cycloalkyl;

[0018] R2 and R3 are each independently selected from: -H, deuterium, -CN, hydroxyl, nitro, halogen (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 alkoxy, NRaRb, -CONRaRb, -CORa, -L 2 -CORa-, -COORa, -L 2 -COORa and 3-10 membered heterocyclic groups; optionally, R2 and R3 are separated by one or more R C replace;

[0019] One or more R C They may be the same or different, and each is independently selected from C1-5 alkyl groups;

[0020] n is 0, 1, 2 or 3, and when n is 2 or 3, each R3 is the same or different;

[0021] Alternatively, R1 and R2, together with the benzene rings they are connected to, form a cyclic β-benzene ring, wherein ring B is selected from a C3-10 carbon ring, a 3-10 membered heterocycle, or a 5-10 membered heteroaromatic ring, preferably selected from a 3-10 membered heterocycle or a 5-10 membered heteroaromatic ring; optionally, ring B is surrounded by one or more R... D replace;

[0022] One or more R DThe same or different, and each independently selected from -OH, -CN, -SF5, halogen (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 haloalkyl, C1-5 alkoxy, C1-5 haloalkoxy, hydroxy-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy, C3-10 cycloalkyl, -3-10 heterocyclic, C1-5 alkylene-3-10 heterocyclic, optionally, R D Further substituted with C1-5 alkyl groups; and

[0023] Ra and Rb are each independently selected from -H, C1-6 alkyl groups (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, and tert-butyl).

[0024] In some implementations, one or more R A For 1, 2, 3 or 4 Rs A .

[0025] In some implementations, one or more R A Each is independently selected from F, Cl, Br, I, C1-8 alkyl, C1-8 haloalkyl, C3-8 cycloalkyl, C3-8 cycloalkoxy, C1-8 alkoxy, C2-8 alkenyl, C2-8 alkynyl, -L 1 -C1-8 alkyl, -L 1 -C2-8 alkenyl, -L 1 -C2-8 ynyl group and -L 1 -C1-8 alkoxy group.

[0026] In some implementations, one or more R A Each is independently selected from C1-6 alkyl, C1-6 haloalkyl, C3-6 cycloalkyl, C3-6 cycloalkoxy, C1-6 alkoxy, C2-6 alkenyl, C2-6 alkynyl, -L 1 -C1-6 alkyl, -L 1 -C2-6 alkenyl, -L 1 -C2-6 ynyl group and -L 1 -C1-6 alkoxy group.

[0027] In some implementations, one or more R A Each is independently selected from C1-4 alkyl, C1-4 haloalkyl, C3-4 cycloalkyl, C3-4 cycloalkoxy, C1-4 alkoxy, C2-4 alkenyl, C2-4 alkynyl, -L 1 -C1-4 alkyl, -L 1 -C2-4 alkenyl, -L 1 -C2-4 ynyl group and -L 1 -C1-4 alkoxy group.

[0028] In some implementations, one or more R A Each is independently selected from -F, -Cl, C1-5 alkyl, C1-5 haloalkyl, C1-5 alkoxy, -L 1 -C1-5 alkyl, -L 1 -C2-5 alkenyl, -L 1 -NRaRb、-L 1 -CONRaRb and -L 1 -C1-5 alkoxy group.

[0029] In some implementations, one or more R A Each is independently selected from methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, methoxy, ethoxy, propoxy, -L 1 -CH3、-L 1 -CH=CH2, -L 1 -N(CH3)2、-L 1 -CONH2 and -L 1 -OCH3.

[0030] In some implementations, the halomethyl group is a fluoromethyl group.

[0031] In some implementations, L 1 Selected from C1-8 alkylene groups, -SO2- and -CO- and any combination thereof.

[0032] In some implementations, L 1 Selected from C1-6 alkylene groups, -SO2- and -CO- and any combination thereof.

[0033] In some implementations, L 1 Selected from C1-4 alkylene groups, -SO2- and -CO- and any combination thereof.

[0034] In some implementations, L 1 Choose methylene, ethylene, -SO2- and -CO- and any combination thereof.

[0035] In some implementations, one or more R A Each is independently selected from -F, -Cl, -CH3, -OCH3, -CF3, -CH2-CH2-N(CH3)2, -SO2-CH=CH2, -CH2-CO-NH2, -CO-CH=CH2, -CO-CH3, and -CH2-CH2-OCH3.

[0036] In some embodiments, ring A is a phenyl group.

[0037] In some implementations, ring A is a 5-6 membered heteroaryl group.

[0038] In some embodiments, ring A is a 5-6 member nitrogen-containing heteroaryl group.

[0039] In some embodiments, ring A is pyridinyl.

[0040] In some implementations, ring A is a 5-6 member heterocyclic group.

[0041] In some embodiments, ring A is a 5-6 member nitrogen-containing heterocyclic group.

[0042] In some embodiments, ring A is piperidinyl.

[0043] In some implementations, ring A is The structure is represented by J, where each J is independently N or C; each K is independently N, NH, CH, or CH2; where This indicates that the ring is an aromatic ring, and This indicates that adjacent atoms on the ring form single or double bonds, or that the ring is an aromatic ring.

[0044] In some implementations, ring A is selected from...

[0045] In some implementations, ring A is selected from...

[0046] In some implementations, ring A is selected from...

[0047] In some implementations, ring A is selected from...

[0048] In some implementations, Q is selected from -NH-, -CH2-, and any combination thereof.

[0049] In some implementations, Q is -NH- or -CH2-.

[0050] In some implementations... Selected from:

[0051] Choose any location It is substituted with a substituent selected from deuterium, C1-5 alkyl, C1-5 haloalkyl, halogen, hydroxyl, cyano, -SF5, and C1-5 alkoxy.

[0052] In some implementations... It is substituted with substituents selected from C1-3 alkyl, C1-3 haloalkyl, and C1-3 alkoxy groups.

[0053] In some implementations... Selected from: Where ph represents The site where the benzene ring in formula (I) is connected.

[0054] In some implementations, one or more R B For 1, 2 or 3 R B .

[0055] In some implementations, one or more R B Each is independently selected from -F, -Cl, -Br, -I, C1-3 alkyl, C1-3 alkoxy, C1-3 haloalkyl, C1-3 haloalkoxy, hydroxy-substituted C1-3 alkyl, C1-5 alkylene-C1-3 alkoxy and C3-7 cycloalkyl.

[0056] In some implementations, one or more R B Each is independently selected from C1-3 alkylene-C1-3 alkoxy and C3-5 cycloalkyl.

[0057] In some implementations, one or more R B Each is independently selected from methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, hydroxymethyl, hydroxyethyl, hydroxypropyl, C1-3 alkylene-methoxy and C3-5 cycloalkyl.

[0058] In some implementations, one or more R B Each is independently selected from fluoromethyl groups.

[0059] In some implementations, one or more R B Each is independently selected from -OH, -CN, -F, -Cl, -CH3, -CF3, -CH2OCH3, cyclopropyl, and cyclobutyl.

[0060] In some implementations, L 2 It is selected from -O-, -NHCO-, -NHSO2-, C1-8 alkylene, C2-8 alkenylene, C2-8 ynylene and any combination thereof.

[0061] In some implementations, L 2 It is selected from -O-, -NHCO-, -NHSO2-, C1-6 alkylene, C2-6 alkenylene, C2-6 ynynylene and any combination thereof.

[0062] In some implementations, L 2 Selected from -O-, -NHCO-, -NHSO2-, C1-4 alkylene, C2-4 alkenylene, C2-4 ynynylene and any combination thereof.

[0063] In some implementations, L 2Selected from -O-, -NHCO-, -NHSO2-, methyleneoxy, ethoxy, propoxy, and ethynyl.

[0064] In some embodiments, R1 is selected from C1-8 alkyl, C1-8 haloalkyl, -C1-8 alkoxy, -C2-8 alkenoxy, -C2-8 alkynoxy, C3-8 cycloalkyl, -L 2 -C1-8 alkoxy group, -L 2 -C1-8 alkyl, -L 2 -C2-8 alkenyl, -L 2 -C3-8 cycloalkyl, -L 2 -3-8 membered heterocyclic group, -L 2 -5-6-membered heteroaryl; C3-8 cycloalkyl, C3-8 cycloalkenyl, 3-8-membered heterocyclic and 5-6-membered heteroaryl.

[0065] In some embodiments, R1 is selected from C1-6 alkyl, C1-6 haloalkyl, -C1-6 alkoxy, -C2-6 alkenoxy, -C2-6 alkynoxy, C3-6 cycloalkyl, -L 2 -C1-6 alkoxy group, -L 2 -C1-6 alkyl, -L 2 -C2-6 alkenyl, -L 2 -C3-6 cycloalkyl, -L 2 -3-6 membered heterocyclic groups; C3-6 cycloalkyl, C3-6 cycloalkenyl and 3-6 membered heterocyclic groups.

[0066] In some embodiments, R1 is selected from C1-4 alkyl, C1-4 haloalkyl, -C1-4 alkoxy, -C2-4 alkenoxy, -C2-4 alkynoxy, C3-4 cycloalkyl, -L 2 -C1-4 alkoxy group, -L 2 -C1-4 alkyl, -L 2 -C2-4 alkenyl, -L 2 -C3-4 cycloalkyl, -L 2 -3-4 membered heterocyclic groups; C3-4 cycloalkyl, C3-4 cycloalkenyl and 3-4 membered heterocyclic groups.

[0067] In some embodiments, R1 is selected from -C1-10 alkoxy, -C2-10 alkynoxy; -L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2-5-10 heteroaryl; C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10 heterocyclic and 5-10 heteroaryl.

[0068] In some embodiments, R1 is selected from -C1-7 alkoxy, -C2-7 alkynoxy; -L 2 -C1-3 alkoxy group, -L 2 -C1-3 alkyl, -L 2 -C2-3 alkenyl, -L 2 -C3-7 cycloalkyl, -L 2 -3-7 membered heterocyclic group, -L 2 -5-6-membered heteroaryl; C3-7 cycloalkyl, C3-7 cycloalkenyl, 3-7-membered heterocyclic and 5-6-membered heteroaryl.

[0069] In some embodiments, R1 is selected from -C1-5 alkoxy, -C2-5 alkynoxy, and -L 2 -C3-6 cycloalkyl, -L 2 -3-6 membered heterocyclic groups; C3-6 cycloalkyl, C3-6 cycloalkenyl.

[0070] In some embodiments, R1 is -N(CH3)(C3H7). In some embodiments, R1 is...

[0071] In some embodiments, R1 is selected from methoxy, ethoxy, propoxy, butoxy, and propyneoxy.

[0072] In some implementations, R1 is selected from...

[0073] In some implementations, R1 is selected from...

[0074] In some implementations, R1 is selected from -L 2 -N(CH3)2、-L 2 -CON(CH3)2、-L 2 -Methoxy group, -L 2 -methyl, -L 2 -propyl, -L 2 -Vinyl, -L 2 -Cyclopropyl, -L 2 -cyclohexyl, -L 2 -oxoheterobutyl, -L 2 -oxetyl-L 2 -oxecyclohexyl and -L 2 -Pyridyl.

[0075] In some implementations, R1 is selected from...

[0076] In some implementations, R1 is selected from:

[0077] In some embodiments, R1 is selected from C5-6 cycloalkyl, C5-6 cycloalkenyl, 5-7 heterocyclic and 5-6 heteroaryl.

[0078] In some embodiments, R1 is selected from cyclohexyl and cyclohexenyl.

[0079] In some implementations, R1 is selected from...

[0080] In some implementations, R1 is selected from...

[0081] In some implementations, R1 is selected from 1-2 5-7 member heterocyclic groups independently selected from O, N and S.

[0082] In some implementations, R1 is selected from...

[0083] In some implementations, R1 is selected from...

[0084] In some implementations, R1 is selected from...

[0085] In some implementations, R1 is selected from:

[0086] In some embodiments, R1 is selected from 1-2 5-6 heteroaryl groups independently selected from O, N and S.

[0087] In some implementations, R1 is selected from...

[0088] In some implementations, R1 is selected from...

[0089] In some implementations, one or more R C For 1, 2 or 3 R C .

[0090] In some implementations, one or more R C It is a C1-3 alkyl group.

[0091] In some implementations, one or more R C It is a methyl group.

[0092] In some embodiments, R2 and R3 are each independently selected from -F, -Cl, -Br, -I, C1-3 alkyl, C1-3 alkoxy, and 3-7 membered heterocyclic groups.

[0093] In some implementations, R2 and R3 are each independently selected from -CONH2.

[0094] In some embodiments, R2 and R3 are each independently selected from methyl and methoxy groups.

[0095] In some implementations, R2 and R3 are each independently selected from 5-7 member heterocyclic groups.

[0096] In some implementations, R2 and R3 are each independently selected from 1-2 5-6 member heterocyclic groups independently selected from O, N and S.

[0097] In some implementations, R2 and R3 are each independently selected from...

[0098] In some implementations, R2 and R3 are each independently selected from...

[0099] In some implementations, R2 and R3 are each independently selected from...

[0100] In some implementations, one or more R D For 1, 2 or 3 R D .

[0101] In some implementations, one or more R D Each is independently selected from -F, -Cl, -Br, -I, C1-3 alkyl, C1-3 haloalkyl, C1-3 alkoxy, C1-3 haloalkoxy, hydroxy-substituted C1-3 alkyl, C1-5 alkylene-C1-3 alkoxy, C3-7 cycloalkyl, 3-7 membered heterocyclic group, and C1-5 alkylene-3-7 membered heterocyclic group.

[0102] In some implementations, one or more R D Each is independently selected from C1-3 alkylene-C1-3 alkoxy and C1-3 alkylene-3-7 heterocyclic groups.

[0103] In some implementations, one or more R D Each is independently selected from methyl, halomethyl, hydroxymethyl, hydroxyethyl, hydroxypropyl and C1-3 alkylene-methoxy.

