A laurocephala and application thereof in preventing and treating broadleaf weeds and gramineous weeds

By screening and applying *Ilex chinensis* and its inoculants and metabolites, the problems of resource scarcity and insufficient selectivity in the control of broadleaf weeds have been solved, achieving efficient biological control of broadleaf weeds and reducing environmental risks.

CN122104436APending Publication Date: 2026-05-29NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610148304.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-03
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing technologies for controlling broadleaf weeds lack microbial resources, have unstable pathogenicity and insufficient crop selectivity, and chemical herbicides cause prominent environmental pollution and resistant weed problems.

Method used

The *Calonectria ilicicola* and its inoculants were screened and applied. Conidia and ascospore liquids were prepared by fermentation, and the metabolite 7α-hydroxytrichodermol was used to control broadleaf and grass weeds.

Benefits of technology

The holly scab exhibits significant pathogenicity against a variety of broadleaf weeds, with good selectivity, is safe for crops, reduces the use of chemical pesticides, lowers environmental residues and the risk of pesticide resistance, and meets the needs of green agriculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104436A_ABST
    Figure CN122104436A_ABST
Patent Text Reader

Abstract

The application belongs to the field of biological weed control, and discloses a Calonectria ilicicola and application thereof in weed control. The Calonectria ilicicola is mainly used for the prevention and treatment of broadleaf weeds in agricultural production, and also shows pathogenic activity to some common grass weeds. The Calonectria ilicicola and metabolites thereof can cause diseases to various broadleaf weeds and some grass weeds, and have strong pathogenicity, so that target weeds such as Alternanthera philoxeroides and Ageratina adenophora can be effectively controlled. In addition, a metabolite 7α-hydroxytrichodermol is identified in the fermentation liquor of the fungus, and the metabolite also has pathogenic activity and can be used as an auxiliary or independent weed control active ingredient. The Calonectria ilicicola is safe to the environment, has certain selectivity and a wide herbicidal spectrum, and has the application potential of being developed into a biological herbicide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural plant protection and microbial control technology, specifically relating to Calonectria ilicicola and its application in controlling broadleaf weeds and grass weeds. Background Technology

[0002] Weeds are a significant limiting factor in agricultural production, affecting crop growth, yield formation, and resource competition. Among them, broadleaf weeds are prevalent in farmland, orchards, and woodlands, causing widespread damage and exhibiting strong competitive capabilities, thus becoming a prominent problem for the development of green agriculture. Invasive alien weeds such as *Alternanthera philoxeroides* and *Ageratina adenophora* have spread widely in many parts of my country, characterized by rapid reproduction, vigorous growth, and strong adaptability, posing a serious threat to the stability of agricultural ecosystems.

[0003] Currently, the control of broadleaf weeds mainly relies on chemical herbicides. However, long-term and excessive application can easily lead to the emergence of resistant weeds and cause a series of problems such as environmental pollution, crop damage, agricultural product residues, and harm to non-target organisms, thus limiting their application prospects in green and sustainable agriculture. In contrast, microbial bioherbicides, due to their advantages such as environmental friendliness, high safety, clear targets, and low likelihood of inducing resistance, are gradually becoming an important research direction in integrated weed management. However, the resources of highly efficient microorganisms for controlling broadleaf weeds are still relatively scarce, and the number of dominant pathogenic strains capable of selectively infecting target weeds is limited.

[0004] Calonectria is a group of highly pathogenic fungi in the fungal kingdom, with some members capable of infecting various plant tissues. Although studies have reported its association with plant diseases, its application in the field of weed biocontrol is still limited, lacking superior strains that can target broadleaf weeds while also exhibiting high selectivity for crops. Therefore, there is an urgent need to screen for a highly pathogenic, stable, and ecologically safe Calonectria strain of *Ilex holly* to provide new strain resources for the green control of broadleaf weeds and the development of biological herbicides. Summary of the Invention

[0005] The purpose of this invention is to provide a Calonectria ilicicola strain that can efficiently infect broadleaf weeds or grass weeds, is of safe origin, eco-friendly, and has good selectivity. It also provides screening methods, prepared microbial agents and herbicides, and their application in controlling broadleaf and grass weeds, in order to solve the problems of insufficient resources, unstable pathogenicity, and insufficient crop selectivity of existing microbial herbicides.

[0006] The technical solution provided by this invention is as follows:

[0007] A species of Calonectria ilicicola, deposited on November 18, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, is classified and named Calonectria ilicicola, with accession number CGMCC No. 42372.

[0008] A microbial agent containing the above-mentioned *Ilex rubrum* or its mycelium, conidia, ascospores, and fermentation metabolites.

