SNP molecular marker related to wet tolerance of brassica napus and application thereof
By using SNP molecular markers and KASP markers at chromosome 11872958 of rapeseed A04, the accuracy and efficiency of detecting rapeseed's tolerance to waterlogging were solved, enabling efficient identification of rapeseed's tolerance to waterlogging and marker-assisted breeding.
Patent Information
- Application Number
- CN202610417484.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-05-29
AI Technical Summary
In existing technologies, the number of SNP sites related to rapeseed's tolerance to waterlogging is limited, and the molecular mechanism is unclear. There is a lack of markers that can be used for marker-assisted breeding, which leads to a decline in the yield and quality of rapeseed under waterlogging stress.
This study provides an SNP molecular marker located at chromosome 11872958 of rapeseed A04. By designing a specific primer set for quantitative real-time PCR, and using KASP labeling technology to detect whether rapeseed is resistant to moisture damage, a detection kit and identification method were developed.
It enables accurate detection and identification of rapeseed's tolerance to moisture damage. The detection method is simple, fast, and low-cost, with high specificity and sensitivity. It is applicable to different detection equipment and the detection results are highly comparable.
Smart Images

Figure CN122104987A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and genetic breeding technology, and in particular to SNP molecular markers related to rapeseed's tolerance to moisture damage and their applications. Background Technology
[0002] Waterlogging, also known as flooding stress or moisture damage, is an abiotic stress caused by excessive soil moisture, which leads to a hypoxic or low-oxygen environment for plant roots or the entire plant, severely restricting plant growth and development. Since oxygen travels at only one ten-thousandth the speed in water compared to air, waterlogging is often accompanied by hypoxia, forcing plants to shift from efficient aerobic respiration to inefficient anaerobic respiration. This results in insufficient energy supply, accumulation of harmful metabolites, and ultimately, decreased root vigor, hindered photosynthesis, and reduced biomass accumulation.
[0003] Rapeseed, an important oilseed crop in my country, faces a particularly severe risk of waterlogging in its main producing area, the Yangtze River Basin. This region accounts for 90% of the national rapeseed planting area and commonly employs a rice-rapeseed rotation system. After rice harvest, the heavy, sticky soil and high water table, coupled with frequent spring rainfall and extreme weather events, make rapeseed highly susceptible to waterlogging stress during the germination and seedling stages. Studies have shown that waterlogging during germination significantly inhibits the length of the radicle, hypocotyl, and seedling fresh weight, affecting the establishment of basic seedlings. Waterlogging during the seedling stage leads to decreased root vitality, leaf chlorosis and reddening, and a reduced photosynthetic rate, resulting in decreased plant height, fewer effective branches, and fewer effective siliques. Yield analysis indicates that waterlogging stress can reduce the number of effective siliques in rapeseed by 31.81% to 78.02%, significantly reducing yield per plant. Waterlogging at maturity can even lead to a 38.2% reduction in rapeseed grain yield, a 13.1% decrease in oil content, and a 46.3% reduction in total oil production. In addition, waterlogging can cause lodging, exacerbate pests and diseases, and affect mechanized harvesting.
[0004] Faced with waterlogging stress, different rapeseed varieties exhibit significant genetic differences. Varieties with strong tolerance to waterlogging show stronger recovery growth after stress, with a rapid increase in adventitious root number, maintained root vigor at a high level, and lower malondialdehyde (MDA) content and wilting index. In terms of yield traits, the reduction in the number of effective branches, effective number per plant, and number of seeds per pod was significantly less in waterlogging-sensitive varieties than in those susceptible to waterlogging. Physiologically, plants regulate adventitious root formation through signaling molecules such as ethylene, auxin, and reactive oxygen species (ROS), and alleviate oxidative damage by increasing the activity of antioxidant enzymes such as catalase and glutathione peroxidase to remove excess ROS. At the molecular level, studies have shown that the ERF-VII family (e.g., RAP2.12) activates hypoxia-response genes via nuclear translocation from the plasma membrane, and the WRKY family (e.g., WRKY33) participates in redox regulation. Furthermore, epigenetic changes such as DNA methylation and histone modifications also play important roles in the waterlogging response.