[0104] In some implementations, one or more R D Each is independently selected from fluoromethyl groups.

[0105] In some implementations, one or more R D Each is independently selected from -CH3, -CF3, -CH2OCH3, cyclopropyl, and cyclobutyl.

[0106] In some implementations, one or more R D Each is independently selected from C1-3 alkylene groups containing O, specifically 3-7 membered heterocyclic groups.

[0107] In some implementations, one or more R D Each independently selected

[0108] In some embodiments, the compound of formula (I) is the compound of formula (I-1):

[0109] In some embodiments, ring B is selected from 5-6 membered heterocyclic rings or 5-6 membered heteroaromatic rings.

[0110] In some implementations, ring B is selected from 1-2 5-6 member heterocycles independently selected from O, N and S.

[0111] In some implementations, ring B is selected from 5-6 member heterocycles containing 1-2 N atoms.

[0112] In some implementations, ring B is selected from...

[0113] In some implementations... Selected from

[0114] In some implementations... Selected from

[0115] In some embodiments, ring B is selected from 1-2 5-6 membered heteroaromatic rings independently selected from O, N and S.

[0116] In some implementations, ring B is selected from 5-6 membered heteroaromatic rings containing 1-2 N atoms.

[0117] In some implementations, ring B is selected from...

[0118] In some implementations... Selected from

[0119] In some implementations, ring B is selected from...

[0120] In some embodiments, Ra and Rb are each independently selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, and tert-butyl.

[0121] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl composed of 8-18 ring atoms,

[0122] One or more R A They may be the same or different, and each is independently selected from halogens (e.g., -F, -Cl, -Br), C1-5 alkyl, C1-5 haloalkyl, and C1-5 alkoxy;

[0123] Q is a divalent linker, preferably -NH- or -CH2-;

[0124] X, Y, and Z are each independently O, S, N, or CH, and Indicates a single bond or a double bond;

[0125] Furthermore, when R2 and R3 are H, R1 is selected from C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10 heterocyclic and 5-10 heteroaryl groups;

[0126] When R2 is not H, R1 is selected from -H, -NRaRb, -C1-10 alkoxy, -C2-10 alkynoxy; -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10-membered heteroaryl; C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10-membered heterocyclic and 5-10-membered heteroaryl, wherein L 2 Selected from -O-, -NHCO-, -NHSO2- and ethynylene groups; optionally, R1 is separated by one or more R groups. B replace;

[0127] One or more R B They may be the same or different, and each is independently selected from -OH, -CN, halogen, C1-5 alkyl, C1-5 haloalkyl, hydroxy-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy, and C3-10 cycloalkyl;

[0128] Alternatively, R1 can be selected from -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group and -L 2 -5-10 aryl aromatic compounds, of which L 2 Selected from methyleneoxy, ethoxy, and propoxy; and optionally, R1 is substituted with a C1-5 alkyl group that is substituted with a hydroxyl group;

[0129] R2 is selected from -CN, -F, C1-5 alkyl, -CONRaRb and 3-10 membered heterocyclic groups, and R3 is selected from -CN, -F, Br, I, C1-5 alkyl, C1-5 alkoxy, -CONRaRb and 3-10 membered heterocyclic groups; optionally, R2 and R3 are separated by one or more R C replace;

[0130] One or more R C They may be the same or different, and each is independently selected from C1-5 alkyl groups;

[0131] n is 0, 1, 2 or 3, and when n is 2 or 3, each R3 is the same or different;

[0132] Alternatively, R1 and R2, together with the benzene rings they are connected to, form a cyclic B-benzene ring, wherein ring B is selected from 3-10 membered heterocycles or 5-10 membered heteroaromatic rings; optionally, ring B is surrounded by one or more R... D replace;

[0133] One or more R D The same or different, and each independently selected from -OH, -CN, halogens (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 haloalkyl, hydroxyl-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy, C3-10 cycloalkyl, and C1-5 alkylene-3-10 heterocyclic groups, optionally, R D Further substituted with C1-5 alkyl groups; and

[0134] Ra and Rb are each independently selected from -H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, and tert-butyl.

[0135] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, one or more R A Each is independently selected from -F, -Cl, methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, methoxy, ethoxy, and propoxy.

[0136] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, the halomethyl group is a fluoromethyl group.

[0137] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, one or more R A Each is independently selected from -CF3.

[0138] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, R2 and R3 are H, and R1 is selected from C5-7 cycloalkyl, C5-7 cycloalkenyl, 5-7 heterocyclic, and 5-6 heteroaryl.

[0139] In a further embodiment, R1 is selected from...

[0140] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl composed of 8-18 ring atoms, R2 is not H, and R1 is selected from -H, -NRaRb, -C1-10 alkoxy, -C2-10 alkynoxy; -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10-membered heteroaryl; C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10-membered heterocyclic and 5-10-membered heteroaryl, wherein L 2 Selected from -O-, -NHCO-, -NHSO2- and ethynylene groups; optionally, R1 is separated by one or more R groups. B replace.

[0141] In a further embodiment, one or more R B Each is independently selected from F, Cl, Br, I, methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, C1-3 alkylene-methoxy and C3-5 cycloalkyl.

[0142] In a further embodiment, one or more R B Each is independently selected from fluoromethyl groups.

[0143] In a further embodiment, one or more R BEach is independently selected from -CH3, -CF3, cyclopropyl, and cyclobutyl.

[0144] In a further embodiment, R1 is selected from -C1-5 alkoxy, -C2-5 alkynoxy, and -L 2 -C1-3 alkoxy group, -L 2 -C1-3 alkyl, -L 2 -C2-3 alkenyl, -L 2 -C3-6 cycloalkyl, -L 2 -3-6 membered heterocyclic group, -L 2 -5-6-membered heteroaryl; C3-6 cycloalkyl, C3-6 cycloalkenyl, 3-7-membered heterocyclic and 5-6-membered heteroaryl.

[0145] In a further embodiment, R1 is -N(CH3)(C3H7). In a further embodiment, R1 is

[0146] In a further embodiment, R1 is selected from methoxy, propoxy, butoxy, and propyneoxy.

[0147] In a further embodiment, R1 is selected from...

[0148] In a further embodiment, R1 is selected from...

[0149] In a further embodiment, R1 is selected from -L 2 -N(CH3)2、-L 2 -CON(CH3)2、-L 2 -Methoxy group, -L 2 -methyl, -L 2 -propyl, -L 2 -Vinyl, -L 2 -Cyclopropyl, -L 2 -cyclohexyl, -L 2 -oxoheterobutyl, -L 2 -oxetyl-L 2 -oxecyclohexyl and -L 2 -Pyridyl.

[0150] In a further embodiment, R1 is selected from...

[0151] In a further embodiment, R1 is selected from:

[0152] In a further embodiment, R1 is selected from C5-6 cycloalkyl, C5-6 cycloalkenyl, 5-7 heterocyclic and 5-6 heteroaryl.

[0153] In a further embodiment, R1 is selected from cyclohexyl and cyclohexenyl.

[0154] In a further embodiment, R1 is selected from...

[0155] In a further embodiment, R1 is selected from...

[0156] In a further embodiment, R1 is selected from 1-2 5-7 member heterocyclic groups independently selected from O, N and S.

[0157] In a further embodiment, R1 is selected from...

[0158] In a further embodiment, R1 is selected from...

[0159] In a further embodiment, R1 is selected from...

[0160] In a further embodiment, R1 is selected from:

[0161] In a further embodiment, R1 is selected from 1-2 5-6 heteroaryl groups independently selected from O, N and S.

[0162] In a further embodiment, R1 is selected from...

[0163] In a further embodiment, R1 is selected from...

[0164] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl composed of 8-18 ring atoms, R2 is not H, and R1 is selected from -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group and -L 2 -5-10 aryl aromatic compounds, of which L 2 It is selected from methyleneoxy, ethoxy, and propoxy; and optionally, R1 is substituted with a C1-5 alkyl group that is substituted with a hydroxyl group.

[0165] In a further embodiment, R1 is replaced by a C1-3 alkyl group substituted with a hydroxyl group.

[0166] In a further embodiment, R1 is replaced by a hydroxymethyl group.

[0167] In a further embodiment, R1 is selected from -L 2 -C1-3 alkoxy group, -L 2 -C1-3 alkyl, -L 2 -C2-3 alkenyl, -L 2 -C3-6 cycloalkyl, -L 2 -3-6-membered heterocyclic groups and -L 2 -5-6 aryl heteroaryl groups, of which L 2 Selected from methyleneoxy, ethoxy, and propoxy.

[0168] In a further embodiment, R1 is selected from -L 2 -N(CH3)2、-L 2 -CON(CH3)2、-L 2 -Methoxy group, -L 2 -methyl, -L 2 -propyl, -L 2 -Vinyl, -L 2 -Cyclopropyl, -L 2 -cyclohexyl, -L 2 -oxoheterobutyl, -L 2 -oxetyl-L 2 -oxecyclohexyl and -L 2 -Pyridyl.

[0169] In a further embodiment, R1 is selected from...

[0170] In a further embodiment, R1 is selected from...

[0171] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, one or more R C It is a C1-3 alkyl group.

[0172] In a further embodiment, one or more R C It is a methyl group.

[0173] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, R2 is selected from C1-3 alkyl and -CONH2.

[0174] In a further embodiment, R2 is selected from methyl.

[0175] In a further embodiment, R2 is selected from 5-7 membered heterocyclic groups.

[0176] In a further embodiment, R2 is selected from 1-2 5-6 member heterocyclic groups independently selected from O, N and S.

[0177] In a further embodiment, R2 is selected from...

[0178] In a further embodiment, R2 is selected from...

[0179] In a further embodiment, R2 is selected from...

[0180] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, R3 is selected from C1-3 alkyl, C1-3 alkoxy, and -CONH2.

[0181] In a further embodiment, R3 is selected from methyl and methoxy.

[0182] In a further embodiment, R3 is selected from 5-7 membered heterocyclic groups.

[0183] In a further embodiment, R3 is selected from 1-2 5-6 membered heterocyclic groups independently selected from O, N and S.

[0184] In a further embodiment, R3 is selected from...

[0185] In a further embodiment, R3 is selected from...

[0186] In a further embodiment, R3 is selected from...

[0187] In some embodiments, when ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, one or more R D Each is independently selected from F, Cl, Br, I, methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, methyl, ethanol, propanol, C1-3 alkylene-methoxy and C1-3 alkylene-3-7 heterocyclic groups.

[0188] In a further embodiment, one or more R D Each is independently selected from fluoromethyl groups.

[0189] In a further embodiment, one or more RD Each is independently selected from -CH2OCH3, cyclopropyl, and cyclobutyl.

[0190] In a further embodiment, one or more R D Each is independently selected from C1-3 alkylene groups containing O, specifically 3-7 membered heterocyclic groups.

[0191] In a further embodiment, one or more R D Each independently selected

[0192] In a further embodiment, the compound of formula (I) is a compound of formula (I-1'): Ring B is selected from 5-6 membered heterocyclic rings or 5-6 membered heteroaromatic rings.

[0193] In embodiments of compounds of formula (I-1'), ring B is selected from 5-6 membered heterocycles comprising 1-2 independently selected O, N and S.

[0194] In embodiments of compounds of formula (I-1'), ring B is selected from 5-6 membered heterocycles containing 1-2 N atoms.

[0195] In embodiments of compounds of formula (I-1'), ring B is selected from...

[0196] In embodiments of the compound of formula (I-1'), Selected from

[0197] In embodiments of the compound of formula (I-1'), Selected from and

[0198]

[0199] In embodiments of compounds of formula (I-1'), ring B is selected from 1-2 5-6 membered heteroaromatic rings independently selected from O, N and S.

[0200] In embodiments of compounds of formula (I-1'), ring B is selected from 5-6 membered heteroaromatic rings containing 1-2 N atoms.

[0201] In embodiments of compounds of formula (I-1'), ring B is selected from...

[0202] In embodiments of the compound of formula (I-1'), Selected from

[0203] In embodiments of compounds of formula (I-1'), ring B is selected from...

[0204] In some embodiments, the compound of formula (I) is a compound of formula (I-2).

[0205]

[0206] in:

[0207] Cycloar Ar is selected from 5-10 membered heteroaryl groups and fused bicyclic heteroaryl groups consisting of 8-18 ring atoms; optionally, cycloar Ar is separated by one or more R groups. A replace;

[0208] One or more R A They may be the same or different, and each is independently selected from halogens (e.g., -F, -Cl, -Br), C1-5 alkyl and C1-5 alkoxy;

[0209] Q is a divalent linker, preferably -NH- or -CH2-;

[0210] X, Y, and Z are each independently O, S, N, or CH, and Indicates a single bond or a double bond;

[0211] R2 is selected from C1-5 alkyl groups;

[0212] Ra is selected from C1-5 alkyl and C1-5 haloalkyl;

[0213] m is 0, 1, 2, or 3; and

[0214] p can be 1, 2, 3, 4 or 5.

[0215] In some embodiments of the compound of formula (I-2), one or more R A For 1, 2, 3 or 4 Rs A .

[0216] In some embodiments of the compound of formula (I-2), one or more R A Each is independently selected from -F, -Cl, methyl, ethyl, propyl, methoxy, ethoxy, and propoxy.

[0217] In some embodiments of the compound of formula (I-2), the cyclic Ar is a 5-6 membered heteroaryl group.

[0218] In some embodiments of the compound of formula (I-2), the cyclic Ar is a 5-6 member nitrogen-containing heteroaryl group.

[0219] In some embodiments of the compound of formula (I-2), the cyclic Ar is pyridyl.

[0220] In some embodiments of the compound of formula (I-2), the cyclic Ar is The structure is represented by J, where each J is independently N or C; each K is independently N, NH, CH, or CH2; where This indicates that the ring is an aromatic ring, and This indicates that adjacent atoms on the ring form single or double bonds, or that the ring is an aromatic ring.