[0009] The present invention also provides the application of the above-mentioned *Ilex chinensis* or the above-mentioned fungal agent in the control of weeds.

[0010] The present invention also provides the application of the above-mentioned *Ilex chinensis* or the above-mentioned fungal agent in the control of broadleaf weeds and grass weeds.

[0011] Furthermore, the aforementioned *Ilex crenata* or the aforementioned fungal agent can be sprayed onto the plant leaves or used for root irrigation.

[0012] Furthermore, the weeds are at least one of the following: Alternanthera philoxeroides, Ageratina adenophora, Chenopodium album L., Cynanchum rostellatum, Vicia sativa L., Acalypha australis L., Trifolium repens L., Cirsium arvense, Arthraxon hispidus, Commelina communis, Digitaria sanguinalis, Ammannia arenaria, Sympyotrichum subulatum, Poa annua, Solidago canadensis, Erigeron sumatrensis, and Humulus scanden.

[0013] The present invention also provides the use of the above-mentioned *Ilex rubrum* or the above-mentioned fungal agent in the preparation of the metabolite 7α-hydroxytrichodermol.

[0014] The present invention also provides a herbicide comprising the above-mentioned *Ilex rubrum* and / or its metabolites and / or the above-mentioned fungal agent.

[0015] Furthermore, the concentration of conidia and / or ascospores of *Ilex rubrum* in the herbicide is not less than 10. 5 cfu / mL.

[0016] Furthermore, the method for preparing the herbicide includes: fermenting or inducing the *Ilex rubrum* strain according to claim 1 to obtain fermentation broth or ascocarps; filtering the fermentation broth or ascocarp fragments to remove mycelium; diluting to obtain spore liquid; and preparing the spore liquid as a herbicide.

[0017] Furthermore, the metabolite is 7α-hydroxytrichodermol.

[0018] Preferably, the bacterial agent is any one of the dosage forms such as liquid, solid, microcapsule, or suspension, and more preferably a liquid bacterial agent.

[0019] The present invention further provides a herbicide comprising the above-mentioned strain and / or the above-mentioned inoculant, which can be formulated with conventional agricultural adjuvants for the control of broadleaf weeds and grass weeds. Preferably, the herbicide contains at least 10 conidia or sexual spores of *Ilex rubrum*. 5 cfu / mL.

[0020] The method for preparing the herbicide includes: culturing *Ilex pubescens* strain 6a-H-2 in a liquid fermentation system to obtain a fermentation broth; removing mycelium by filtration; and adjusting the concentration as needed to obtain a conidial solution or a sexual spore solution prepared by breaking ascothecia.

[0021] Preferably, the fermentation conditions include: an inoculum size of at least one 3 mm diameter mycelium cake per 200 mL culture medium, a culture temperature of 25–30 °C, and dark static culture for 20–30 days.

[0022] The present invention also provides a herbicidal active metabolite derived from *Ilex chinensis* 6a-H-2, which can induce obvious necrotic spots on the leaves of broadleaf weeds such as *Eupatorium adenophorum* even in the absence of live bacteria, and the diameter of the necrotic spots is ≥ 0.5 cm.

[0023] The method for preparing the metabolites includes: fermenting strain 6a-H-2 in a liquid culture medium, filtering to remove mycelium, and extracting the fermentation broth with ethyl acetate or other organic solvents to obtain metabolite extracts.

[0024] Furthermore, the *Ilex pubescens* strain 6a-H-2 was inoculated into liquid culture medium and fermented for 20–30 days in the dark at 25–30°C. The mycelium was removed by filtration / centrifugation, and the fermentation broth was extracted with ethyl acetate or other organic solvents to obtain metabolite extracts.

[0025] In further chemical analysis of the fermentation metabolites of *Ilex rubrum* 6a-H-2, a single compound with significant herbicidal activity was successfully isolated from the crude extract. After purification by silica gel column chromatography and preparative HPLC, the pure product was obtained. Its structure was identified by LC-MS, XRD, and NMR, confirming that the compound is 7α-hydroxytrichodermol. This compound induced significant necrotic spots in broadleaf weeds such as *Ageratum adenophorum*, *Chenopodium album*, and *Amaranthus trifoliata* even in the absence of viable bacteria, indicating that it is a key active component of the herbicidal activity of *Ilex rubrum*, providing a clear active molecular basis for the development of bio-derived herbicides.

[0026] The *Ilex crenata* strain, inoculant, herbicide, and metabolites of the present invention can be used to control broadleaf weeds, preferably at least one of the following: *Alternanthera philoxeroides*, *Eupatorium adenophorum*, *Chenopodium album*, *Phyllanthus urinaria*, *Amaranthus trifoliata*, *Trifolium repens*, *Amaranthus urinaria*, *Cirsium japonicum*, and *Alternanthera philoxeroides*.

