A trypanosoma evansi qpcr detection method

The real-time quantitative PCR detection method using specific primer pairs and probe combinations solves the problems of insufficient specificity and sensitivity in Trypanosoma eeris detection, enabling rapid, accurate, and quantitative detection of Trypanosoma eeris. It is suitable for clinical testing and epidemiological surveys of livestock, poultry, and pets.

CN122104970APending Publication Date: 2026-05-29LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610297843.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-12
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing methods for detecting Trypanosoma eerilyum suffer from problems such as poor target gene selection, insufficient specificity and sensitivity, and poor repeatability, making it difficult to achieve rapid, accurate, and quantitative detection.

Method used

A real-time quantitative PCR detection method using specific primer pairs and probe combinations was adopted. The ISG75 gene was used as the target. The upstream primer ISG75-F, the downstream primer ISG75-R, and the fluorescent probe ISG75-Probe were designed to amplify the ISG75 gene of Trypanosoma eeris. A 20 μL reaction system was constructed for qPCR detection.

Benefits of technology

It achieves highly specific, sensitive, and reproducible detection of Trypanosoma eeleris, enabling rapid and accurate quantification of Trypanosoma eeleris, reducing the false negative rate, and is suitable for clinical testing and epidemiological surveys of livestock, poultry, and pets.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104970A_ABST
    Figure CN122104970A_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of molecular biology detection, and specifically relates to a Trypanosoma evansi qPCR detection method, which adopts a combination of specific primer pairs and a probe to perform real-time fluorescent quantitative PCR detection by a probe method; the combination of the primer pairs and the probe comprises an upstream primer ISG75-F, a downstream primer ISG75-R and a fluorescent probe ISG75-Probe; the nucleotide sequence of the upstream primer ISG75-F is shown in SEQ ID NO:1; the nucleotide sequence of the downstream primer ISG75-R is shown in SEQ ID NO:2; and the nucleotide sequence of the fluorescent probe ISG75-Probe is shown in SEQ ID NO:3. The Trypanosoma evansi qPCR detection method constructed by the application has high specificity of specific primer pairs and a probe, high sensitivity, good repeatability, simple operation, rapid detection, can realize qualitative and quantitative detection of Trypanosoma evansi, is suitable for clinical detection, epidemiological investigation, pathogen screening and treatment effect monitoring of Trypanosoma evansi disease of livestock and poultry and pets, and can be prepared into a commercial detection kit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology detection technology, specifically a qPCR detection method for Trypanosoma eeris, and particularly relates to Trypanosoma eeris specific primer pairs, fluorescent probes, and probe-based qPCR detection methods targeting the ISG75 gene. Background Technology

[0002] Trypanosoma eerilyense is a protozoan that parasitizes the blood of livestock, causing trypanosomiasis. This disease primarily infects horses, cattle, sheep, dogs, and other poultry, but can also infect pets. Symptoms include fever, anemia, emaciation, and edema; in severe cases, it can lead to death, causing significant economic losses to livestock production and pet ownership. Early and accurate detection of Trypanosomiasis is crucial for disease control. Traditional detection methods include microscopic examination and serological testing.

[0003] Microscopic examination is a diagnostic method that involves observing parasites in blood smears. This method is simple to operate and low in cost, but it has extremely low sensitivity and can only detect samples with a high parasite content. It is also easily affected by the operator's experience and has a high false negative rate. Serological detection methods, such as enzyme-linked immunosorbent assay (ELISA) and indirect hemagglutination assay, can detect samples with low parasite content, but they have poor specificity, are prone to cross-reaction with other protozoa, and cannot achieve quantitative detection of pathogens.