[0221] In some embodiments of the compound of formula (I-2), the cyclic Ar is selected from...

[0222] In some embodiments of the compound of formula (I-2), the cyclic Ar is selected from...

[0223] In some embodiments of the compound of formula (I-2), the cyclic Ar is selected from...

[0224] In some embodiments of the compound of formula (I-2), Selected from

[0225] In some embodiments of the compound of formula (I-2), Selected from Where ph represents The site where the benzene ring in formula (I) is connected.

[0226] In some embodiments of the compound of formula (I-2), R2 is selected from C1-3 alkyl groups.

[0227] In some embodiments of the compound of formula (I-2), R2 is selected from methyl.

[0228] In some embodiments of the compounds of formula (I-2), Ra is selected from C1-3 alkyl and C1-3 haloalkyl.

[0229] In some embodiments of the compound of formula (I-2), Ra is selected from -CH3 and -CF3.

[0230] In some embodiments of the compound of formula (I-2), Selected from

[0231] In some embodiments of the compound of formula (I-2), Selected from

[0232] In some embodiments of the compound of formula (I-2), Selected from:

[0233] In some embodiments, R1 and R2 together with the benzene rings they are connected to form a cyclic B and a benzene ring. When ring B is selected from a 3-10 membered heterocyclic ring or a 5-10 membered heteroaromatic ring, one or more R A Each is independently selected from -F, -Cl, methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, methoxy, ethoxy, propoxy, -L 1 -CH3、-L 1 -CH=CH2, -L 1 -N(CH3)2、-L 1 -CONH2 and -L 1 -OCH3.

[0234] In a further embodiment, the halomethyl group is a fluoromethyl group.

[0235] In a further embodiment, L 1 It is methylene or ethylene.

[0236] In a further embodiment, one or more R A Each is independently selected from -CF3, -CH2-CH2-N(CH3)2, -SO2-CH=CH2, -CH2-CO-NH2, -CO-CH=CH2, -CO-CH3, and -CH2-CH2-OCH3.

[0237] In a further embodiment, ring A is a phenyl group.

[0238] In a further embodiment, ring A is a 5-6 membered heteroaryl group.

[0239] In a further embodiment, ring A is a 5-6 member nitrogen-containing heteroaryl group.

[0240] In a further embodiment, ring A is pyridinyl.

[0241] In a further embodiment, ring A is a 5-6 member heterocyclic group.

[0242] In a further embodiment, ring A is a 5-6 member nitrogen-containing heterocyclic group.

[0243] In a further embodiment, ring A is piperidinyl.

[0244] In a further embodiment, ring A is... The structure is represented by J, where each J is independently N or C; each K is independently N, NH, CH, or CH2; where This indicates that the ring is an aromatic ring, and This indicates that adjacent atoms on the ring form single or double bonds, or that the ring is an aromatic ring.

[0245] In a further embodiment, ring A is selected from...

[0246] In a further embodiment, ring A is selected from...

[0247] In a further embodiment, ring A is selected from...

[0248] In a further embodiment, ring A is selected from...

[0249] In a further embodiment, one or more R D Each is independently selected from F, Cl, Br, I, methyl, ethyl, propyl, halomethyl, haloethyl, halopropyl, methyl, ethanol, propanol, C1-3 alkylene-methoxy and C1-3 alkylene-3-7 heterocyclic groups.

[0250] In a further embodiment, one or more R D Each is independently selected from fluoromethyl groups.

[0251] In a further embodiment, one or more R D Each is independently selected from -CH3, -CF3, -CH2OCH3, cyclopropyl, and cyclobutyl.

[0252] In a further embodiment, one or more R D Each is independently selected from C1-3 alkylene groups containing O, specifically 3-7 membered heterocyclic groups.

[0253] In a further embodiment, one or more R D Each independently selected

[0254] In a further embodiment, ring B is selected from 5-6 membered heterocyclic rings or 5-6 membered heteroaromatic rings.

[0255] In a further embodiment, ring B is selected from 1-2 5-6 membered heterocycles independently selected from O, N and S.

[0256] In a further embodiment, ring B is selected from 5-6 member heterocycles containing 1-2 N atoms.

[0257] In a further embodiment, ring B is selected from...

[0258] In a further embodiment, the structure formed by ring B and its fused benzene ring Selected from

[0259] In a further embodiment, the structure formed by ring B and its fused benzene ring Selected from

[0260] In a further embodiment, ring B is selected from 1-2 5-6 membered heteroaromatic rings independently selected from O, N and S.

[0261] In a further embodiment, ring B is selected from 5-6 membered heteroaromatic rings containing 1-2 N atoms.

[0262] In a further embodiment, ring B is selected from... In a further embodiment, the structure formed by ring B and its fused benzene ring... Selected from

[0263] In a further embodiment, ring B is selected from... In some embodiments, the compound of formula (I) is selected from the following compounds:

[0264]

[0265]

[0266]

[0267] In some embodiments, the compound of formula (I) is selected from the following compounds:

[0268]

[0269]

[0270] In a second aspect of the invention, a pharmaceutical composition is provided comprising a compound of formula (I) of the invention or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, nitride, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug thereof, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutically acceptable carrier or excipient may be selected, for example, a solid carrier, a liquid carrier or a semi-solid carrier, an adjuvant, a diluent, a filler or leavening agent, a granulator, a coating agent, a release control agent, a binder, a disintegrant, a lubricant, a preservative, an antioxidant, a buffer, a suspending agent, a thickener, a flavoring agent, a sweetener, a masking agent, a stabilizer, or any other excipient commonly used in pharmaceutical compositions.

[0271] In some embodiments, the pharmaceutical composition may be in any form suitable for oral, parenteral, topical, intranasal, intrabronchial, sublingual, ophthalmic, otological, rectal, vaginal, or transdermal administration. When the composition is intended for parenteral administration, it may be formulated for intravenous, intramuscular, intraperitoneal, or subcutaneous administration, or administered directly to the target organ or tissue via injection, infusion, or other routes of administration.

[0272] In a third aspect of the invention, the use of compounds of formula (I), (I-1), (I-1'), or (I-2) as described in the first aspect, or their enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, or pharmaceutical compositions as described in the second aspect, in the preparation of medicaments for treating and / or preventing diseases associated with Polθ expression or high expression is provided.

[0273] In some embodiments, the compounds and / or pharmaceutical compositions of the present invention can treat (prevent or inhibit) diseases associated with Polθ expression or high expression.

[0274] In some implementations, diseases associated with Polθ expression or high expression include tumors or cancer.

[0275] In some embodiments, the compounds and / or pharmaceutical compositions of the present invention can treat (prevent or inhibit) tumors or can treat (or inhibit) cancers (and their benign counterparts) including, but are not limited to, epithelial tumors (adenomas and various types of cancer, including adenocarcinoma, squamous cell carcinoma, transitional cell carcinoma and other cancers), such as bladder cancer and urinary tract cancer, breast cancer, gastrointestinal cancers (including esophageal cancer, gastric cancer, small bowel cancer, rectal cancer and other cancers), liver cancer (hepatocellular carcinoma), gallbladder cancer and biliary system cancer, pancreatic exocrine carcinoma, kidney cancer, lung cancer (e.g., adenocarcinoma, small cell lung cancer, non-small cell lung cancer, bronchoalveolar carcinoma and mesothelial carcinoma). Cancers affecting the head and neck (e.g., tongue cancer, oral cancer, laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, tonsil cancer, salivary gland cancer, nasal cavity cancer, and paranasal sinus cancer), ovaries, fallopian tubes, peritoneum, vagina, vulva, penis, cervix, myometrium, endometrium, thyroid gland (e.g., follicular thyroid carcinoma), adrenal glands, prostate, skin and adnexa (e.g., melanoma, basal cell carcinoma, squamous cell carcinoma, keratoacanthoma, dysplastic nevus); hematologic malignancies (i.e., leukemia, lymphoma, lymphoma) and pre-malignant hematologic diseases as well as marginal malignancies, including hematologic malignancies and related lymphatic diseases (e.g., acute lymphoblastic leukemia [ALL], chronic lymphoblastic leukemia [CLL]), B-cell lymphomas, such as diffuse large B-cell lymphoma. Follicular B-cell lymphoma (DLBCL), follicular lymphoma, Burkitt lymphoma, mantle cell lymphoma, MALT lymphoma, T-cell lymphoma and leukemia, natural killer (NK) cell lymphoma, Hodgkin's lymphoma, hairy cell leukemia, monoclonal antibody disease of undetermined significance, plasmacytoma, multiple myeloma and post-transplant lymphoproliferative disorders, as well as myeloid hematologic malignancies and related diseases (such as acute myeloid leukemia [AML], chronic myeloid leukemia [CML], chronic myelomonocytic leukemia [CMML]), eosinophilic syndrome, myeloproliferative disorders such as polycythemia vera, essential thrombocythemia and essential myelofibrosis. Tumors of various origins include: fibrosarcomas, myelodysplastic syndromes, myelodysplastic syndromes, and promyelocytic leukemia; stromal tumors, such as soft tissue, bone, or cartilage sarcomas, including osteosarcoma, fibrosarcoma, chondrosarcoma, rhabdomyosarcoma, myeloma, liposarcoma, angiosarcoma, Kaposi's sarcoma, Ewing's sarcoma, synovial sarcoma, epithelioid sarcoma, gastrointestinal stromal tumors, benign and malignant histiocytomas, and primary dermatofibrosarcoma; tumors of the central or peripheral nervous system (such as astrocytomas, gliomas and glioblastomas, meningiomas, epitheliomas, pineal tumors, and schizomas); endocrine tumors (such as pituitary adenomas, adrenal adenomas, islet cell tumors, parathyroid adenomas, carcinoid tumors, and medullary thyroid carcinomas); and tumors of the eye and adnexa (such as retinoblastomas).Germ cell and trophoblastic tumors (such as teratomas, seminomas, embryonal dysplasia, chorioretinopathy, and choriocarcinoma); pediatric and embryonic tumors (such as medulloblastoma, neuroblastoma, Wilms' tumor, and primitive neuroectodermal tumors); or congenital or other syndromes that predispose patients to malignant tumors (such as hyperpigmentation).

[0276] In some specific embodiments, the compounds and / or pharmaceutical compositions of the present invention can treat (or inhibit) tumors including esophageal cancer, cervical cancer, breast cancer, ovarian cancer, advanced serous ovarian cancer, lung cancer, pancreatic cancer, and prostate cancer.

[0277] In a fourth aspect of the invention, the use of compounds of formulas (I), (I-1), (I-1'), and (I-2) described in the first aspect, or their enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, nitrides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, or the pharmaceutical compositions described in the second aspect, in combination with other therapies, for the treatment and / or prevention of tumors, is provided.

[0278] In some specific implementations, other therapies include, but are not limited to, chemotherapy, immunotherapy, radiotherapy, and other antitumor agents.

[0279] In some embodiments, the combination of the compounds and / or pharmaceutical compositions of the present invention with other therapies can treat / prevent tumors as described above.

[0280] In some embodiments, the compounds and / or pharmaceutical compositions of the present invention may be administered before, after, or simultaneously with other therapies.

[0281] In a fifth aspect of the invention, a method for treating and / or preventing tumors in a subject in need is provided, the method comprising administering an effective amount of the compound or pharmaceutical composition of the invention to the subject in need.

[0282] In some embodiments, the subject is a human or animal patient, preferably a human or veterinary animal, and more preferably a human.

[0283] The inventors have discovered that the compounds of this invention have high Polθ inhibitory activity and are highly efficient Polθ inhibitors that can be used to treat and / or prevent tumors, including esophageal cancer, cervical cancer, breast cancer, ovarian cancer, advanced serous ovarian cancer, lung cancer, pancreatic cancer, prostate cancer and many other tumors. Detailed Implementation

[0284] definition

[0285] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0286] As described herein, the compounds of this invention can be expanded by substituting any number of substituents or functional groups. Generally, when used in general formulas including substituents in this invention, the term "substitution," whether preceding or following the term "optional," refers to replacing a hydrogen radical with a substituent of a specified structure. When multiple positions in a particular structure are substituted by multiple specific substituents, each substituent position can be the same or different. The term "substitution" as used herein includes all permissible substitutions in organic compounds. In a broad sense, permissible substituents include acyclic, cyclic, branched, unbranched, carbocyclic, and heterocyclic, aromatic and non-aromatic organic compounds. In this invention, heteroatomic nitrogen may be supplemented with hydrogen substituents or any permissible substituents to complement its valence state. Furthermore, this invention considers the combination of substituents and variable groups to provide a stable form of compound, thereby facilitating the treatment of diseases. The term "stable" here means a compound having a stable structure that is sufficient to maintain the integrity of the compound structure when detected for a sufficiently long period of time, preferably remaining effective for a sufficiently long period of time.

[0287] The term "alkyl" refers to a straight-chain or branched saturated aliphatic hydrocarbon group having a specified number of carbon atoms. Alkyl groups used in this invention (including those that are themselves or as a portion of another substituent) may contain 1 to 10 carbon atoms, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms, preferably 1 to 5 carbon atoms, more preferably 1 to 3 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, and their various branched isomers.

[0288] The term "alkylene" refers to a divalent group formed by further removing a hydrogen atom from an alkyl group. The removed hydrogen atom can come from a single carbon atom or from hydrogen atoms on different carbon atoms. Examples of alkylene groups in this document include, but are not limited to, methylene, ethylene, or propylene.