[0027] This invention also provides a method for screening strains of *Ilex rubrum*, comprising the following steps: Step 1) Cultivating strains isolated from naturally diseased tissues, extracting genomic DNA, and performing PCR amplification using primer pairs CAL, TEF-1α, and HIS3, respectively; Step 2) Sequencing and splicing the amplified sequences to obtain a combined sequence; Step 3) Comparing the combined sequence with the GenBank database for homology, constructing a phylogenetic tree based on the maximum likelihood method, determining the phylogenetic position of the strain, and finally identifying it as *Ilex rubrum*.

[0028] The spore solution can be prepared in one of the following two ways:

[0029] (1) Preparation of conidial solution: The strain was first activated on PDA solid medium for 5–7 days, then sterile water was added and the conidia were gently washed away by shaking. The mycelium was removed by filtration, and the spore concentration was adjusted to ≥10. 5 Prepare a diplosporin agent using cfu / mL.

[0030] (2) Preparation of ascospore solution: The strain was activated on PDA solid medium for 5–7 days, and after removing the mycelial layer, it was cultured in the dark at 25–30℃ for 10–20 days to induce the formation of ascocarps; the ascocarps were collected and crushed, and the resulting lysate was diluted with sterile water to an ascospore concentration ≥ 1×10⁻⁶. 5 Ascospores were prepared at a concentration of cfu / mL.

[0031] The identification method for strains of *Ilex rubrum* includes the following steps:

[0032] Step 1) The strain was cultured in a dark incubator at 28℃ for 5 days. DNA was extracted using a fungal gDNA extraction kit. PCR amplification was performed using the rDNA CAL sequence, TEF-1α sequence, and HIS3 sequence, respectively. The universal primers were CAL-228F (5'-GAGTTCAAGGAGGCCTTCTCCC-3', SEQ ID NO.4), CAL-2Rd (5'-TGRTCNGCCTCDCGGATCATCTC-3', SEQ ID NO.5), EF-1a-728F (5'-CATCGAGAAGTTCGAGAAGG-3', SEQ ID NO.6), EF-1a-986R (5'-TACTTGAAGGAACCCTTACC-3', SEQ ID NO.7); and H3-3F (5'-AGGTCCACTGGTGGCAAG-3', SEQ ID NO.8), H3-3R (5'-AGCTGGATGTCCTTGGACTG-3', SEQ ID NO.4). ID NO.9);

[0033] Step 2) Sequencing the amplification products from Step 1) and combining the sequencing results in the order CAL + His3 + tef1. The combined sequence is then compared for homology in the Genbank nucleic acid database.

[0034] Step 3) After amplification and sequencing alignment, the CAL amplified sequence OR188221, TEF1 amplified sequence OR188223, and HIS3 amplified sequence OR188222 showed 99% homology with the Calonectria ilicicola strain (CBS 190.50), and 99.22%, 98.37%, and 99.58% homology with the three nucleic acid sequences AY725676, AY725726, and AY725764, respectively. A phylogenetic tree was constructed using the maximum likelihood method, confirming the strain as *Alternaria ilicicola*.

[0035] Beneficial effects

[0036] The *Calonectria ilicicola* strain 6a-H-2 provided by this invention exhibits significant pathogenicity against a variety of broadleaf weeds. It effectively infects and inhibits typical invasive or highly damaging broadleaf weeds such as *Alternanthera philoxeroides*, *Eupatorium adenophorum*, *Chenopodium album*, *Phyllanthus urinaria*, *Amaranthus trifoliata*, *Trifolium repens*, *Amaranthus urinaria*, *Isodon japonicus*, and *Alternanthera philoxeroides*, demonstrating a broad spectrum of weed suppression and biocontrol potential. This strain was isolated from naturally diseased tea tree leaves and is itself an existing fungal resource in the ecosystem. Its prepared live, dead, or metabolite formulations cause minimal environmental disturbance when applied in the field, meeting the requirements for green, safe, and sustainable weed control. Safety test results show that this strain and its metabolites have good selectivity against major crops such as rice, without causing significant lesions or growth inhibition. It can control broadleaf weeds without harming crops and can also be used for weed control in wastelands or non-cultivated land. Host range testing results showed that among 105 plant species from 35 families tested, 6 were highly sensitive, 12 were sensitive, and 10 were moderately sensitive, with limited impact on non-target plants, demonstrating clear target specificity. Simultaneously, metabolite sensitivity testing results showed that among 119 plant species from 42 families, 6 were highly sensitive, 6 were sensitive, and 12 were moderately sensitive, indicating that their fermentation metabolites also possess independent herbicidal activity and can be used as bioactive ingredients in the development of biological herbicides. Compared to traditional chemical herbicides, this invention utilizes a biological weed-suppressing mechanism, which can significantly reduce the amount of chemical pesticides applied, lower environmental residues and the risk of herbicide resistance, and better align with the development direction of green agriculture, organic agriculture, and ecological governance. In summary, the *Ilex chinensis* strain provided by this invention is naturally derived, environmentally friendly, and possesses strong weed-suppressing ability, good selectivity, and independent metabolite activity, making it a biological control resource for broadleaf and grass weeds with significant application value and promotion prospects. Attached Figure Description