[0004] Real-time quantitative PCR (qPCR) technology boasts advantages such as high sensitivity, strong specificity, rapid detection, and quantification, and has been widely applied in the detection of pathogenic microorganisms. Probe-based qPCR, compared to dye-based methods, offers higher specificity and avoids interference from non-specific amplification products, making it the preferred method for accurate pathogen detection. Currently, qPCR detection methods for Trypanosoma eerilyense still suffer from problems such as poor target gene selection, insufficient specificity and sensitivity, and poor reproducibility. Therefore, there is an urgent need to screen suitable target genes, design specific primers and probes, and construct an efficient, accurate, and stable qPCR detection method for Trypanosoma eerilyense to meet the needs of clinical testing and disease control. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing Trypanosoma eeris detection methods and provide a qPCR detection method for Trypanosoma eeris with high specificity, high sensitivity and good repeatability, so as to achieve rapid, accurate and quantitative detection of Trypanosoma eeris and provide technical support for the prevention and control of Trypanosoma eeris disease.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: A qPCR detection method for Trypanosoma eerilyense uses a combination of specific primer pairs and probes to perform real-time quantitative PCR detection using the probe method. The primer pair and probe combination includes upstream primer ISG75-F, downstream primer ISG75-R, and fluorescent probe ISG75-Probe; The nucleotide sequence of the upstream primer ISG75-F is shown in SEQ ID NO: 1; SEQ ID NO: 1: 5'TGTTGCTTGGGTTGCTTGTG3'; The nucleotide sequence of the downstream primer ISG75-R is shown in SEQ ID NO: 2; SEQ ID NO: 2: 5'CGGGCACCTGTGATAGTGTT3'; The nucleotide sequence of the fluorescent probe ISG75-Probe is shown in SEQ ID NO: 3; SEQ ID NO: 3: 5'FAM-CCGTAGGAAGGCTGAGGTGAAGGATGA-3'BHQ1.

[0007] Preferably, the fluorescent probe ISG75-Probe has a fluorescent reporter group FAM labeled at its 5' end and a fluorescent quencher group BHQ1 labeled at its 3' end.

[0008] Preferably, the primer pair amplifies the target fragment of the Trypanosoma eigerentii ISG75 gene, which is 156 bp in size.

[0009] Preferably, the qPCR reaction system has a total volume of 20 μL and includes: 10 μL of Premix Ex Taq (ProbeqPCR) (2X), 0.4 μL of 10 μM upstream primer ISG75-F, 0.4 μL of 10 μM downstream primer ISG75-R, 0.4 μL of fluorescent probe ISG75-Probe, 0.2 μL of 50X ROX Reference Dye, 1 μL of DNA template, and 7.6 μL of sterile water.

[0010] Preferably, the final concentrations of the upstream primer, downstream primer, and fluorescent probe in the reaction system are all 200 nM, the final concentration of Premix Ex Taq (Probe qPCR) is 1×, the final concentration of ROX Reference Dye is 1×, and the amount of DNA template used is <100 ng.

[0011] Preferably, the qPCR reaction program is as follows: 95°C pre-denaturation for 30 seconds, 1 cycle; 95°C denaturation for 5 seconds, 59°C annealing and extension for 34 seconds, 40 cycles.

[0012] Preferably, the detection limit of the detection method is 7.14 × 10¹ copies / μL of Trypanosoma eicosa ISG75 plasmid.

[0013] Preferably, the detection method shows amplification signals for Trypanosoma brucei, Trypanosoma eeris, and Trypanosoma equine, but no amplification signals for Trypanosoma congo, Tyle equine, Apharospasm, and Babesia oocystis, and no amplification signal for the negative control.

[0014] Preferably, in the repeatability test of the detection method, the within-group coefficient of variation for detecting different concentrations of Trypanosoma eicirii ISG75 plasmid is ≤0.53%, and the between-group coefficient of variation is ≤0.96%.

[0015] The application of the primer pair and probe combination in the preparation of Trypanosoma eeris detection reagents or kits.

[0016] The application of the described Trypanosoma eeris qPCR detection method in the clinical detection, epidemiological investigation, and pathogen screening of Trypanosoma eeris disease.

[0017] Compared with the prior art, the present invention has the following advantages: 1. High primer and probe specificity: This invention targets the ISG75 gene of Trypanosoma eeris. The designed primer pairs and probes are highly specific to Trypanosoma eeris, amplifying the target fragment of 156 bp. There is no non-specific amplification, and amplification signals are only generated for Trypanosoma brucei, Trypanosoma eeris, and Trypanosoma equine. There is no cross-amplification for common livestock / pet pathogens such as Trypanosoma congo, Tyle equine, Apocytozoon, and Babesia oocystis. The negative control shows no amplification signal, effectively avoiding false positive results.

[0018] 2. High detection sensitivity: The qPCR detection method constructed in this invention has a detection limit as low as 7.14 × 10¹ copies / μL of Trypanosoma eiciridis ISG75 plasmid, which is much higher than that of traditional microscopic examination and conventional serological methods. It can detect samples with low parasite content and reduce the false negative rate.