[0289] The term "alkenyl" refers to a straight-chain or branched, non-cyclic unsaturated hydrocarbon group having a specified number of carbon atoms, wherein at least two carbon atoms are bonded together by unsaturated double bonds. The alkenyl groups suitable for use in this invention may have 2 to 10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, preferably 2 to 5 carbon atoms. Examples of C2-5 alkenyl groups include, but are not limited to, vinyl, 1-propen-1-yl, 1-propen-2-yl, 2-propen-1-yl, 2-methyl-1-propen-1-yl, 2-methyl-2-propen-1-yl, 1-buten-1-yl, 1-buten-2-yl, 2-buten-1-yl, 2-buten-2-yl, 3-buten-1-yl, 3-buten-2-yl, 1,3-butadien-1-yl, 1,3-butadien-2-yl, 1-penten-1-yl, 2-penten-1-yl, 2-penten-2-yl, 3-penten-1-yl, 3-penten-3-yl, 4-penten-1-yl, 4-penten-4-yl, etc. The alkenyl group preferably has one double bond.

[0290] The term "alkynyl" refers to a straight-chain or branched, non-cyclic unsaturated hydrocarbon group having a specified number of carbon atoms, wherein at least two carbon atoms are bonded together by an unsaturated triple bond. The alkynyl group suitable for use in this invention can have 2-10 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10) carbon atoms, preferably 2-5 carbon atoms. The alkynyl group preferably has one triple bond.

[0291] The term "alkylene" refers to a divalent group formed by further removing a hydrogen atom from an alkyl group. The removed hydrogen atom may be from a single carbon atom or from hydrogen atoms on different carbon atoms. Examples of alkylene groups in this document include, but are not limited to, methylene, ethylene, or propylene. Similarly, the terms "alkenylene," "ynyneene," and "alkoxyene" refer to divalent groups formed by further removing a hydrogen atom from an alkenyl, ynyne, and alkoxy group, respectively. The removed hydrogen atom may be from a single carbon atom or from hydrogen atoms on different carbon atoms. Examples of alkenylene groups in this document include, but are not limited to, vinylene and propenylene. Examples of ynyneene groups in this document include, but are not limited to, ethynene and propynene. Examples of alkoxyene groups in this document include, but are not limited to, methyleneoxy, ethoxy, and propoxyene.

[0292] The term "cycloalkyl" refers to cyclic alkyl groups comprising saturated monocyclic, bicyclic, or polycyclic rings, such as C3-10 cycloalkyl groups, for example, monocyclic, bicyclic, or polycyclic rings having 3, 4, 5, 6, 7, 8, 9, or 10 carbon ring atoms. Cycloalkyl groups may also include spirocyclic, bridged, and fused ring structures, such as 5-10 member fused bicyclic rings and 5-10 member spirobicyclic rings. Cycloalkyl groups suitable for use in this invention include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and norbornel. Examples of 5-10 member fused bicyclic rings include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and norbornel. Examples of 5-10 inch double-ring screws include, but are not limited to, those shown below. In this invention, the cycloalkyl group is preferably a monocyclic cycloalkyl group containing 3 to 10 carbon ring atoms, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0293] The term "cycloalkenyl" refers to a cycloalkyl group containing one or more unsaturated double bonds, such as a cycloalkenyl group containing 3 to 10 carbon ring atoms, for example, a monocyclic, bicyclic, or polycyclic cycloalkenyl group having 3, 4, 5, 6, 7, 8, 9, or 10 carbon ring atoms. The cycloalkenyl group suitable for use in this invention can have 4 to 8 carbon ring atoms. In this invention, the cycloalkenyl group is preferably a cycloalkenyl group containing one unsaturated double bond, for example, a cyclohexenyl group.

[0294] The term "heterocyclic group" refers to a cycloalkyl or cycloalkenyl group containing one or more heteroatoms, wherein one or more heteroatoms replace one or more cyclic carbon atoms of the cycloalkyl or cycloalkenyl group, and may include monocyclic heterocycles, bicyclic bridged heterocycles, bicyclic fused heterocycles, and bicyclic spirocyclic heterocycles, etc. Heterocyclic groups suitable for use in this invention may contain 3 to 10 ring atoms (3-10 membered heterocycles), for example 3, 4, 5, 6, 7, 8, 9, or 10 ring atoms, preferably 3-7 ring atoms. The heterocyclic group may be attached to a heteroatom or a carbon atom. The N and S in the ring atoms of the heterocyclic group may be oxidized to various oxidation states. Non-limiting examples of heterocyclic groups include oxoheterobutyl, azaheterobutyl, tetrahydrofuranyl, tetrahydropyrroleyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothioranyl, dioxaneyl, piperazineyl, hexahydropyrazineyl, morpholinyl, piperidinyl, dithiaalkyl, etc.

[0295] The term "aryl" refers to a monocyclic, bicyclic, or tricyclic ring system (preferably a 5-10 membered monoaromatic ring) having a total of 5 to 15 ring members (or ring atoms), wherein one ring in the system is aromatic and each ring in the system contains 3 to 10 ring members. In some embodiments of the invention, "aryl" refers to an aromatic ring system, including but not limited to phenyl, biphenyl, indenyl, 1-naphthyl, 2-naphthyl, tetrahydronaphthyl, anthraceneyl, and phenanthrene. Fused aryl groups may be attached to another group at a suitable position on an aromatic or non-aromatic ring. Hereinafter, "aryl" and "aromatic ring" are used interchangeably.

[0296] The term "heteroaryl" is an aryl group containing one or more heteroatoms, wherein the heteroatoms replace one or more carbon atoms in the aromatic ring. The heteroaryl groups applicable to this invention may contain 5-20-membered heteroaryl groups, preferably 5-10-membered heteroaryl groups, and more preferably 5-6-membered heteroaryl groups.

[0297] The term "fused heteroaryl" refers to a plurality of rings fused together, wherein at least one of the fused rings is a heteroaryl ring. The term "fused bicyclic heteroaryl" refers to a fused heteroaryl consisting of two rings fused together. Fused ring heteroaryl groups suitable for use in this invention include 5,6-fused ring heteroaryl, 6,6-fused ring heteroaryl, or 6,5-fused ring heteroaryl. Non-limiting examples of fused ring heteroaryl groups include fluorenyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalolinyl, cyclophosphinyl, naphthidyl, triazineyl, indoleyl, indazoleyl, benzofuranyl, benzothiophenyl, benzoxazolyl, benzotriazolyl, or benzothiazolyl. Heteroaryl or fused ring heteroaryl groups can be linked to the remainder of the molecule via carbon atoms or heteroatoms.

[0298] The term "alkoxy" or "alkyloxy" refers to -O-alkyl, such as -O-C1-C10 alkyl, preferably -O-C1-C5 alkyl, and more preferably -O-C1-C3 alkyl. Non-limiting examples of alkoxy compounds include methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, isobutoxy, tert-butoxy, n-pentoxy, n-hexoxy, cyclopropoxy, and cyclobutoxy.

[0299] The term "alkynyloxy group" or "alkynyloxy group" refers to an -O-alkynyl group, such as an -O-C2-C10 alkynyl group, preferably an -O-C2-C5 alkyl group, and more preferably an -O-C2-C3 alkyl group. Non-limiting examples of alkynyloxy groups include acetylynyloxy, n-propynyloxy, isopropynyloxy, n-butynyloxy, sec-butynyloxy, isobutynyloxy, tert-butynyloxy, etc.

[0300] In this article, the heteroatoms contained in heteroaryl and heterocyclic groups refer to O, S, N, Se, Si, B, and P. Preferably, the heteroatoms contained in this article are O, S, and N.

[0301] The term "halogen" refers to F, Cl, Br, I, or isotopes thereof. The terms "halogenated" or "halogen-substituted" refer to the substitution of a hydrogen atom by one or more of F, Cl, Br, I, or their isotopes. The upper limit for the number of halogen substituents is equal to the sum of the number of hydrogen atoms that can be substituted in the substituted group. Unless otherwise specified, the number of halogen substituents is any integer between 1 and this upper limit. When the number of halogen substituents is greater than 1, it can be the substitution of the same or different halogens. The term "halogenated alkyl" refers to an alkyl group in which one or more hydrogen atoms are substituted by a halogen. Examples of halogenated alkyl groups in this document include, but are not limited to, fluoroalkyl groups, such as trifluoromethyl.

[0302] In this document, when one group modifies another group, it means that the first group acts as a substituent, replacing the hydrogen atom on the second group. For example, aminoalkyl means that an amino group acts as a substituent, replacing the hydrogen atom on the alkyl group; alkylamino means that an alkyl group acts as a substituent, replacing the hydrogen atom on the amino group.

[0303] In this paper, the connecting lines drawn from the ring system indicate that one end of the bond can be connected to any suitable ring atom in the ring system that the bond passes through. Passing through one ring indicates a connection at any optional position on that ring, and passing through multiple rings indicates a connection at any optional position on multiple rings. For example, It can represent any of the following structures:

[0304] The term "treatment" for a subject's disease or "treatment" for a subject with or suspected of having a disease refers to administering medication to the subject, such as one or more agents, to reduce or prevent the worsening of at least one symptom of the disease. Therefore, in one implementation, "treatment" specifically refers to delaying progression, accelerating remission, inducing remission, increasing remission, accelerating recovery, increasing the efficacy of alternative therapies, or reducing resistance to alternative therapies, or combinations thereof. For example, reducing or maintaining the number or volume of detectable tumors in a treated patient population relative to an untreated control group, or reducing their invasiveness and metastatic potential, or reducing their resistance to known therapies or chemotherapy, etc.

[0305] In some embodiments, a "therapeutic effective amount" means that applying a sufficient amount of the compound disclosed in this invention will, to some extent, alleviate, reduce, or cure one or more symptoms of the treated disease or condition. In some embodiments, the result is a reduction and / or mitigation of the signs, symptoms, or causes of the disease, or any other desired alteration of the biological system. For example, an "effective amount" for therapeutic use is the amount of a composition comprising the compound disclosed in this application required to provide a clinically significant reduction in disease symptoms.

[0306] The term "subject" refers to an animal, such as a mammal, like a human or veterinary animal, including but not limited to primates (e.g., humans), cattle, sheep, goats, horses, dogs, cats, rabbits, rats, mice, etc. In some implementations, the subject is a human.

[0307] The term "pharmaceutical composition" refers to a mixture of one or more compounds described in this invention or their pharmaceutically acceptable salts, stereoisomers, isotopic compounds or prodrugs, with other components, wherein the other components contain physiologically / pharmaceuticalally acceptable carriers and / or excipients.

[0308] The terms “enantiomer,” “diastereomer,” “racemate,” “tautomer,” “stereoisomer,” “geometric isomer,” “deuterated compound,” “nitrogen oxide,” “metabolite,” “pharmaceuticalally acceptable salt, ester, solvate, hydrate, isotopically labeled compound” have the meanings known in the art. In the term “deuterated compound,” deuteration can occur at any possible position on the compound, such as on the main chain, branches, and substituents, as long as the deuteration does not adversely affect the properties of the compound.

[0309] The term "medicinal salt" refers to (i) the salt formed by an acidic functional group (e.g., -COOH) present in the compounds provided by this invention and a suitable inorganic or organic cation (base), including but not limited to, alkali metal salts such as sodium, potassium, and lithium salts; alkaline earth metal salts such as calcium and magnesium salts; other metal salts such as aluminum, iron, zinc, copper, nickel, and cobalt salts; inorganic base salts such as ammonium salts; and organic base salts such as tert-octylamine, dibenzylamine, morpholine, glucosamine, phenylglycine alkyl ester, ethylenediamine, N-methylglucosamine, guanidine, diethylamine, triethylamine, dicyclohexylamine, N,N'-dibenzylethylenediamine, chloroprocaine, procaine, diethanolamine, N-benzyl-phenylethylamine, piperazine, tetramethylamine, and tris(hydroxymethyl)aminomethane. And (ii) the salts formed by the basic functional group (e.g., -NH2) present in the compounds provided by this invention and suitable inorganic or organic anions (acids), including but not limited to, hydrohalides such as hydrofluoric acid, hydrochloride, hydrobromide, hydroiodide, etc.; inorganic acid salts such as nitrates, perchlorates, sulfates, phosphates, etc.; lower alkyl sulfonates such as methanesulfonates, trifluoromethanesulfonates, ethanesulfonates, etc.; aryl sulfonates such as benzenesulfonates, p-benzenesulfonates, etc.; organic acid salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, maleates, etc.; amino acid salts such as glycine salts, trimethylglycine salts, arginine salts, ornithine salts, glutamate salts, aspartate salts, etc. See Handbook of Pharmaceutical Salts: Properties, Selection, and Use (P. Heinrich Stahl, 2002).

[0310] The compounds or salts of this invention may exist as enantiomers and diastereomers resulting from axial chirality or chiral centers. All such stereoisomers are part of this invention. Independent stereoisomers of the compounds of this invention may not coexist with other isomers (e.g., possessing special activity as a pure or substantially pure optical isomer), or may be mixtures, such as racemates, or mixtures formed with all other stereoisomers or a portion thereof.

[0311] The term "isotope derivative" refers to an isotopically labeled compound. Examples of isotopes that can be listed as compounds of the present invention include hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine isotopes, such as 2H, 3H, 13C, 11C, 14C, 15N, 18O, 17O, 31P, 32P, 35S, 18F, and 36Cl, respectively. In some embodiments, heavier isotopes, such as deuterium, i.e., 2H or D, are substituted, which may be preferred in certain cases due to their good metabolic stability, which is advantageous in some therapies, such as increasing the half-life or reducing the dosage in vivo. Isotopically labeled compounds can be prepared using general methods by replacing non-isotopic reagents with readily available isotopically labeled reagents, according to the schemes disclosed in the examples.

[0312] The term "prodrug" refers to a derivative of the compound that can be hydrolyzed, oxidized, or otherwise reacted under biological conditions (in vitro or in vivo) to provide the compound of the present invention. Prodrugs become active compounds only after undergoing the reaction under biological conditions, or they do not have or only have low activity in their unreacted forms. Prodrugs can generally be prepared using well-known methods, such as those described in Burger's Medicinal Chemistry and Drug Discovery (1995) 172-178, 949-982 (Manfred E. Wolff, 5th edition).