[0037] Figure 1 This is a phylogenetic analysis based on CAL, HIS3, and TEF1 sequences. The isolates of this invention are shown in bold; 6a-H-1, 6a-H-2, and 6a-H-3 are three replicates of this isolate, and the scale bar shows the branch lengths.

[0038] Figure 2 This is the colony morphology of *Ilex rubrum* (strain 6a-H-2) on a PDA plate in Example 1;

[0039] Figure 3 This is the morphology of the large conidia of *Ilex crenulata* in Example 1;

[0040] Figure 4 The morphology of the perithecia and ascospores of *Ilex rubrum* in Example 1;

[0041] Figure 5This is a diagram showing the infection effect of strain 6a-H-2 on the leaves of Eupatorium adenophorum in Example 2;

[0042] Figure 6 This is a diagram showing the pathogenic effect of the metabolites of strain 3 on the leaves of *Eupatorium adenophorum*.

[0043] Figure 7 The active compound isolated by this invention has the structural formula (Formula I).

[0044] Figure 8 This is a control effect diagram of the entire potted Alternanthera philoxeroides plant in Test Example 3, showing the inhibitory effect of the fungicide on Alternanthera philoxeroides. Detailed Implementation

[0045] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0046] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and should be understood to include those approximate. For numerical ranges, the endpoint values ​​of the ranges, the endpoint values ​​of the ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0047] The formulations of PDA and PDB culture media used in this invention are as follows: PDA: 200 g potato, 20 g glucose, 15 g agar, add distilled water to 1000 mL, pH at rest, sterilize at 121℃ for 20 min; PDB: 200 g potato, 20 g glucose, add distilled water to 1000 mL, pH at rest, sterilize at 121℃ for 20 min.

[0048] This invention evaluates the pathogenicity susceptibility of most broadleaf weeds using a leaf contact method, including attaching mycelium or applying a fermentation metabolite solution. The main focus is on recording the area of ​​lesions and the degree of necrosis to assess the susceptibility of different weeds to the strain or its metabolites.

[0049] To further verify the whole-plant control efficacy of the strain, a potted spore spraying experiment was conducted using Alternanthera philoxeroides as a representative, with fresh weight change as the control efficacy indicator. The fresh weight control efficacy was calculated using the following formula: Fresh weight control efficacy (%) = (average fresh weight of control - average fresh weight of treatment) / average fresh weight of control × 100%.

[0050] The tested weeds included a variety of common broadleaf weeds such as *Ageratina adenophora*, *Chenopodium album*, *Phyllanthus urinaria*, *Acalypha australis*, *Adenostemmalavenia*, *Trifolium repens*, *Ammannia arenaria*, *Cirsium arvense*, and *Alternanthera philoxeroides*. Among these, *Ageratina adenophora*, *Chenopodium album*, *Phyllanthus album*, *Acalypha australis*, *Adenostemmalavenia*, *Trifolium repens*, *Ammannia arenaria*, *Cirsium arvense*, and *Alternanthera philoxeroides* all exhibited obvious lesions after contact with the mycelium of the strain or its fermentation metabolites, representing highly sensitive target weed types screened in this invention. Furthermore, potted whole-plant experiments using typical sensitive weeds, such as Alternanthera philoxeroides, have confirmed that the strain of this invention can still cause significant necrosis and growth inhibition at the whole-plant level, demonstrating its potential as a biological herbicide.

[0051] Example 1

[0052] Isolation, pathogenicity verification and identification of strain 6a-H-2

[0053] 1. Tissue Isolation. Naturally diseased tea leaves were collected from Yunnan tea gardens. After removing surface dirt and grime, the leaves were cut into 0.5 × 0.5 cm pieces along the boundary between diseased and healthy tissue. The pieces were treated with 70% ethanol for 30 s, followed by treatment with 1% sodium hypochlorite for 60 s. They were then rinsed 3–4 times with sterile water and dried in a laminar flow hood. The tissue pieces were cultured on PDA plates at a constant temperature of 25–28℃ to obtain fungal colonies. Single colonies were picked and continuously transferred for purification to obtain candidate strains.