[0019] 3. Excellent repeatability and stability: Repeatability test results of plasmids with different concentrations show that the coefficient of variation within groups is ≤0.53% and the coefficient of variation between groups is ≤0.96%, both below 1%; the correlation coefficient of the standard curve is R²=0.9993, with extremely high fit, and the amplification efficiency is En=104.2%, which is close to the ideal amplification efficiency. The detection results are stable and reliable, and can meet the needs of batch sample detection.

[0020] 4. Simple operation and rapid detection: The qPCR detection reaction system of this invention is simple to configure, and the entire reaction procedure only takes about 1 hour. Compared with traditional detection methods, the detection time is greatly shortened, and it can be automated, making it suitable for rapid clinical screening and large-scale epidemiological surveys.

[0021] 5. Quantitative detection is possible: This invention constructs a standard curve based on standard plasmids, which can calculate the copy number of the pathogen based on the Ct value of the sample, thereby realizing the quantitative detection of Trypanosoma eeris and providing data support for assessing the degree of infection and monitoring the treatment effect. Attached Figure Description

[0022] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the embodiments of the invention to explain the invention and do not constitute a limitation thereof.

[0023] Figure 1 This is an agarose gel electrophoresis image of the target fragment of the ISG75 plasmid in this embodiment of the invention; where M is the DL2000 Marker, NC is the negative control, 1 is the ISG75 plasmid amplification product, and 1 shows a specific band at the 156bp position.

[0024] Figure 2 This is a specificity test amplification curve of the qPCR detection method for Trypanosoma eeris in this embodiment of the invention; wherein, 1, 2, and 3 are Trypanosoma brücken, Trypanosoma eeris, and Trypanosoma equinee, respectively, and 4 and 5 are Trypanosoma congoe, Trypanosoma equinee, Trypanosoma equinee, Trypanosoma ovalis, and Trypanosoma ovalis, respectively. 1-3 have obvious S-shaped amplification curves, while 4-5 have no amplification curves.

[0025] Figure 3 This is an amplification curve of the sensitivity test for the qPCR detection method of Trypanosoma eeris in this embodiment of the invention; where 1-9 represent 7.14 × 10⁻⁹ cm⁻¹. 9 A plasmid sample of ~7.14 × 10¹ copies / μL, where 10 is 7.14 × 10¹ copies. 0 Plasmid samples of copies / μL and NTC showed obvious S-shaped amplification curves for samples 1-9, while sample 10 showed no amplification curve.

[0026] Figure 4 This is a standard curve graph of the qPCR detection method for Trypanosoma eeris in this embodiment of the invention; the horizontal axis is the logarithm of the plasmid copy number (Log Quantity), the vertical axis is the Ct value, and the standard curve equation is y=-3.2231x+31.899, R²=0.9993, En=104.2%. Detailed Implementation

[0027] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] Experimental materials: Primers and probes: The upstream primer ISG75-F, the downstream primer ISG75-R, and the fluorescent probe ISG75-Probe were synthesized by Qingke Biotechnology, and their sequences are as described in the invention description.

[0029] Standard plasmid: Trypanosoma eiri ISG75 plasmid, target fragment 156 bp, plasmid concentration 7.14 × 10¹ 0 Copies / μL were used as standards for qPCR detection.

[0030] Reagents and consumables: Premix Ex Taq (Probe qPCR) (2X) and ROX Reference Dye (50X) are commercially available reagents; sterile water is enzyme-free ultrapure water; DL2000 Marker is a nucleic acid molecular weight standard.

[0031] Test samples: nucleic acid samples of Trypanosoma brucei, Trypanosoma eeris, Trypanosoma equinei, Trypanosoma congoi, Tyrelia equinei, Apocytozoa, and Babesia oocystis. The negative control (NTC) is enzyme-free ultrapure water.

[0032] Instruments and equipment: Real-time quantitative PCR instrument, agarose gel electrophoresis instrument, nucleic acid electrophoresis imaging system, micropipette, etc.

[0033] Example 1: Amplification and Validation of the Target Fragment in ISG75 Plasmid Using the Trypanosoma eiciridis ISG75 plasmid as a template, conventional PCR amplification was performed using the primer pair ISG75-F / ISG75-R of this invention. The amplified products were detected by 1.5% agarose gel electrophoresis. The electrophoresis results showed that the DL2000 Marker exhibited characteristic bands of 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. The negative control (NC) showed no band. The detection well (1) showed a single, bright, specific band at position 156bp, with no extraneous bands. This indicates that the primer pair of this invention can specifically amplify the target fragment of the Trypanosoma eiciridis ISG75 gene, and the amplification effect is good. Figure 1 As shown.