[0313] As used herein, the terms “tumor” and “cancer” have meanings known to those skilled in the art. Specifically, the term “tumor” refers to a mass or tissue that forms due to the abnormal proliferation of cells within the body after the loss of normal growth control mechanisms. These can be benign, slow-growing, and do not invade surrounding tissues or metastasize to distant sites; or they can be malignant, aggressive, and capable of invading surrounding tissues and metastasizing to other parts of the body via the blood and lymphatic system. In this article, a tumor can be a solid tumor, examples of which include benign solid tumors such as, but not limited to, leiomyomas, hemangiomas, lymphangiomas, and various adenomas and adenomatous polyps; and malignant solid tumors such as, but not limited to, Hodgkin's lymphoma, non-Hodgkin's lymphoma, lung cancer, breast cancer, colon cancer, rectal cancer, liver cancer, pancreatic cancer, osteosarcoma, chondrosarcoma, etc.; a tumor can also be a non-solid tumor, examples of which include, but are not limited to, leukemia (e.g., various types of leukemia, such as acute lymphoblastic leukemia, chronic myeloid leukemia, etc.), lymphoma (e.g., Hodgkin's lymphoma and non-Hodgkin's lymphoma), and glioma (e.g., glioma). "Cancer" refers to a malignant tumor.

[0314] The pharmaceutical compositions of the present invention may contain pharmaceutically acceptable excipients, including but not limited to: ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffering substances such as phosphates, glycerol, sorbic acid, potassium sorbate, a mixture of partial glycerides of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylate, beeswax, lanolin, etc.

[0315] "Pharmaceutically acceptable carriers" refer to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here refers to the ability of the components in the composition to interact with and be mixed with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as... Wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0316] "Pharmaceutically acceptable excipients" refer to substances that contribute to the formulation and / or administration and / or absorption of an active agent by an individual and can be included in the compositions disclosed herein without causing significant adverse toxicological effects on that individual. Non-limiting examples of pharmaceutically acceptable carriers and excipients include water, NaCl, aqueous physiological saline solutions, lactated Ringer's solution, conventional sucrose, conventional glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavorings, salt solutions (e.g., Ringer's solution), alcohols, oils, gelatin, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethyl cellulose, polyvinylpyrrolidone, and pigments. Such formulations can be sterilized and, if desired, mixed with adjuvants such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts affecting osmotic pressure, buffers, colorants, and / or aromatic substances that will not harmfully react with or interfere with the activity of the compounds provided herein. Those skilled in the art will recognize that other pharmaceutical carriers and excipients are suitable for the disclosed compounds.

[0317] In some embodiments, the pharmaceutical compositions of the present invention may be in solid or liquid form.

[0318] Drugs containing active ingredients can be in suitable oral dosage forms, such as tablets, pills, lozenges, water-soluble or oily suspensions, dispersed latex powders or granules, emulsions, hard or soft capsules, or syrups or elixirs. Orally administered drugs can be prepared according to known process methods of the drug ingredient manufacturer. These compositions may include one or more of the following agents: sweeteners, flavoring agents, coloring agents, and protective agents, to provide an elegant and palatable pharmaceutical formulation. Tablets contain the active ingredient mixed with non-toxic, pharmaceutically acceptable excipients suitable for tablet production. Examples of these excipients include inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate, or sodium phosphate; granulating agents, disintegrants such as corn starch or alginic acid; binding agents such as starch, gelatin, or gum arabic; and lubricants such as magnesium stearate, stearic acid, or talc. The tablet may be uncoated or coated to delay degradation and absorption in the gastrointestinal tract, thereby maintaining its activity over a longer period.

[0319] The pharmaceutical compositions of the present invention can be prepared in various forms according to different routes of administration. For example, the pharmaceutical compositions can be administered in any of the following ways: orally, by spray inhalation, rectal administration, nasal administration, buccal administration, vaginal administration, topical administration, and extra-intestinal administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intrasternal, and intracranial injection or infusion, or via an external implantation device. Oral or intravenous administration is preferred.

[0320] The compounds of this invention may optionally be used in combination with one or more other active ingredients, the amounts and proportions of which may be adjusted by those skilled in the art according to specific symptoms, patient conditions, and clinical needs. Combined use does not mean that the therapy or treatment agent must be administered simultaneously and / or formulated for joint delivery, although such delivery methods are within the scope of this invention. The combined therapeutic agent may be administered simultaneously, before, or after one or more other additional therapies or treatment agents. The therapeutic agent or treatment regimen may be administered in any order.

[0321] "Optional" or "optionally" means that the event or situation described below may but does not have to happen, and the description includes the circumstances under which the event or situation may or may not happen.

[0322] Examples and Test Cases

[0323] Part 1: Preparation of Compounds

[0324] Unless otherwise specified, the compounds used in the embodiments of this application are obtained through conventional commercial purchases. The abbreviations used in this application and their meanings are shown in Table 1.

[0325] Table 1. Abbreviations used in this application and their meanings

[0326]

[0327]

[0328] Preparation of raw materials and intermediates

[0329] (1) Preparation of 6-1

[0330]

[0331] Morpholine (56 mg, 643 μmol), 5-bromo-2-iodo-m-xylene (200 mg, 643 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (120 mg, 193 μmol), sodium tert-butoxide (185 mg, 1.9 mmol), and tris(dibenzylacetone)palladium (59 mg, 64 μmol) were dissolved in toluene (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 6-1-1 (30 mg, yield: 17%).

[0332] 6-1-1 (30 mg, 111 μmol), potassium acetate (22 mg, 222 μmol), pinacol diboronate (34 mg, 133 μmol), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (8 mg, 11 μmol) were dissolved in 1,4-dioxane (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 6-1 (14 mg, yield: 39%).

[0333] (2) Preparation of 7-1

[0334]

[0335] Morpholine (56 mg, 643 μmol), 2,5-dimethyl-4-bromoiodobenzene (200 mg, 643 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (120 mg, 193 μmol), sodium tert-butoxide (185 mg, 1.9 mmol), and tris(dibenzylideneacetone)palladium (59 mg, 64 μmol) were dissolved in toluene (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 7-1-1 (70 mg, yield: 40%).

[0336] 7-1-1 (70 mg, 259 μmol), potassium acetate (51 mg, 518 μmol), pinacol diboronate (79 mg, 311 μmol), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (19 mg, 26 μmol) were dissolved in 1,4-dioxane (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 7-1 (30 mg, yield: 36%).

[0337] (3) Preparation of 8-1

[0338]

[0339] Morpholine (16 mg, 186 μmol), 5-bromo-2-iodo-1-methoxy-3-methylbenzene (64 mg, 196 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (37 mg, 59 μmol), sodium tert-butoxide (38 mg, 392 μmol), and tris(dibenzylideneacetone)palladium (18 mg, 20 μmol) were dissolved in toluene (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 8-1-1 (28 mg, yield: 49%).

[0340] 8-1-1 (28 mg, 98 μmol), potassium acetate (19 mg, 196 μmol), pinacol diboronate (37 mg, 146 μmol), and [1,1'-bis(diphenylphosphino)ferrocene]palladium dichloride (9 mg, 9.8 μmol) were dissolved in 1,4-dioxane (3 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 8-1 (10 mg, yield: 30%).

[0341] (3) Preparation of 9-1

[0342]

[0343] 5-(4,4,5,5-tetramethyl-1,3,2-dioxoron-2-yl)indoline (200 mg, 816 μmol) was dissolved in DMF (10 mL). Sodium hydride (24 mg, 979 μmol) was added at 0 °C and stirred for 1 hour. Then, 3-bromomethyl-3-methyl-1-oxetane (135 mg, 816 μmol) was added and stirred for 5 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 9-1 (102 mg, yield: 37%).

[0344] (4) Preparation of 10-1

[0345]

[0346] 6-(4,4,5,5-tetramethyl-1,3,2-dioxaborhecyclopentan-2-yl)-1,2,3,4-tetrahydroquinoline (200 mg, 771 μmol) was dissolved in DMF (10 mL). Sodium hydride (55 mg, 926 μmol) was added at 0 °C and stirred for 1 hour. Then, 3-bromomethyl-3-methyl-1-oxetane (127 mg, 771 μmol) was added and stirred for 5 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and passed through a silica gel column to obtain 10⁻¹ (90 mg, yield: 35%).

[0347] (4) Preparation of 12-2

[0348]

[0349] (2) Preparation of 12-2

[0350] Commercially available raw material, 5-indoleboronic acid pinacol ester (1 g, 4.1 mmol), was dissolved in DMF (20 mL). Sodium hydride (128 mg, 5.6 mmol) was added at 0 °C and stirred for 1 hour. Then, 3-bromomethyl-3-methyl-1-oxetane (519 μL, 4.5 mmol) was added and the reaction was carried out for 10 hours. The reaction was monitored. After the reaction was completed, the mixture was filtered through a diatomaceous earth layer, washed with EA, and the filtrate was washed three times with water. The organic phase was dried over anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 5:1) to obtain 12-2 (870 mg, yield: 65%).

[0351] Example 1 Preparation of 1-(2-(4-(2,6-dimethylmorpholin-4-yl)-3-methylphenyl]-thiazo-4-yl)-3-(6-methylpyridin-3-yl)urea

[0352]

[0353] Synthetic route and method:

[0354]

[0355] (1) Preparation of intermediate 1-1

[0356] Commercially available raw material 5-bromo-2-iodotoluene (100 mg, 337 μmol) was dissolved in toluene (5 mL). Then, 2S,6S-dimethylmorpholine (45 μL, 337 μmol), 1,1'-binaphthyl-2,2'-bis(diphenylphosphine) (42 mg, 67 μmol), tris(dibenzylacetone)dipalladium (31 mg, 34 μmol), and sodium tert-butoxide (95 μL, 1.1 mmol) were added to the reaction flask. The mixture was purged with nitrogen three times and reacted at 100 °C for 10 hours. After the reaction was complete, the mixture was filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried over anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:10) to obtain 1-1 (27 mg, 28% yield).

[0357] (2) Preparation of intermediate 1-2

[0358] Dissolve 1-1 (27 mg, 95 μmol) in 1,4-dioxane (2 mL), add pinacol diboronate (27 mg, 105 μmol), 1,1-bis(diphenylphosphine)diberberine palladium dichloride (7 mg, 10 μmol), and potassium acetate (19 mg, 190 μmol) to the reaction flask, purge with nitrogen three times, and react at 100 °C for 10 hours. Monitor the reaction, and after completion, filter through a diatomaceous earth layer, wash with EA, wash the filtrate three times with water, dry the organic phase with anhydrous sodium sulfate, filter, and separate by silica gel column chromatography (EA:PE = 1:2) to obtain 1-2 (25 mg, 79% yield).

[0359] (3) Preparation of intermediates 1-3

[0360] Commercially available raw material 2-bromo-4-thiazolic acid (5.0 g, 24 mmol) was dissolved in toluene (20 mL), and diphenyl azidophosphate (9.9 g, 36 mmol) and triethylamine (3.7 mL, 29 mmol) were added. The mixture was purged with nitrogen three times, stirred at 100 °C for 1 hour, and then 5-amino-2-methylpyridine (2.9 g, 26 mmol) was added and the reaction was continued for 2 hours. After monitoring, the reaction was completed, filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried with anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:5) to obtain 1-3 (3.1 g, 41% yield).

[0361] (4) Preparation of Example 1

[0362] Intermediates 1-2 (34 mg, 103 μmol), 1-3 (30 mg, 96 μmol), tetra-triphenylphosphine palladium (11 mg, 10 μmol), and potassium carbonate (40 mg, 287 μmol) were dissolved in 1,4-dioxane (6 mL) and water (2 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 1 (11 mg, 24% yield).

[0363] 1 ¹H NMR (400MHz, methanol-d⁴) δ 8.52 (d, J = 2.7 Hz, 1H), 7.91 (dd, J = 8.5, 2.7 Hz, 1H), 7.74–7.66 (m, 2H), 7.25 (d, J = 8.5 Hz, 1H), 7.14 (s, 1H), 7.06 (d, J = 8.2 Hz, 1H), 4.22–4.10 (m, 2H), 3.00–2.92 (m, 2H), 2.74–2.66 (m, 2H), 2.48 (s, 3H), 2.38 (s, 3H), 1.35 (s, 3H), 1.33 (s, 3H); ESI-MS [M+H] + :438.2.

[0364] The preparation of Examples 2-13 was carried out in accordance with the synthesis method of Example 1, using the aliphatic amines in Table 2 to prepare the corresponding target compounds.

[0365] Table 2: Compounds from Examples 2 to 13

[0366]

[0367]

[0368]

[0369] Example 14 Preparation of 1-(2-(4-(3,6-dihydro-2H-pyran-4-yl)-3-methylphenyl)thiazolyl-4-yl)-3-(6-methylpyridin-3-yl)urea

[0370] Synthetic route and method:

[0371]

[0372] (1) Preparation of intermediate 2-1

[0373] 4-Bromo-3-methylphenylboronic acid (3.09 g, 14 mmol), 1-3 (5.00 g, 16 mmol), tetrakis(triphenylphosphine)palladium (1.84 g, 1.6 mmol), and potassium carbonate (6.62 g, 48 mmol) were dissolved in 1,4-dioxane (60 mL) and water (20 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and subjected to silica gel column chromatography (MeOH:DCM = 1:20) to give 2-1 (6.44 g, 59% yield).

[0374] (2) Preparation of Example 14

[0375] Intermediate 2-1 (57 mg, 273 μmol), 3,6-dihydro-2H-pyran-4-boronic acid (100 mg, 248 μmol), tetra-triphenylphosphine palladium (29 mg, 25 μmol), and potassium carbonate (103 mg, 744 μmol) were dissolved in 1,4-dioxane (6 mL) and water (2 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 14 (7 mg, 7% yield).