[0054] 2. Pathogenicity Verification. A suspension of conidia from a pure culture strain was inoculated into healthy tea seedlings. After 7 days, typical dark brown conidial tumor leaf spots appeared. The strain obtained by re-isolieving the lesion tissue was identical to the original strain, conforming to Koch's postulates. This strain was identified as the pathogenic strain and designated 6a-H-2.

[0055] 3. Morphological identification. The strain forms white, flocculent colonies on PDA, which later turn pale yellow and secrete a dark brown soluble pigment. Microscopic observation shows that the macroconidia are colorless, cylindrical, and septate; after about 30 days of culture, orange-red, nearly spherical ascothecia are formed, which are orange-red, almost spherical, and have a rough surface; breaking the ascothecia releases transparent ascospores with two septa.

[0056] Molecular biological identification. Genomic DNA was extracted from the strain, and the CAL, TEF-1α, and HIS3 sequences were amplified. The amplified sequences were assembled in the order of CAL+HIS3+TEF1 and compared with the GenBank database. The sequences OR188221 (CAL), OR188223 (TEF1), and OR188222 (HIS3) all showed 98.37%–99.58% homology with Calonectria ilicicola (CBS 190.50). A phylogenetic tree was constructed based on the maximum likelihood method, and the strain was identified as *Calonectria ilicicola*.

[0057] The 6a-H-2 bidirectional sequencing assembly sequence (CAL sequence) is as follows:

[0058] GAGTTCCCAAGGGGGCCTTCTCCCTCTTTGTAAGTCTCTCCTACACCCTCGCGGGCGCACCTCAGCCTTGTCGACCGTGTTGAAACCCTTTCATGCTAACACGTTCGCGCAGGACAAGGATGGTGATGGTGAGTTCGCTCCCCTCAATGTTACGCACCGCCTCTCCTGGCAGTTACCGCTCGATCACGGACCCGACCTGCTCAGAACCGCTTCCCCATCACCTTTCACCCTTTCGAAGCGAATTGATTTTGCAACAGCCGACTAAATAACATGCTCTAGGCCAGATCACTACCAAGGAGCTTGGCACTGTCATGCGCTCCCTGGGCCAGAACCCCTCCGAGTCCGAGCTTCAGGACATGATCAACGAGGTCGATGCCGACAACAACGGCACTATCGATTTCCCTGGTGCGTGACAATATCCCTCTGATTCATCGGCACCACTGCGATCTAACACAGCTGCGAAGAGTTCCTTACCATGATGGCTCGCAAAATGAAGGATACCGACTCCGAGGAAGAGATCCGAGAAGCTTTCAAGGTTCGTGCAAAGTCTCCAGGTATTTAGCGTGCTCAAGATGTTGATTTTCATTCCCAGGTCTTTGACCGTGACAACAACGGATTTATCTCCGCTGCCGAGCTTCGCCACGTCATGACCTCCATTGGCGAGAAGCTCACTGACGATGAGGTTGACGAGATGATCCGCAGGGGCGGGACCAAA (SEQ ID NO.1).

[0059] The 6a-H-2 bidirectional sequencing splicing sequence (EF1-a sequence) is as follows:

[0060] CATCGAGAAGTCGAGAAGGTTGGTGACATTCCCTCGATTCCCCCATCGACCGTCGATTCGCGCGTCGCCGTGTCTGCTCCACCCGAAACACCTCCCCTCGCCACCCCTCTTTGTCGATCTAAAAATTTTCTGCACACATCCTCTGGGTTTGTGGTGGGGGCA TTTACCCCGCCGCCCACAGGACGTCGTCAAACCCGCCCCGCCCCACTTTGACTTTCGCACCAAATCACATTTGGCATCTCGCCACACATATTGATTGACACTGTGCTGACTCTCACAAACAGGAAGCCGCTGAACTCGGTAAGGGTTCCTTCAAGTAA (SEQ ID NO.2).

[0061] The 6a-H-2 bidirectional sequencing assembly sequence (HIS3 sequence) is as follows:

[0062] TACTGGTCCACCTGTGGCAAGGCCCCTCGCAAGCAGCTCGCTTCCAAGGCTGGTGAGTACACTCTGTCACAGAATACTGGCGACACATGCTGACATCAATCCAACAGCCCGCAAGAGCGCCCCTTCCACCGGAGGTGTCAAGAAGCCCCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGACGATCCAGAAGTCGACTGAGCTGCTTATCCGCAAGCTCCCC TTCCAGCGTCTTGTAACCCCGAACATCACCATAACATCAGGCGCTAATCAGAAACAGGTTCGTGAGATCGCCCAGGACTTCAAGAGCGACCTTCGCTTCCAGTCATCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGTCCTACCTCGTCTCTCTTTTCGAGGACACCAACCTCTGCGCTATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGCCATCCAGCA (SEQ ID NO.3).