[0034] Example 2: Construction of the reaction system and procedure for qPCR detection of Trypanosoma eeris. qPCR reaction system: The total volume was 20 μL. The composition and volume of each reagent were as follows: Premix Ex Taq (Probe qPCR) (2X) 10 μL, 10 μM ISG75-F 0.4 μL, 10 μM ISG75-R 0.4 μL, ISG75-Probe 0.4 μL, 50X ROX Reference Dye 0.2 μL, DNA template 1 μL, and sterile water 7.6 μL. The final concentrations of each reagent were: Premix Ex Taq (Probe qPCR) 1×, upstream and downstream primers and probes 200 nM each, ROX Reference Dye 1×, and DNA template <100 ng. See Table 1 for details. Table 1

[0035] (2) qPCR reaction procedure: 95℃ pre-denaturation for 30 seconds (1 cycle); 95℃ denaturation for 5 seconds, 59℃ annealing and extension for 34 seconds (40 cycles), with real-time acquisition of fluorescence signals during amplification. (3) Method validation: This detection method has high specificity, generating amplification signals only for specific species of Trypanosoma, with no cross-amplification for other livestock / pet pathogens; high sensitivity, with a detection limit of 7.14×10¹ copies / μL; excellent repeatability, with intra- and inter-group coefficients of variation both below 1%, good standard curve fit, and amplification efficiency close to the ideal value. As shown in Table 2: Table 2

[0036] Example 3 Specificity test of the qPCR detection method for Trypanosoma eeris. Experimental methods: Using nucleic acid samples of Trypanosoma brucei, Trypanosoma eeris, Trypanosoma equineissus, Trypanosoma congois, Tyrelia equineissus, Apocytozoa, and Babesia oocystis as templates, and enzyme-free ultrapure water as a negative control (NTC), the qPCR detection method constructed in this invention was used for amplification, and the fluorescence amplification curves of each sample were observed.

[0037] Test results: such as Figure 2 As shown, the amplification curves of the specificity test revealed that *Trypanosoma brevicornu*, *Trypanosoma eerilys*, and *Trypanosoma equinee* samples exhibited distinct S-shaped amplification curves with significant fluorescence signals; while *Trypanosoma congo*, *Typanosoma equinee*, *Apharospasm*, *Babesia oocystis* samples, and the negative control showed no S-shaped amplification curves or fluorescence signals. This indicates that the qPCR detection method of this invention has high specificity, amplifying only specific species of the *Trypanosoma* genus, and exhibiting no cross-reactivity with other common livestock / poultry / pet pathogens, effectively distinguishing *Trypanosoma eerilys* from other pathogens.

[0038] Example 4 Sensitivity test of the qPCR detection method for Trypanosoma eeris. Experimental method: The concentration was 7.14 × 10¹ 0 ISG75 standard plasmid copies / μL was serially diluted 10-fold to obtain 7.14 × 10⁻⁶ copies / μL. 9 ~7.14×10 0 Ten plasmid samples at concentration gradients of 10 copies / μL were amplified using the qPCR detection method of this invention, with each gradient plasmid serving as a template, to determine the limit of detection.

[0039] Test results: such as Figure 3 As shown, the amplification curve of the sensitivity test shows 7.14 × 10⁻⁶. 9 Plasmid samples with ~7.14×10¹ copies / μL all showed obvious S-shaped amplification curves and fluorescence signals; 7.14×10¹ copies / μL 0 No amplification curve or fluorescence signal was observed in plasmid samples of copies / μL and in the negative control. This indicates that the qPCR detection method of the present invention has high sensitivity, with a detection limit of 7.14 × 10¹ copies / μL.

[0040] Example 5: Repeatability test of the qPCR detection method for Trypanosoma eeris. Experimental method: Select 7.14×10², 7.14×10³, and 7.14×10 4 7.14×10 5 7.14×10 6 Five ISG75 standard plasmids at five different concentrations (copies / μL) were used as templates. Each concentration was used in three replicate wells for three independent experiments. The mean Ct value, standard deviation (SD), and coefficient of variation (CV) were calculated for both within-group and between-group experiments to verify the repeatability of the method.

[0041] Test results: The repeatability test results are shown in Table 3 below: Table 3. Repeatability test results of the qPCR detection method for Trypanosoma eiridis.