[0376] 1 ¹H NMR (600MHz, chloroform-d) δ 10.18 (s, 1H), 9.13 (s, 1H), 8.48 (s, 1H), 8.06 (dd, J = 8.4, 2.7Hz, 1H), 7.69–7.64 (m, 2H), 7.20–7.12 (m, 2H), 6.67 (s, 1H), 5.66 (s, 1H), 4.34–4.29 (m, 2H), 3.94 (t, J = 5.4Hz, 2H), 2.52 (s, 3H), 2.36 (s, 5H); ESI-MS [M+H] + :407.2.

[0377] The preparation of Examples 15-25 was carried out in accordance with the synthesis method of Example 14, using boric acid as the raw material in Table 3 to prepare the corresponding target compounds.

[0378] Table 3: Compounds from Examples 15-25

[0379]

[0380]

[0381]

[0382] Example 26 Preparation of 1-(2-(4-(2-dimethylaminoethoxy)-3-methylphenyl)thiazolyl-4-yl)-3-(6-methylpyridin-3-yl)urea

[0383]

[0384] Synthetic route and method:

[0385]

[0386] (1) Preparation of intermediate 3-1

[0387] Pinenoyl 3-methyl-4-hydroxyphenylboronic acid (632 mg, 2.7 mmol), 1-3 (1.00 g, 3.0 mmol), tetrakis(triphenylphosphine)palladium (346 mg, 0.3 mmol), and potassium carbonate (1.2 g, 9.0 mmol) were dissolved in 1,4-dioxane (30 mL) and water (10 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and subjected to silica gel column chromatography (MeOH:DCM = 1:10) to give 3-1 (525 mg, 48% yield).

[0388] (2) Preparation of Example 26

[0389] Intermediate 3-1 (26 mg, 76 μmol) was dissolved in DMF (3 mL), and anhydrous potassium carbonate (42 mg, 305 μmol) and commercially available raw material (2-bromomethyl)dimethylamine (12 mg, 76 μmol) were added. The mixture was reacted at 90 °C for 12 hours. After the reaction was complete, the mixture was filtered through a diatomaceous earth layer, eluted with ACN, dissolved under reduced pressure, and separated by Prep-HPLC to obtain Example 26 (13 mg, 38% yield).

[0390] 1 H NMR (400MHz, methanol-d4) δ9.33(d,J=2.6Hz,1H),8.72(dd,J=8.5,2.6Hz,1H),8.57–8.49(m,2H),8.06(d,J=8.4Hz,1H),7.93(s,1 H),7.80(d,J=8.3Hz,1H),5.03(t,J=5.3Hz,2H),3.79(t,J=5.3Hz,2H),3.31(s,6H),3.29(s,3H),3.09(s,3H); ESI-MS[M+H] + :412.4.

[0391] The preparation of Examples 27-39 was carried out in accordance with the synthesis method of Example 26, using the bromine derivatives in Table 4 to prepare the corresponding target compounds.

[0392] Table 4: Compounds from Examples 27-39

[0393]

[0394]

[0395]

[0396] Example 40 Preparation of 2-chloro-N-(2-methyl-4-(4-(3-(6-methylpyridin-3-yl)ureido)thiazolyl-2-yl)phenyl)acetamide

[0397]

[0398] Synthetic route and method:

[0399]

[0400] (1) Preparation of intermediate 4-1

[0401] 2-Methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborhexacyclopentan-2-yl)aniline (200 mg, 0.8 mmol), 1-3 (322 mg, 1.0 mmol), tetraphenylphosphine palladium (99 mg, 86 μmol), and potassium carbonate (355 mg, 2.6 mmol) were dissolved in 1,4-dioxane (30 mL) and water (10 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and subjected to silica gel column chromatography (MeOH:DCM = 1:10) to give 4-1 (120 mg, 41% yield).

[0402] (2) Preparation of Example 40

[0403] Intermediate 4-1 (30 mg, 88 μmol) and triethylamine (18 mg, 133 μmol) were dissolved in THF (3 mL). Chloroacetyl chloride (8.4 μL, 106 μmol) was added at 0 °C and stirred for 5 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried with anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 40 (12 mg, 31% yield).

[0404] 1H NMR (400MHz, methanol-d4) δ8.58(d,J=2.6Hz,1H),7.95(dd,J=8.5,2.7Hz,1H),7.84(s,1H),7.79(d,J=8.8Hz,1H),7.60(d, J=8.4Hz,1H),7.30(d,J=8.5Hz,1H),7.26(s,1H),4.29(s,2H),3.30(s,29H),2.51(s,3H),2.36(s,3H); ESI-MS[M+H] + :416.1.

[0405] The preparation of Example 41 was carried out in accordance with the synthesis method of Example 40, using the chlorinated starting materials in Table 5 to prepare the corresponding target compound.

[0406] Table 5: Compounds from Example 41

[0407]

[0408] Example 42 Preparation of 1-(2-(4-((1-hydroxycyclohexyl)ethynyl)-3-methylphenyl)thiazolyl-4-yl)-3-(6-methylpyridin-3-yl)urea

[0409]

[0410] Synthetic route and method:

[0411]

[0412] (1) Preparation of intermediate 5-1

[0413] Commercially available raw material 5-bromo-2-iodotoluene (200 mg, 673 μmol) was dissolved in DMF (5 mL). Then, 1-ethynylcyclohexanol (86 μL, 673 μmol), cuprous iodide (13 mg, 67 μmol), tetrakis(triphenylphosphine)palladium (78 mg, 67 μmol), and triethylamine (751 μL, 5.4 mmol) were added to the reaction flask. The mixture was purged with nitrogen three times and reacted at 100 °C for 10 hours. After the reaction was complete, the mixture was filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried over anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:10) to obtain 5-1 (115 mg, 58% yield).

[0414] (2) Preparation of intermediate 5-2

[0415] Dissolve 1-1 (115 mg, 392 μmol) in 1,4-dioxane (5 mL), add pinacol diboronate (100 mg, 392 μmol), 1,1-bis(diphenylphosphine)diberberine palladium dichloride (29 mg, 39 μmol), and potassium acetate (115 mg, 1.2 mmol) to the reaction flask, purge with nitrogen three times, and react at 100 °C for 10 hours. Monitor the reaction, and after completion, filter through a diatomaceous earth layer, wash with EA, wash the filtrate three times with water, dry the organic phase with anhydrous sodium sulfate, filter, and separate by silica gel column chromatography (EA:PE = 1:2) to obtain 5-2 (30 mg, 22% yield).

[0416] (4) Preparation of Example 42

[0417] Intermediates 5-2 (30 mg, 96 μmol), 1-3 (33 mg, 96 μmol), tetra-triphenylphosphine palladium (11 mg, 9.6 μmol), and potassium carbonate (40 mg, 287 μmol) were dissolved in 1,4-dioxane (6 mL) and water (2 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 42 (1.7 mg, 4% yield).

[0418] 1 ¹H NMR (600MHz, methanol-d⁴) δ 9.08 (d, J = 2.5Hz, 1H), 8.23 ​​(dd, J = 8.7, 2.5Hz, 1H), 7.85 (d, J = 1.8Hz, 1H), 7.77–7.72 (m, 2H), 7.48 (d, J = 8.1Hz, 1H), 7.39 (s, 1H), 2.70 (s, 3H), 2.52 (s, 3H), 2.06–2.02 (m, 2H), 1.84–1.78 (m, 2H), 1.72–1.62 (m, 5H); ESI-MS [M+H] + :447.2.

[0419] The preparation of Examples 43-45 was carried out in accordance with the synthesis method of Example 42, using the alkyne analogues in Table 6 to prepare the corresponding target compounds.

[0420] Table 6: Compounds from Examples 43-45

[0421]

[0422] Example 46 Preparation of 1-(2-(1H-indol-6-yl)thiazolyl-4-yl)-3-(6-methylpyridin-3-yl)urea

[0423]

[0424] Synthetic route and method:

[0425]

[0426] (1) Preparation of Example 46

[0427] Intermediates 1-3 (30 mg, 96 μmol), indole-6-borate pinacol ester (17 mg, 105 μmol), tetra-triphenylphosphine palladium (11 mg, 9.6 μmol), and potassium carbonate (40 mg, 287 μmol) were dissolved in 1,4-dioxane (6 mL) and water (2 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 46 (33 mg, 59% yield).

[0428] 1 H NMR (600MHz, methanol-d4) δ8.54(d,J=2.6Hz,1H),7.99(s,1H),7.93(dd,J=8.3,2.6Hz,1H),7.63–7.56(m,2H),7 .36(d,J=3.0Hz,1H),7.26(d,J=8.4Hz,1H),7.11(s,1H),6.50(d,J=3.1Hz,1H),2.48(s,3H); ESI-MS[M+H] + 350.1.

[0429] The preparation of Examples 47-60 was carried out in accordance with the synthesis method of Example 46, using the raw materials in Table 7 to prepare the corresponding target compounds.

[0430] Table 7: Compounds from Examples 47-60

[0431]

[0432]

[0433]

[0434] Example 61 Preparation of 1-(2-(3-methyl-4-morpholinylphenyl)thiazolyl-4-yl)-3-(p-tolyl)urea

[0435]

[0436] Synthetic route and method:

[0437]

[0438] (1) Preparation of intermediate 11-1

[0439] Commercially available raw material 2-bromo-4-thiazolic acid (200 mg, 961 μmol) was dissolved in toluene (6 mL), and diphenyl azidophosphate (397 mg, 1.4 mmol) and triethylamine (161 μL, 1.2 mmol) were added. The mixture was purged with nitrogen three times, stirred at 100 °C for 1 hour, and then p-toluidine (103 mg, 961 μmol) was added and the reaction was continued for another 2 hours. After monitoring, the reaction was completed, filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried with anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (MeOH:DCM = 1:30) to obtain 11-1 (125 mg, 42% yield).

[0440] (2) Preparation of Example 61

[0441] Intermediate 11-1 (35 mg, 112 μmol), 3-methyl-4-(4-morpholino)phenylboronic acid (27 mg, 123 μmol), tetrakis(triphenylphosphine)palladium (13 mg, 11 μmol), and potassium carbonate (46 mg, 336 μmol) were dissolved in 1,4-dioxane (6 mL) and water (2 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 61 (4 mg, 8% yield).

[0442] 1 H NMR (600MHz, methanol-d4) δ7.77(d,J=2.2Hz,1H),7.76–7.74(m,1H),7.36(d,J=8.4Hz,2H),7.15(d,J=3.1Hz,2H) ,7.15–7.13(m,2H),3.88(dd,J=5.8,3.3Hz,4H),3.00–2.98(m,4H),2.40(s,3H),2.32(s,3H); ESI-MS[M+H] + :409.2.

[0443] The preparation of Examples 62-75 was carried out in accordance with the synthesis method of Example 61, using the aromatic amines in Table 8 to prepare the corresponding target compounds.

[0444] Table 8: Compounds from Examples 62-75

[0445]

[0446]

[0447]

[0448] Preparation of Example 76 (S)-1-(2-(1-((3-methyloxetane-3-yl)methyl)-1H-indol-5-yl)thiazo-4-yl)-3-(piperidin-3-yl)urea, Example 77 (S)-1-(1-(2-(dimethylamino)ethyl)piperidin-3-yl)-3-(2-(1-((3-methyloxetane-3-yl)methyl)-1H-indol-5-yl)thiazo-4-yl)urea, and Example 79 (S)-1-(2-(1-((3-methyloxetane-3-yl)methyl)-1H-indol-5-yl)thiazo-4-yl)-3-(1-(vinylsulfonyl)piperidin-3-yl)urea

[0449]

[0450] Synthetic route and method:

[0451]

[0452] (1) Preparation of intermediate 12-1

[0453] Commercially available raw material 2-bromo-4-thiazolic acid (200 mg, 1.0 mmol) was dissolved in toluene (10 mL), and diphenyl azidophosphate (344 mg, 1.3 mmol) and triethylamine (218 μL, 1.6 mmol) were added. The mixture was purged with nitrogen three times, stirred at 100 °C for 1 hour, and then (S)-1-Boc-3-aminopiperidine (250 mg, 1.3 mmol) was added and the reaction was continued for 2 hours. After monitoring, the reaction was completed, filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried with anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:5) to obtain 12-1 (201 mg, 38% yield).

[0454] (2) Preparation of intermediate 12-3

[0455] Intermediates 12-1 (300 mg, 740 μmol), 12-2 (242 mg, 740 μmol), tetra-triphenylphosphine palladium (85 mg, 74 μmol), and potassium carbonate (307 mg, 2.2 mmol) were dissolved in 1,4-dioxane (30 mL) and water (10 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and 12-3 (150 mg, 38% yield) was obtained by Prep-HPLC.

[0456] (3) Preparation of Example 76

[0457] Intermediate 12-4 (150 mg, 740 μmol) was dissolved in DCM (10 mL), and TFA (5 mL) was added and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the product was directly dried to obtain Example 76 (100 mg, 76% yield).

[0458] 1 H NMR (600MHz, methanol-d4) δ8.13(d,J=1.7Hz,1H),7.73(dd,J=8.7,1.8Hz,1H),7.52(d,J=8.7Hz, 1H),7.33(d,J=3.2Hz,1H),6.96(d,J=2.5Hz,1H),6.60(d,J=3.2Hz,1H),4.72(d,J=6.0Hz, 2H),4.43(s,2H),4.35(d,J=6.0Hz,2H),4.01–3.95(m,1H),3.05–2.95(m,2H),2.15–2.10( m,1H),2.09–1.99(m,2H),1.89–1.81(m,1H),1.74–1.59(m,2H),1.29(s,3H); ESI-MS[M+H] + :426.1.

[0459] (4) Preparation of Example 77

[0460] Intermediate 12-4 (20 mg, 47 μmol) and N,N-dimethylaminobromoethane hydrobromide (11 mg, 47 μmol) were dissolved in DMF (3 mL) and potassium carbonate (26 mg, 188 μmol) was added. The mixture was stirred at 80 °C for 5 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 77 (12 mg, 31% yield).