[0005] With the development of molecular marker technology, single nucleotide polymorphism (SNP) markers have become important tools for crop genetic research and molecular breeding due to their wide distribution in the genome, genetic stability, and high detection throughput. SNP microarrays and genome-wide association studies (GWAS) have been widely used for gene mapping of important traits in rapeseed and the discovery of superior alleles. In the study of rapeseed waterlogging tolerance, previous studies have used recombinant inbred line populations for QTL mapping, detecting multiple QTL loci associated with waterlogging tolerance. In addition, GWAS analysis detected 26 SNP loci significantly associated with waterlogging tolerance in natural populations. However, the number of reported waterlogging-related QTLs and SNP loci is currently limited, the functions of most candidate genes have not been validated, the molecular mechanisms of rapeseed response to flooding stress remain unclear, and there is a lack of SNP markers that can be directly used for marker-assisted breeding. Summary of the Invention
[0006] In view of this, the purpose of this invention is to provide an SNP molecular marker related to rapeseed's tolerance to moisture damage and its application.
[0007] The specific technical solution is as follows: In a first aspect, the present invention provides an SNP molecular marker related to rapeseed's tolerance to moisture damage, wherein the SNP molecular marker is located at position 11872958 on the rapeseed A04 chromosome; the SNP base difference is A or G.
[0008] Furthermore, the sequence of the SNP molecular marker is shown in SEQ ID No. 1.
[0009] Secondly, the present invention provides a primer set for the above-mentioned molecular markers, the primer set comprising: The A / G site at sequence 11872958 shown in SEQ ID No. 1 was detected, which included: forward primer F1, forward primer F2, and universal reverse primer R1. The nucleotide sequence of forward primer F1 is 5'-GAAGGTGACCAAGTTCATGCTCCAGTAAGCAGAACATCTCCAGTA-3', the nucleotide sequence of forward primer F2 is 5'-GAAGGTCGGAGTCAACGGATTCCAGTAAGCAGAACATCTCCAGTG-3', and the nucleotide sequence of universal reverse primer R1 is 5'-ATGCAGGGATGTCTCAAACAATCG-3'.
[0010] Furthermore, tags for distinguishing the base types of their corresponding molecular marker sites are connected to the 5' ends of the forward primers F1 and F2, respectively.
[0011] Furthermore, a connector sequence is connected between the forward primer F1, the forward primer F2 and the tag.
[0012] Furthermore, the linker sequence between the 5' end of the forward primer F1 and the tag is GAAGGTGACCAAGTTCATGCT; Furthermore, the linker sequence between the 5' end of the forward primer F2 and the tag is GAAGGTCGGAGTCAACGGATT.
[0013] Furthermore, the tag used to distinguish the type of base at position 1187295 of the molecular marker is a fluorescent reporter group.
[0014] Preferably, the fluorescent reporter group is selected from FAM or HEX.
[0015] Thirdly, the present invention provides a detection kit comprising the aforementioned primer set.
[0016] Fourthly, the present invention also provides the application of a molecular marker, a primer set for detecting the molecular marker, or a detection kit in any of the following: (1) Identify rapeseed varieties resistant to moisture damage; (2) Cultivate improved rapeseed germplasm resources with resistance to moisture damage.
[0017] Fifthly, the present invention also provides a method for identifying whether rapeseed is resistant to moisture damage, comprising the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time PCR using the primer set or the detection kit, the fluorescence signal is read and analyzed, the genotype of the molecular marker is identified, and the rapeseed is determined to be resistant to moisture damage based on the genotype. If the genotype at molecular marker site 11872958 is AA or AG, then rapeseed is resistant to wet damage. If the genotype at molecular marker site 11872958 is GG, then rapeseed is not tolerant to wet damage. The molecular marker site 11872958 is located at 11872958 bp on chromosome A04 of the rapeseed genome, and the full genome sequence version of the rapeseed genome is Brassica_napus_Darmor_v4.1.
[0018] Furthermore, the real-time PCR reaction system for labeling the 11872958 bp site in this invention is as follows: 0.4 μL of 2×KASP Master Mix; 0.0054 μL of KASP mixed primers, where F1:F2:R1=2:2:5 (V / V / V); 0.8 μL of rapeseed sample DNA template at 10-50 ng / μL, dried; add sterile water to a total volume of 0.8 μL.
[0019] Furthermore, the fluorescence quantitative PCR reaction conditions for labeling the 11872958bp site in this invention are as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃-57℃ (annealing temperature decreases by 0.8℃ per cycle) for 60 seconds, 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 33 cycles.
[0020] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a molecular marker combination for identifying rapeseed's tolerance to moisture damage, which can accurately detect and identify rapeseed's tolerance to moisture damage and has wide applicability.
[0021] 2. This invention provides a detection method based on KASP markers, which can be used to detect the moisture resistance trait of rapeseed. The KASP marker detection method is simple, fast, and low in cost, and is suitable for different detection instruments and equipment.