[0063] This strain was deposited at the China General Microbiological Culture Collection Center (CGMCC) on November 18, 2025, with accession number CGMCC No. 42372.

[0064] Example 2

[0065] Composition and preparation of *Ilex rubrum* inoculant

[0066] In this invention, there is no particular limitation on the concentration of *Ilex rubrum* in the inoculant, which can be flexibly adjusted according to factors such as application method, weed type, and formulation requirements. The inoculant may contain at least one of live *Ilex rubrum* cells, dead *Ilex rubrum* cells, and / or its fermentation products, wherein live cells and fermentation metabolites are preferred components. In this invention, "fermentation products" refers to extracellular or intracellular metabolites produced by *Ilex rubrum* during cultivation, which have independent pathogenic activity. The mycelial forms of *Ilex rubrum* in the inoculant of this invention include conidia, ascospores, and mycelia, which can be used alone or in combination as needed.

[0067] Preparation of conidial agent: The strain 6a-H-2 obtained in Example 1 was activated on a PDA for 7 days, sterile water was added and gently shaken to wash away conidia, mycelium was removed by filtration, and the spore concentration was adjusted to 10. 5 Prepare a diplosporin agent using cfu / mL.

[0068] Preparation of sexual spore-forming agent: The 6a-H-2 strain obtained in Example 1 was transferred to a fresh PDA plate for activation. After 7 days, the mycelia growing on the plate were washed away with sterile water. The plate with the mycelia removed was then cultured in the dark at 28°C for 14 days, which produced a large number of ascocarps. The ascocarps were collected and crushed in a small amount of sterile water. The crushed liquid was diluted with sterile water to a concentration of 10 sexual spores. 5 Sexual spore liquid at cfu / mL was used as a biological herbicide.

[0069] Example 3

[0070] Preparation of fermentation metabolites

[0071] Five to eight 3 mm mycelial discs of strain 6a-H-2 were inoculated into PDB medium. The optimal preparation conditions were glucose-sucrose mixture (19% sucrose + 81% glucose) fermented statically at 28 °C for 25 days under 15 / 9 h light / dark conditions. After fermentation, mycelium was removed by filtration through four layers of gauze, the pH was adjusted to 3, and extraction was performed using organic solvents such as ethyl acetate. The organic phase was evaporated to obtain crude metabolites. The metabolites were dissolved in methanol (final methanol concentration <5%) to prepare a 5 mg / mL solution for weed susceptibility testing.

[0072] Example 4

[0073] Isolation, purification and structural identification of active metabolites

[0074] The crude ethyl acetate extract obtained in Example 3 was dissolved in a small amount of methanol and subjected to silica gel column chromatography with a gradient elution of petroleum ether / ethyl acetate (10:1→1:1). Fractions with similar spots were collected. The fractions containing the active components were further analyzed by preparative HPLC (C10-C2000). 18 The compound was purified by column chromatography (50%–90% methanol / water gradient) to obtain a single compound with a purity ≥ 95%.

[0075] The structure of the compound was determined using LC-MS, NMR (600 MHz), and XRD. Combined with the spectral data, the compound was confirmed to be 7α-hydroxytrichodermol, and its structure is shown in formula I. Figure 7 As shown.

[0076] Activity verification showed that when the compound was applied to the leaves of Eupatorium adenophorum at a concentration of 1–5 mg / mL, it could produce typical necrotic spots with a diameter ≥ 0.5 cm within 5 days. Its herbicidal activity was consistent with that of the crude extract, proving that it is an effective active ingredient in the fermentation metabolites.

[0077] Test Example 1

[0078] Pathogenicity of strains against leaves of different weed species

[0079] A 3 mm diameter mycelial block was taken from the edge of a PDA plate colony and attached to the leaves of various weeds, including *Eupatorium adenophorum*, *Chenopodium album*, *Phyllanthus urinaria*, *Amaranthus trifoliata*, *Trifolium repens*, *Amaranthus urinaria*, and *Sonchus oleraceus*. A blank PDA plate was used as a control. After 5 days of light incubation, lesions were observed. Most of the tested weeds showed obvious necrotic spots. The sensitivity data for each weed are shown in Table 1. A typical lesion of *Eupatorium adenophorum* is shown below. Figure 5 As shown.