[0461] 1H NMR (600MHz, methanol-d4) δ8.15–8.13(m,1H),7.73(dd,J=8.7,1.7Hz,1H),7.53(d,J=8.7Hz,1H), 7.34(d,J=3.1Hz,1H),6.93(s,1H),6.60(d,J=3.1Hz,1H),4.72(d,J=5.9Hz,2H),4.43(s,2H) ,4.36(d,J=5.8Hz,2H),3.92(s,1H),3.26–3.18(m,2H),2.97–2.88(m,6H),2.07–1.92(m,4H ),1.87–1.78(m,2H),1.54(d,J=5.3Hz,2H),1.29(s,3H),0.90(t,J=6.9Hz,2H); ESI-MS[M+H] + :497.3.

[0462] (5) Preparation of Example 78

[0463] Example 76 (20 mg, 47 μmol) and vinyl sulfonyl chloride (6 μL, 70 μmol) were dissolved in DCM (3 mL) and DIPEA (41 μL, 234 μmol) were added. The mixture was stirred at 80 °C for 5 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 78 (10 mg, 10% yield).

[0464] 1 H NMR (600MHz, methanol-d4) δ8.14(d,J=1.7Hz,1H),7.78(dd,J=8.6,1.7Hz,1H),7.53(d,J=8.7Hz,1H),7.31 (d,J=3.2Hz,1H),6.87(s,1H),6.68–6.60(m,2H),6.19(d,J=16.6Hz,1H),6.10(d,J=10.1Hz,1H),4.7 3(dd,J=6.0,1.1Hz,2H),4.43(s,2H),4.35(d,J=6.0Hz,2H),4.04–3.99(m,1H),3.37–3.31(m,2H),3 .14–3.07(m,2H),1.92–1.81(m,2H),1.76–1.68(m,1H),1.68–1.61(m,1H),1.29(s,3H); ESI-MS[M+H] + :516.2.

[0465] The preparation of Examples 79-82 was carried out using the same synthesis methods as Examples 77-78, and the corresponding target compounds were prepared using the raw materials listed in Table 9.

[0466] Table 9: Compounds from Examples 79-82

[0467]

[0468]

[0469] The preparation of Example 83 was carried out in accordance with the synthesis method of Example 77, using the corresponding raw materials in Table 10 to prepare the corresponding target compound.

[0470] Table 10: Compounds from Examples 83-84

[0471]

[0472]

[0473] The preparation of Examples 85-88 was carried out in accordance with the synthesis method of Example 76, using the raw materials in Table 11 to prepare the corresponding target compounds.

[0474] Table 11: Compounds from Examples 85-88

[0475]

[0476]

[0477] Example 89 Preparation of 1-(5-chloropyridin-2-yl)-3-(2-(1-((3-methyloxetane-3-yl)methyl)-1H-indol-5-yl)thiazolyl-4-yl)urea

[0478]

[0479] Synthetic route and method:

[0480]

[0481] (1) Preparation of intermediate 13-1

[0482] Commercially available raw material 2-bromo-4-thiazolic acid (1.0 g, 4.8 mmol) was dissolved in toluene (10 mL), and diphenyl azidophosphate (1.6 g, 5.8 mmol) and triethylamine (1.0 mL, 7.2 mmol) were added. The mixture was purged with nitrogen three times, stirred at 100 °C for 1 hour, and then 2-amino-5-chloropyridine (680 mg, 5.3 mmol) was added and the reaction was continued for 2 hours. After monitoring, the reaction was completed, filtered through a diatomaceous earth layer, washed with DCM, and the filtrate was washed three times with water. The organic phase was dried with anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:5) to obtain 13-1 (500 mg, 31% yield).

[0483] (2) Preparation of Example 89

[0484] Intermediates 13-1 (20 mg, 92 μmol), 12-2 (30 mg, 92 μmol), [1,1'-bis(diphenylphosphine)ferrocene]palladium dichloride (6.7 mg, 9.2 μmol), and potassium carbonate (38 mg, 275 μmol) were dissolved in 1,4-dioxane (3 mL) and water (1 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 89 (20 mg, 48% yield).

[0485] 1 H NMR (600MHz, methanol-d4) δ7.61–7.57(m,2H),6.83(s,1H),6.50(d,J=8.3Hz,1H),4.62(d,J=5.8Hz,2H),4.41(d,J=5.8Hz,2H),3.99–3.93(m,2H), 3.34(s,2H),3.05(d,J=8.4Hz,2H),3.03–3.00(m,2H),3.00–2.95(m,2H),2.19(t,J=7.6Hz,2H),2.03–2.01(m,2H),1.41(s,3H); ESI-MS[M+H] + :428.2.

[0486] The preparation of Example 90 was carried out in accordance with the synthesis method of Example 89, using the aromatic amines listed in Table 12 to prepare the corresponding target compound.

[0487] Table 12: Compounds from Example 90

[0488]

[0489] Example 91 Preparation of 5-(4-(3-(6-methylpyridin-3-yl)ureido)thiazolyl)-2-morpholinobenzamide

[0490]

[0491] Synthetic route and method:

[0492]

[0493] (1) Preparation of intermediate Example 91

[0494] Example 49 (15 mg, 37 μmol) was dissolved in concentrated sulfuric acid (1 mL), and the mixture was stirred at 50 °C for 16 hours until the reaction was complete. Prep-HPLC yielded Example 91 (10 mg, 61% yield).

[0495] 1 H NMR (600MHz, methanol-d4) δ8.56(d,J=2.8Hz,1H),8.33(d,J=2.3Hz,1H),8.01(dd,J=8.4,2.4Hz,1H),7.92(dd,J=8.4,2.7Hz,1H) ,7.29(d,J=8.5Hz,1H),7.26(d,J=8.4Hz,1H),7.23(s,1H),3.89–3.85(m,4H),3.11–3.08(m,4H),2.49(s,3H); ESI-MS[M+H] + :439.2.

[0496] Example 92 Preparation of 2-(2-(3-methyl-4-morpholinylphenyl)thiazolyl-4-yl)-N-(6-methylpyridin-3-yl)acetamide

[0497]

[0498] Synthetic route and method:

[0499]

[0500] (1) Preparation of intermediate 14-1

[0501] Commercially available 2-bromo-4-thiazolylacetic acid (50 mg, 225 μmol), 5-amino-2-methylpyridine (29 mg, 270 μmol), HATU (102 mg, 270 μmol), and DIPEA (118 μL, 675 μmol) were dissolved in DMF (12 mL) and stirred at room temperature for 12 hours. The reaction was monitored by TLC. After the reaction was complete, the mixture was diluted with water and extracted three times with EA. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and separated by silica gel column chromatography (EA:PE = 1:10) to obtain 14-1 (45 mg, 64% yield).

[0502] (2) Preparation of Example 92

[0503] 14-1 (40 mg, 128 μmol), 3-methyl-4-(4-morpholino)phenylboronic acid (39 mg, 128 μmol), tetrakis(triphenylphosphine)palladium (15 mg, 13 μmol), and potassium carbonate (53 mg, 384 μmol) were dissolved in 1,4-dioxane (3 mL) and water (1 mL). The mixture was substituted with N2 three times, heated to 100 °C under N2 atmosphere, and stirred for 12 hours. The reaction was monitored by TLC. After the reaction was completed, the mixture was diluted with water, extracted three times with EA, and the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and Prep-HPLC was used to obtain Example 92 (15 mg, 26% yield).

[0504] 1 H NMR (600MHz, chloroform-d) δ9.76(s,1H),8.43–8.39(m,1H),8.14(dd,J=8.6,2.7Hz,1H),7.80–7.77(m,2H),7.12(d,J=8.4 Hz,1H),7.10–7.06(m,2H),3.90–3.87(m,6H),2.99(dd,J=5.5,3.6Hz,4H),2.50(s,3H),2.40(s,3H); ESI-MS[M+H] + :409.2.

[0505] Part Two: Activity Testing

[0506] Test Example 1: Compound Enzyme Activity Test

[0507] 1. Experimental objective:

[0508] The purpose of this experiment was to test the ability of the compound of this invention to inhibit the activity of the Polθ polymerase domain. DNA templates and primers were mixed in a 1:1 ratio and heated at 95°C for 5 minutes in annealing buffer, followed by slow cooling to room temperature to obtain substrate DNA. Polθ polymerase was then incubated with the substrate DNA and the compound for 20 minutes. dNTPs were added to initiate the reaction, and the reaction was terminated. Excitation and emission wavelengths of 480 / 520 nm were selected on a full-function microplate reader (SynergyNeo2) to read the data. The IC50 values ​​were obtained by four-parameter fitting of the data. 50 The values ​​were used to determine the inhibitory activity of the compound against Polθ polymerase.

[0509] 2. Experimental Materials and Equipment

[0510] 1) Materials

[0511] Primer: GACCGGGAAGG (SEQ ID NO: 1) (Shanghai Sangon Biotech)

[0512] Template: CCTTCCTCCCGTGTCTTGTAGTGTCTTGTAGTGTCTTGTACCTTCCCGTCA (SEQ ID NO: 2) (Shanghai Sangon Biotech)

[0513] 2) Reagents, manufacturers and product numbers

[0514] Tris HCl pH 7.5, Shanghai Bio-tech, #B548124-0005

[0515] NaCl, Shanghai Sangon Biotech, #A501218-0001

[0516] MgCl2, Sigma-Aldrich, #M1028-100ML

[0517] Glycerol, Sigma-Aldrich, #G5516

[0518] Triton-X100, Sigma-Aldrich, #1001128254

[0519] BSA, Sigma-Aldrich, #v900933-100G

[0520] DTT, Diamond, #A100281-0005

[0521] PicoGreen, invitrogen, #P7589

[0522] 3) Consumables and their part numbers

[0523] Assay plate: 384-well plate, Greiner, #784076

[0524] Compound plate: 384-well full-skirted plate, Axygen, #PCR-384-C

[0525] 4) Equipment and Model

[0526] Liquid Handler, Bravo

[0527] Full function microhole plate detector,SynergyNeo2

[0528] Pipettes: Eppendorf, 3125000010, 3123000225

[0529] Centrifuge: Eppendorf, 5810R

[0530] Ultrapure water system: Milli-Q Direct 16

[0531] Refrigerators: Meiling, YC-725L, DW-YL450

[0532] 3. Experimental Procedure

[0533] 1) The Polθ polymerase fragment (1819-2590) was expressed in E. coli and the target protein with a purity of >90% was obtained. After aliquoting, it was stored in a -80℃ freezer for later use.

[0534] 2) The reaction was carried out in a buffer system (25mM Tris-HCl pH 7.5, 12.5mM NaCl, 0.5mM MgCl2, 5% glycerol, 0.01% Triton-X100, 0.01% BSA, 1mM DTT) and terminated in TE buffer (10mM Tris-HCl, 1mM EDTA, pH 7.5).

[0535] 3) DNA substrate: Mix template 5′-CCTTCCTCCCGTGTCTTGTAGTGTCTTGTAGTGTCTTGTACCTTCCCGTCA-3′ with primer 5′-GACGGGAAGG-3′ in an equimolar ratio, heat in annealing buffer (10mM Tris, pH 7.5-8.0, 50mM NaCl) at 95°C for 5 minutes, and then slowly cool to room temperature.

[0536] 4) Experimental Procedure

[0537] The compound was dissolved in DMSO to a concentration of 10 mM. The compound was serially diluted 3-fold to select 11 test concentrations. 1.2 μL of the compound was taken with Bravo and added to a 384-well compound dilution plate (Axygen, #PCR-384-C) containing 28.8 μL of reaction buffer. 1.2 μL of DMSO was added to the positive control and negative control wells. The highest concentration of the compound in the reaction system was 10 μM, and the content of DMSO in the reaction system was 1%. Using Bravo, 5 μL of Polθ protein, DNA substrate, and the compound were sequentially added to a reaction plate (greiner, #784076) (final concentration of Polθ protein: 1.5 nM; final concentration of DNA substrate: 50 nM). The plate was incubated at room temperature for 20 minutes. Then, 5 μL of dNTP (final concentration: 40 μM) was added, and the plate was incubated at 30°C for 45 minutes. Finally, 5 μL of 5× PicoGreen diluted in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) was added to the reaction wells (final concentration of PicoGreen: 1×). The reaction was terminated by shaking and incubating at room temperature for 10 minutes. After incubation, the reaction signal was measured and recorded at 480 / 520 nm using a full-function microhole plate detector. The IC50 of the compound was also recorded. 50 The value is determined by a four-parameter fitting equation.

[0538] The test results are listed in Table 13.

[0539] Table 13: Inhibitory activity of the compounds of the present invention against POLQ polymerase (IC50) 50 )

[0540] compound <![CDATA[IC 50 ]]> compound <![CDATA[IC 50 ]]> compound <![CDATA[IC 50 ]]> 1 B 32 C 72 B 4 B 33 B 73 A 5 B 34 C 74 B 7 B 35 C 75 B 8 B 59 B 76 A 10 C 61 C 77 B 11 C 63 B 79 B 12 B 64 B 83 A 13 B 66 C 85 A 14 B 67 B 86 C 15 C 68 B 24 C 69 C 25 C 70 B 31 B 71 C

[0541] Where A≤100nM; 100nM <B≤500nΜ;500nΜ<C≤1μΜ。

[0542] As can be seen from the above, the compounds of the present invention have a strong inhibitory effect on POLQ polymerase and can be used as drugs for treating diseases related to Polθ expression or high expression.