[0022] 3. The detection method provided by this invention has high specificity, sensitivity and resolution; the labeling is not affected by environmental conditions, and seeds or any type of plant tissue can be used. The detection results are accurate, repeatable and stable; different testing laboratories and different data results can be compared and verified with each other, and the data has universal comparability. Attached Figure Description
[0023] Figure 1 Genotyping diagram for rapeseed moisture tolerance using molecular markers. Red clusters represent the AA genotype, blue clusters represent the GG genotype, and purple clusters represent the AG genotype.
[0024] Figure 2 The results show the detection of the molecular markers of this invention in 76 diverse materials; among which, Figure 2 A represents the relationship between the molecular marker genotype and the relative hypocotyl in this invention; Figure 2 Table B contains the statistical analysis results. Detailed Implementation
[0025] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.
[0026] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.
[0028] The rapeseed material used in this invention was obtained by the rapeseed team at Zhejiang University.
[0029] Example 1 In this case, through investigation and analysis of 198 rapeseed accessions for tolerance to waterlogging and genome-wide association studies, six SNP molecular markers related to rapeseed tolerance to waterlogging were screened.
[0030] The following indicators were used to compare the genotyping results of each SNP locus: Indicator 1: Phenotypic grouping ability of waterlogging damage; Indicator 2: KASP tagging's clustering ability.
[0031] Table 1 site Indicator 1 Indicator 2 S1 (This invention) Significant Significant (p<0.001) D1(632) Not significant Not significant (p = 0.506) D2(631) Not significant N / A D3(638) Significant Not significant (p = 0.423) D4(639) Significant Not significant (p = 0.743) D5(643) Significant Not significant (p = 0.061) The results showed that the SNP site (S1) at position 11,872,958 on chromosome A04 of the Brassica_napus_Darmor_v4.1 genome was significantly associated with moisture tolerance. This SNP site was a difference in base A / G. The nucleotide sequence of this SNP is shown in SEQ ID No.1. The 201st position of this sequence is the SNP site, and there is A / G diversity.
[0032] SEQ ID No. 1: GGAATCACATAGAAGAAAATGAAAACCTGAAGGTGGTGCAGGAAGCAGCCTTAAATTATTATTGGCAAAACTGCAGATAACTTTCAGACAATTAGTAAATTATCCTGACCACTCCATCAAGAATAAAACTAGGGACAAGGAGGGAACCTAACAGCAGTGAACTGAGAAAAGGAACCAGTAAGCAGAACATCTCCAGTR AGCCGATTGTTTGAGACATCCCTGCATGTCAGGATGATATCATTTTTGTCATAACCCAAGATTTCACAGACCAAATATTAATAAAAACTAACAGAATGATTCAGGAGAGACAAAGTCACACTCACAGAACTTGAAGCGACAACACATCCGTCAAGGACCTTGGAAGTTCTCCAGATAAAGCATTGTTATTAAGACGCC.
[0033] Example 2 2.1 KASP Tag Design and Synthesis Based on the obtained SNP site information, referring to chromosome 11872958 of the Brassica napus Darmor v4.1 genome, an A / G nucleotide polymorphism was found. Flanking sequences of 150 bp before and after this site were extracted. Primers were designed using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ). This KASP marker consists of three primers: two specific forward primers as shown in SEQ ID No. 2 and SEQ ID No. 3, and one universal reverse primer as shown in SEQ ID No. 4. The primer sequences are as follows: SEQ ID No.2: GAAGGTGACCAAGTTCATGCTCCAGTAAGCAGAACATCTCCAGTA; SEQ ID No.3: GAAGGTCGGAGTCAACGGATTCCAGTAAGCAGAACATCTCCAGTG; SEQ ID No. 4:ATGCAGGGATGTCTCAAACAATCG.
[0034] The two forward primers, SEQ ID No. 2 and SEQ ID No. 3, have universal tag sequences at their 5' ends, as shown in SEQ ID No. 5 and SEQ ID No. 6, respectively. These tag sequences can bind to the FAM or HEX fluorescent groups in the KASP Master Mix to generate a signal.
[0035] 2.2 Detection and Validation of Molecular Markers Molecular markers were validated and detected using Douglas Scientific's ArrayTape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for fluorescence signal scanning, and INTELLICS for data analysis.
[0036] PCR amplification system: The PCR amplification system was automatically assembled using NEXAR, and the PCR amplification system is shown in Table 2 below.