[0080] Table 1. Sensitivity of tested weeds to *Ilex chinensis* 6a-H-2

[0081]

[0082]

[0083] Table 1 shows that *Ilex chinensis* 6a-H-2 exhibits strong infectivity against a variety of broadleaf weeds, with *Chenopodium album*, *Trifolium repens*, *Smilax china*, *Amaranthus urinaria*, *Phyllanthus urinaria*, and *Eupatorium adenophorum* showing high sensitivity, forming obvious necrotic lesions. It also shows sensitivity or moderate sensitivity to many broadleaf weeds from the Papaveraceae, Polygonaceae, and Solanaceae families, indicating that this strain has broad-spectrum pathogenicity against broadleaf weeds. In contrast, grass weeds such as barnyard grass, foxtail grass, and Kentucky bluegrass generally show no obvious lesions or very weak reactions, indicating that 6a-H-2 has weak infectivity against grass plants and exhibits clear selectivity. These results demonstrate that this strain is a dominant pathogenic resource against broadleaf weeds.

[0084] Test Example 2

[0085] Pathogenicity of fermentation metabolites on weed leaves

[0086] As shown in Table 2, the 6a-H-2 metabolite of *Cyclocarya paliurus* described in this invention exhibits significantly differentiated sensitivity to different weeds, with lesion areas ranging from 0.18±0.022 to 4.409±0.770 cm². 2 Based on the sensitivity grading results, highly sensitive weeds include Amaranthus powellii (4.409±0.770 cm). 2 ), duck tongue grass (Pontederia vaginallis, 3.976±0.738 cm) 2 Sensitive weeds include Fallopia convolvulus (2.331±0.434 cm), etc.; sensitive weeds include... 2 Polygonum multiflorum (1.597±0.266 cm) 2 Other weeds include: moderately sensitive weeds (such as Alternanthera philoxeroides, 0.542±0.023 cm), and moderately sensitive weeds (such as Alternanthera philoxeroides, 0.542±0.023 cm). 2 ), *Lactuca indica*, 1.757 ± 0.195 cm 2 ), Chrysanthemum indicum, 1.430±0.101 cm 2 Stable lesions were observed in various weeds, including wild oats (Avena fatua, 0.724±0.647 cm). Mildly sensitive weeds showed smaller overall lesion areas. 2 ), Commelina communis, 0.699±0.381 cm 2 ), Panicum repens (0.430±0.156 cm) 2 Therefore, unlike existing chemical herbicides which exhibit "broad-spectrum / non-selective action," the metabolites described in this invention also show significant pathogenic effects on weeds, producing significant lesion reactions on various broadleaf weeds. This provides experimental evidence and support for their application as a biological herbicidal active ingredient.

[0087] After puncturing the underside of the leaves of the tested weeds, 10 μL of fermentation metabolite solution was added, with the solvent serving as a blank control. The diameter of the lesions was measured 5 days later. *Eupatorium adenophorum*, *Chenopodium album*, and *Amaranthus trifoliata* were highly sensitive to the metabolites; data are shown in Table 2. Typical lesions are shown in... Figure 6 As shown.

[0088] Table 2. Sensitivity of tested weeds to metabolites of *Ilex chinensis* 6a-H-2.

[0089]

[0090] Test Example 3

[0091] Hollow lotus seed potted plants fresh weight and preventive effect

[0092] Hollow-stemmed Alternanthera plants were cultivated in plastic pots. When the plants reached about 20cm in length (12 leaves), foliar spraying was performed (spraying spore suspension at a rate of 10mL; Tween 80 solution was used as a control (ck)). The spraying was done once. After spraying, the plants were placed in an artificial climate chamber at 28℃~30℃ and 80% humidity for 48 hours. Afterward, they were moved to a greenhouse for natural growth. The plant efficacy was assessed after 14 days, and the plant efficacy and fresh weight efficacy were assessed after 21 days.

[0093] Based on the survey data, the fresh weight efficacy (%) of each treatment was calculated according to formula (1). The disease index at 21 days was calculated according to formula (2).

[0094] Fresh weight efficacy (%) = [(fresh weight of control group - fresh weight of treatment group) / fresh weight of control group] × 100% (1)

[0095] Disease index (%) = 100 × ∑(disease level value × number of leaves at that level) / (total number of leaves × highest disease level value) (2)

[0096] The above experiments determined the effectiveness of strain 6a-H-2 in controlling water hyacinth. The results are shown in Table 3 and [Table data missing]. Figure 7 The results showed that when the spore concentration was 10... 5 The control efficacy against the indoor fresh weight of water peanut reached 35.2% on day 7 and 85.9% on day 21. At this time, the disease index reached 86.3%.