[0543] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A compound of formula (I) or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated derivative, nitrogen oxide, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug thereof, in: Ring A is selected from 6-10 aryl, 5-10 heteroaryl, 5-10 heterocyclic, C5-10 carbocyclic, and fused bicyclic heteroaryl composed of 8-18 ring atoms. Preferably, ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl composed of 8-18 ring atoms. Optionally, ring A is separated by one or more R atoms. A replace; One or more R A They may be the same or different, and each is independently selected from deuterium, halogens (e.g., F, Cl, Br, or I), oxo (=O), -SF5, hydroxyl, cyano, nitro, C1-10 alkyl, C1-10 haloalkyl, C3-10 cycloalkyl, C3-10 cycloalkoxy, C1-10 alkoxy, C2-10 alkenyl, C2-10 alkynyl, -L 1 -C1-10 alkyl, -L 1 -C2-10 alkenyl, -L 1 -C2-10 Alkynyl, -NRaRb, -CONRaRb, -L 1 -NRaRb、-L 1 -CONRaRb, -CORa, -L 1 -CORa-, -COORa, -L 1 -COORa and -L 1 -C1-10 alkoxy group, where L 1 The components are selected from C1-10 alkylene groups, -SO2- and -CO- and any combination thereof, preferably selected from methylene, ethylene, propylene, butylene, -SO2- and -CO- and any combination thereof; Q is a divalent linker, preferably selected from -O-, -SO-, -SO2-, -CO-, -NH-, -CH2-, and any combination thereof; X, Y, and Z are each independently O, S, N, or CH, and Indicates a single bond or a double bond; R1 is selected from -H, deuterium, halogen, -SF5, hydroxyl, cyano, nitro, C1-10 alkyl, C1-10 haloalkyl, -NRaRb, CONRaRb, -C1-10 alkoxy, -C2-10 alkenoxy, -C2-10 alkynoxy, -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-10 alkoxy group, -L 2 -C1-10 alkyl, -L 2 -C2-10 alkenyl, -CORa, -L 2 -CORa-, -COORa, -L 2 -COORa、-L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10-membered heteroaryl, C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10-membered heterocyclic and 5-10-membered heteroaryl, of which L 2 Selected from -O-, -NHCO-, -NHSO2-, C1-10 alkylene, C1-10 alkenylene, C1-10 ynylene, and any combination thereof; optionally, R1 is separated by one or more R B replace; One or more R B They may be the same or different, and each is independently selected from -OH, -CN, -SF5, halogen, nitro, amino, C1-5 alkyl, C1-5 alkoxy, C1-5 haloalkyl, C1-5 haloalkoxy, hydroxy-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy and C3-10 cycloalkyl; R2 and R3 are each independently selected from: -H, deuterium, -CN, -SF5, hydroxyl, nitro, halogen (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 alkoxy, NRaRb, -CONRaRb, -CORa, -L 2 -CORa-, -COORa, -L 2 -COORa and 3-10 membered heterocyclic groups; optionally, R2 and R3 are separated by one or more R C replace; One or more R C They may be the same or different, and each is independently selected from C1-5 alkyl groups; n is 0, 1, 2 or 3, and when n is 2 or 3, each R3 is the same or different; Alternatively, R1 and R2, together with the benzene rings they are connected to, form a cyclic β-benzene ring, wherein ring B is selected from a C3-10 carbon ring, a 3-10 membered heterocycle, or a 5-10 membered heteroaromatic ring, preferably selected from a 3-10 membered heterocycle or a 5-10 membered heteroaromatic ring; optionally, ring B is surrounded by one or more R... D replace; One or more R D The same or different, and each independently selected from -OH, -CN, -SF5, halogen (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 haloalkyl, C1-5 alkoxy, C1-5 haloalkoxy, hydroxy-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy, C3-10 cycloalkyl, -3-10 heterocyclic, C1-5 alkylene-3-10 heterocyclic, optionally, R D Further substituted with C1-5 alkyl groups; and Ra and Rb are each independently selected from -H, C1-6 alkyl groups (e.g., methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, and tert-butyl).

2. The compound according to claim 1 or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein one or more of the R... A Each is independently selected from -F, -Cl, C1-5 alkyl, C1-5 haloalkyl, C1-5 alkoxy, -L 1 -C1-5 alkyl, -L 1 -C2-5 alkenyl, -L 1 -NRaRb、-L 1 -CONRaRb and -L 1 -C1-5 alkoxy group.

3. The compound according to any one of claims 1-2, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein one or more of the R... A Each is independently selected from -F, -Cl, -CH3, -OCH3, -CF3, -CH2-CH2-N(CH3)2, -SO2-CH=CH2, -CH2-CO-NH2, -CO-CH=CH2, -CO-CH3, and -CH2-CH2-OCH3.

4. The compound according to any one of claims 1-3, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein ring A is selected from phenyl, 5-6-membered heteroaryl, 5-6-membered heterocyclic groups, and... The structure is represented by J, where each J is independently N or C; each K is independently N, NH, CH, or CH2; where This indicates that the ring is an aromatic ring, and This indicates that adjacent atoms on the ring form single or double bonds, or that the ring is an aromatic ring.

5. The compound according to any one of claims 1-4, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein ring A is selected from...

6. The compound according to any one of claims 1-5, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated derivative, nitride, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein ring A is selected from...

7. The compound according to any one of claims 1-6, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein... Selected from: Choose any location It is substituted with a substituent selected from deuterium, C1-5 alkyl, C1-5 haloalkyl, halogen, hydroxyl, cyano, -SF5, and C1-5 alkoxy.

8. The compound according to any one of claims 1-7, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein one or more of the R... B Each is independently selected from -OH, -CN, -F, -Cl, -Br, -I, C1-3 alkyl, C1-3 alkoxy, C1-3 haloalkyl, C1-3 haloalkoxy, hydroxy-substituted C1-3 alkyl, C1-5 alkylene-C1-3 alkoxy, and C3-7 cycloalkyl.

9. The compound according to any one of claims 1-8, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein one or more of the R... B Each is independently selected from -OH, -CN, -F, -Cl, -CH3, -CF3, -CH2OCH3, cyclopropyl, and cyclobutyl.

10. The compound according to any one of claims 1-9, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein L 2 Selected from -O-, -NHCO-, -NHSO2-, C1-4 alkylene, C2-4 alkenylene, C2-4 ynylene and any combination thereof.

11. The compound according to any one of claims 1-10, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein L 2 Selected from -O-, -NHCO-, -NHSO2-, methyleneoxy, ethoxy, propoxy, and ethynyl.

12. The compound according to any one of claims 1-11, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R1 is selected from -C1-10 alkoxy, -C2-10 alkynoxy; -L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10 heteroaryl; C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10 heterocyclic and 5-10 heteroaryl.

13. The compound according to any one of claims 1-12, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R1 is selected from -N(CH3)(C3H7), preferably. Methoxy, ethoxy, propoxy, butoxy, and propyneoxy, preferably L 2 -N(CH3)2、-L 2 -CON(CH3)2、-L 2 -Methoxy group, -L 2 -methyl, -L 2 -propyl, -L 2 -Vinyl, -L 2 -Cyclopropyl, -L 2 -Cyclohexyl, -L 2 -oxoheterobutyl, -L 2 -oxetyl-L 2 -oxecyclohexyl and -L 2 -pyridyl, preferably, 14. The compound according to any one of claims 1-13, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R1 is selected from:

15. The compound according to any one of claims 1-12, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R1 is selected from...

16. The compound according to any one of claims 1-12, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R1 is selected from:

17. The compound according to any one of claims 1-16, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein R2 and R3 are each independently selected from -F, -Cl, -Br, -I, -CN, -CONH2, C1-3 alkyl, C1-3 alkoxy, and 3-7 membered heterocyclic groups; preferably, R2 and R3 are each independently selected from -F, -CN, -CH3, -CONH2, -OCH3, ...

18. The compound according to any one of claims 1-17, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitride, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein one or more of the R... D Each is independently selected from -F, -Cl, -Br, -I, C1-3 alkyl, C1-3 haloalkyl, C1-3 alkoxy, C1-3 haloalkoxy, hydroxy-substituted C1-3 alkyl, C1-5 alkylene-C1-3 alkoxy, C3-7 cycloalkyl, 3-7 membered heterocyclic group, and C1-5 alkylene-3-7 membered heterocyclic group.

19. The compound according to any one of claims 1-18, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein one or more of the R... D Each independently selected 20. The compound according to any one of claims 1-19, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein the compound of formula (I) is a compound of formula (I-1): in: Rings A, Q, X, Y, and Z are defined in compounds of formula (I) as described in any one of claims 1-19, wherein ring B is selected from 5-6 membered heterocycles or 5-6 membered heteroaromatic rings, optionally, ring B is separated by one or more R D replace.

21. The compound of claim 20 or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated derivative, nitride, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug thereof, wherein ring B is selected from...

22. The compound according to any one of claims 20-21, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein... Selected from 23. The compound according to any one of claims 20-22, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein... Selected from 24. The compound according to any one of claims 1-19, or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein ring A is selected from 6-10 aryl, 5-10 heteroaryl, and fused bicyclic heteroaryl consisting of 8-18 ring atoms, and wherein when R2 and R3 are H, R1 is selected from C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10 heterocyclic, and 5-10 heteroaryl; When R2 is not H, R1 is selected from -H, -NRaRb, -C1-10 alkoxy, -C2-10 alkynoxy; -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group, -L 2 -5-10-membered heteroaryl; C3-10 cycloalkyl, C3-10 cycloalkenyl, 3-10-membered heterocyclic and 5-10-membered heteroaryl, wherein L 2 Selected from -O-, -NHCO-, -NHSO2- and ethynylene groups; optionally, R1 is separated by one or more R groups. B replace; Alternatively, R1 can be selected from -L 2 -NRaRb、-L 2 -CONRaRb、-L 2 -C1-5 alkoxy group, -L 2 -C1-5 alkyl, -L 2 -C2-5 alkenyl, -L 2 -C3-10 cycloalkyl, -L 2 -3-10 heterocyclic group and -L 2 -5-10 aryl aromatic compounds, of which L 2 Selected from methyleneoxy, ethoxy, and propoxy; and optionally, R1 is substituted with a C1-5 alkyl group that is substituted with a hydroxyl group; R2 is selected from -CN, -F, C1-5 alkyl, -CONRaRb and 3-10 membered heterocyclic groups, and R3 is selected from -CN, -F, Br, I, C1-5 alkyl, C1-5 alkoxy, -CONRaRb and 3-10 membered heterocyclic groups; optionally, R2 and R3 are separated by one or more R C replace; One or more R C They may be the same or different, and each is independently selected from C1-5 alkyl groups; n is 0, 1, 2 or 3, and when n is 2 or 3, each R3 is the same or different; Alternatively, R1 and R2, together with the benzene rings they are connected to, form a cyclic B-benzene ring, wherein ring B is selected from 3-10 membered heterocycles or 5-10 membered heteroaromatic rings; optionally, ring B is surrounded by one or more R... D replace; One or more R D The same or different, and each independently selected from -OH, -CN, halogens (e.g., F, Cl, Br or I), C1-5 alkyl, C1-5 haloalkyl, hydroxyl-substituted C1-5 alkyl, C1-5 alkylene-C1-5 alkoxy, C3-10 cycloalkyl, and C1-5 alkylene-3-10 heterocyclic groups, optionally, R D Further substituted with C1-5 alkyl groups; and Ra and Rb are each independently selected from -H, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, and tert-butyl.

25. The compound according to any one of claims 1-19, or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitrogen oxide, metabolite, or pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound, or prodrug thereof, wherein the compound of formula (I) is a compound of formula (I-1). in: Cycloar Ar is selected from 5-10 membered heteroaryl groups and fused bicyclic heteroaryl groups consisting of 8-18 ring atoms; optionally, cycloar Ar is separated by one or more R groups. A replace; One or more R A They may be the same or different, and each is independently selected from halogens (e.g., -F, -Cl, -Br), C1-5 alkyl and C1-5 alkoxy; Q is a divalent linker, preferably -NH- or -CH2-; X, Y, and Z are each independently O, S, N, or CH, and Indicates a single bond or a double bond; R2 is selected from C1-5 alkyl groups; Ra is selected from C1-5 alkyl and C1-5 haloalkyl; m is 0, 1, 2, or 3; and p is 1, 2, 3, 4 or 5.

26. The compound of claim 1 or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs, wherein the compound of formula (I) is selected from the group consisting of:

27. The compound of claim 1 or its enantiomers, diastereomers, racemates, tautomers, stereoisomers, geometric isomers, deuterated derivatives, nitrogen oxides, metabolites, or pharmaceutically acceptable salts, esters, solvates, hydrates, isotopically labeled compounds, or prodrugs thereof, wherein the compound of formula (I) is selected from the following compounds:

28. A pharmaceutical composition comprising the compound of any one of claims 1-27 or an enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitride, metabolite or a pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug thereof.

29. The pharmaceutical composition of claim 28, wherein the pharmaceutical composition is used to treat and / or prevent diseases associated with Polθ expression or high expression.

30. The pharmaceutical composition of claim 29, wherein the disease associated with Polθ expression or high expression is cancer, preferably, the cancer is selected from esophageal cancer, cervical cancer, breast cancer, ovarian cancer, advanced serous ovarian cancer, lung cancer, pancreatic cancer, and prostate cancer.

31. Use of the compound or its enantiomer, diastereomer, racemate, tautomer, stereoisomer, geometric isomer, deuterated product, nitride, metabolite or its pharmaceutically acceptable salt, ester, solvate, hydrate, isotopically labeled compound or prodrug, and the pharmaceutical composition of any one of claims 28-30 in the preparation of a medicament for treating and / or preventing diseases associated with Polθ expression or high expression.

32. The use according to claim 31, wherein the disease associated with Polθ expression or high expression is cancer, preferably, the cancer is selected from esophageal cancer, cervical cancer, breast cancer, ovarian cancer, advanced serous ovarian cancer, lung cancer, pancreatic cancer, and prostate cancer.