[0042] As shown in Table 3, the coefficient of variation within each group for each plasmid concentration is ≤0.53%, and the coefficient of variation between groups is ≤0.96%, both below 1%, indicating that the qPCR detection method of the present invention has excellent repeatability and the detection results are stable and reliable.

[0043] Example 6: Construction of the standard curve for the qPCR detection method of Trypanosoma eeris. Experimental method: 7.14 × 10 9Using the ISG75 standard plasmid with ~7.14×10¹ copies / μL as a template, amplification was performed using the qPCR detection method of this invention. A standard curve was constructed with the logarithm of plasmid copy number as the abscissa and Ct value as the ordinate, and the correlation coefficient (R²) and amplification efficiency (En) were calculated.

[0044] Test results: such as Figure 4 As shown, the equation of the constructed standard curve is: The correlation coefficient R² = 0.9993 and the amplification efficiency En = 104.2% indicate that the standard curve has an extremely high fit and the amplification efficiency is close to the ideal value (100% ± 10%), making it suitable for quantitative detection of Trypanosoma samples.

[0045] The qPCR detection method for Trypanosoma eeris constructed in this invention has highly specific primer pairs and probes, and the detection method is highly sensitive, reproducible, easy to operate, and rapid. It can realize the qualitative and quantitative detection of Trypanosoma eeris and is suitable for clinical detection, epidemiological investigation, pathogen screening, and treatment effect monitoring of Trypanosoma eeris in livestock and poultry and pets. It can be prepared into commercial detection kits and has broad industrial application prospects and market value in the fields of animal husbandry, pet medical care, and animal disease prevention and control.

[0046] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention. No reference numerals in the claims should be construed as limiting the scope of the claims.

Claims

1. A qPCR detection method for Trypanosoma eerilyense, characterized in that, A combination of specific primer pairs and probes was used to perform real-time quantitative PCR detection using the probe method; The primer pair and probe combination includes upstream primer ISG75-F, downstream primer ISG75-R, and fluorescent probe ISG75-Probe; The nucleotide sequence of the upstream primer ISG75-F is shown in SEQ ID NO: 1; The nucleotide sequence of the downstream primer ISG75-R is shown in SEQ ID NO: 2; The nucleotide sequence of the fluorescent probe ISG75-Probe is shown in SEQ ID NO:

3.

2. The qPCR detection method for Trypanosoma eeris according to claim 1, characterized in that, The fluorescent probe ISG75-Probe has a fluorescent reporter group FAM labeled at its 5' end and a fluorescent quencher group BHQ1 labeled at its 3' end.

3. The qPCR detection method for Trypanosoma eeris according to claim 1, characterized in that, The primer pair amplified the target fragment of the Trypanosoma eigerentii ISG75 gene, which was 156 bp in size.

4. The qPCR detection method for Trypanosoma eeris according to claim 1, characterized in that, The qPCR reaction system has a total volume of 20 μL and includes: 10 μL of Premix Ex Taq (Probe qPCR) (2X), 0.4 μL of 10 μM upstream primer ISG75-F, 0.4 μL of 10 μM downstream primer ISG75-R, 0.4 μL of fluorescent probe ISG75-Probe, 0.2 μL of 50X ROX ReferenceDye, 1 μL of DNA template, and 7.6 μL of sterile water.

5. The qPCR detection method for Trypanosoma eeris according to claim 4, characterized in that, In the reaction system, the final concentrations of the upstream primer, downstream primer, and fluorescent probe were all 200 nM, the final concentration of Premix Ex Taq (Probe qPCR) was 1×, the final concentration of ROX Reference Dye was 1×, and the amount of DNA template used was <100 ng.

6. The qPCR detection method for Trypanosoma eeris according to claim 1, characterized in that, The qPCR reaction program is as follows: 95℃ pre-denaturation for 30 seconds, 1 cycle; 95℃ denaturation for 5 seconds, 59℃ annealing and extension for 34 seconds, 40 cycles.

7. The qPCR detection method for Trypanosoma eeris according to claim 1, characterized in that, The detection limit of the method is 7.14 × 10¹ copies / μL of Trypanosoma eeris ISG75 plasmid.

8. The use of the primer pair and probe combination according to claim 1 in the preparation of Trypanosoma eeris detection reagents or kits.

9. The application of the qPCR detection method for Trypanosoma eeris as described in any one of claims 1-7 in the clinical detection, epidemiological investigation, and pathogen screening of Trypanosoma eeris disease.