[0097] Table 3 Spraying 10 5 Effect of spore / mL sexual spore suspension on the control of water hyacinth (indoors)

[0098]

[0099] Test Example 4

[0100] Safety of *Ilex chinensis* strain 6a-H-2 in rice

[0101] 1. Preparation of spore suspension of strain 6a-H-2

[0102] The 6a-H-2 strain was inoculated into 9 cm petri dishes and cultured at 28°C for 7 days. After the mycelium had fully grown, it was scraped off with sterile water. The petri dishes with the scraped-off mycelium were then placed in the 28°C culture room until several ascocarps appeared. The ascocarps were collected, broken, and adjusted to a concentration of 10 with 0.05% (v / v) Tween-80. 5 Spores / mL.

[0103] 2. Cultivation experiment using rice

[0104] The rice variety was Nangeng 46. The rice was cultivated in a constant temperature incubator at 28℃ until the seeds sprouted, and then transplanted into pots with 5 rice plants per pot. This process was repeated 3 times, and the plants were placed outdoors to grow.

[0105] 3. Test methods

[0106] Prepare 10 5 Spore suspension at spore density / mL and 0.05% (v / v) Tween-80 solution. When rice plants reach the two-leaf stage, foliar spraying (spore suspension, 10 ml; Tween-80 solution as control (CK)) is performed. After a single application, the sprayed rice plants are placed in an artificial climate chamber at 28℃~30℃ and 80% humidity for 48 hours for moist cultivation. Afterward, they are transferred to a greenhouse for natural growth. After 7 and 14 days, the plants are graded and the disease incidence is investigated. The disease is graded and assigned a value according to the degree of disease on the leaves of the treated plants.

[0107] The grading of different severity levels of rice diseases is based on the grading standards of Chen Yong (2001). The grading standards for rice diseases are as follows:

[0108] Level 0: Rice is disease-free, represented by NS;

[0109] Grade 1: Rice leaves have lesions but the lesions do not exceed 1 / 2 of the entire leaf, indicated by HS;

[0110] Level 2: All leaves of the rice plant wither and die, denoted by S.

[0111] 4. Test Results

[0112] The safety of strain 6a-H-2 for rice was determined through the above experiments. The results are shown in Table 3, indicating that no infection symptoms were observed in the rice plants. The experiments demonstrate that strain 6a-H-2 is safe for crops when used in paddy fields.

[0113] Table 3. Safety of rice treated with 106 spores / mL spore suspension for 14 days (indoor test)

[0114]

Claims

1. A type of Calonectria ilicicola, characterized in that, The Calonectria ilicicola species was deposited on November 18, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. It was classified and named Calonectria ilicicola, with accession number CGMCC No. 42372.

2. A microbial agent, characterized in that, The inoculum contains the *Ilex chinensis* as described in claim 1, or its mycelium, conidia, ascospores, and fermentation metabolites.

3. The application of the *Ilex chinensis* as described in claim 1 or the fungal agent as described in claim 2 in the control of weeds.

4. The application according to claim 3, characterized in that, Spray the *Ilex rubrum* as described in claim 1 or the fungal agent as described in claim 2 onto the plant leaves or drench the roots.

5. The application according to claim 3, characterized in that, The weeds are broadleaf weeds or grassy weeds, including Alternanthera philoxeroides, Ageratina adenophora, Chenopodium album L., Cynanchum rostellatum, Vicia sativa L., Acalypha australis L., Trifolium repens L., Cirsium arvense, Arthraxon hispidus, Commelina communis, Digitaria sanguinalis, Ammannia arenaria, Sympyotrichum subulatum, Poa annua, Solidago canadensis, Erigorum sulphureus, and Humulus. At least one of the following: scanden.

6. The use of the *Ilex rubrum* strain of claim 1 or the fungal agent of claim 2 in the preparation of the active ingredient 7α-hydroxytrichodermol from metabolites.

7. A herbicide, characterized in that, The herbicide includes the *Ilex rubrum* as described in claim 1 and / or its metabolites and / or the fungal agent as described in claim 2.

8. The herbicide according to claim 7, characterized in that, The herbicide contains at least 10% concentrations of conidia and / or ascospores of *Ilex rubrum*. 5 cfu / mL.

9. The herbicide according to claim 7, characterized in that, The method for preparing the herbicide includes: fermenting or inducing the *Ilex rubrum* strain according to claim 1 to obtain fermentation broth or ascocarps; filtering the fermentation broth or ascocarp fragments to remove mycelium; diluting to obtain spore liquid; and preparing the spore liquid as a herbicide.

10. The herbicide according to claim 7, characterized in that, The metabolite is 7α-hydroxytrichodermol.