[0037] Table 2. PCR amplification system for KASP marker genotyping Components Final concentration Actual usage 100 μM Primer C 0.375μM 0.0030 μL 100 μM Primer X 0.15μM 0.0012 μL 100 μM Primer Y 0.15μM 0.0012 μL 2× KASP Master Mix 1× 0.4 μL Ultrapure water / 0.3946 μL DNA (DNA is added to a tape membrane and then dried) 10 ng-50 ng Total volume / 0.8 μL PCR amplification: PCR amplification was performed using SOELLEX under the following conditions: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃-57℃ (annealing temperature decreased by 0.8℃ per cycle) for 60 seconds, 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 33 cycles.
[0038] Signal scanning and genotyping: After the PCR reaction, the fluorescence signal of the reaction system was scanned using ARAYA, and then genotyping and data analysis were performed using INTELLICS. In the KASP marker genotyping detection, the genotypes of the samples were divided into three clusters: the FAM cluster, the VIC cluster, and the heterozygous genotype cluster (see...). Figure 1 The FAM cluster indicates that the sample contains a homozygous AA allele at this KASP marker site (marked in red in the upper left corner of the genotyping graph), the VIC cluster indicates that the sample contains a homozygous GG allele at this KASP marker site (marked in blue in the lower right corner of the genotyping graph), and the heterozygous genotype cluster indicates that the sample contains heterozygous A and G alleles at this marker site (marked in purple in the genotyping graph).
[0039] The molecular marker combinations were validated using 76 materials. The validation showed that homozygous and heterozygous clusters were well-typed and compact, with single-copy sites and a detection rate exceeding 99%. The detection results of the molecular marker combinations are as follows: Figure 2 As shown in Table 3, the test results of 76 samples with different genotypes are shown in Table 4, and the corresponding germplasm names and phenotypic information are shown in Table 4.
[0040] Table 3. Detection results of molecular markers on 76 samples Sample Name Genotyping results Phenotype JD0001 A:A Resistant to moisture damage JD0002 G:G Not resistant to moisture damage JD0003 G:G Not resistant to moisture damage JD0004 G:G Not resistant to moisture damage JD0005 G:G Not resistant to moisture damage JD0006 G:G Not resistant to moisture damage JD0007 G:G Not resistant to moisture damage JD0008 G:G Not resistant to moisture damage JD0009 G:G Not resistant to moisture damage JD0010 G:G Not resistant to moisture damage JD0011 A:A Resistant to moisture damage JD0012 G:G Not resistant to moisture damage JD0013 A:A Resistant to moisture damage JD0014 A:A Resistant to moisture damage JD0015 G:G Not resistant to moisture damage JD0016 A:A Resistant to moisture damage JD0017 A:A Resistant to moisture damage JD0018 G:G Not resistant to moisture damage JD0019 A:A Resistant to moisture damage JD0020 A:A Resistant to moisture damage JD0021 A:A Resistant to moisture damage JD0022 A:A Resistant to moisture damage JD0023 A:A Resistant to moisture damage JD0024 A:A Resistant to moisture damage JD0025 A:A Resistant to moisture damage JD0026 A:A Resistant to moisture damage JD0027 A:A Resistant to moisture damage JD0028 G:G Not resistant to moisture damage JD0029 A:A Resistant to moisture damage JD0030 G:G Not resistant to moisture damage JD0031 G:G Not resistant to moisture damage JD0032 G:G Not resistant to moisture damage JD0033 G:G Not resistant to moisture damage JD0034 A:A Resistant to moisture damage JD0035 A:A Resistant to moisture damage JD0036 A:A Resistant to moisture damage JD0037 A:A Resistant to moisture damage JD0038 A:A Resistant to moisture damage JD0039 A:A Resistant to moisture damage JD0040 A:A Resistant to moisture damage JD0041 G:G Not resistant to moisture damage JD0042 A:A Resistant to moisture damage JD0043 A:A Resistant to moisture damage JD0044 A:A Resistant to moisture damage JD0045 A:G Resistant to moisture damage JD0046 G:G Not resistant to moisture damage JD0047 A:A Resistant to moisture damage JD0048 A:A Resistant to moisture damage JD0049 A:A Resistant to moisture damage JD0050 A:A Resistant to moisture damage JD0051 G:G Not resistant to moisture damage JD0052 G:G Not resistant to moisture damage JD0053 A:A Resistant to moisture damage JD0054 A:A Resistant to moisture damage JD0055 G:G Not resistant to moisture damage JD0056 A:A Resistant to moisture damage JD0057 A:A Resistant to moisture damage JD0058 A:A Resistant to moisture damage JD0059 A:A Resistant to moisture damage JD0060 A:A Resistant to moisture damage JD0061 A:A Resistant to moisture damage JD0062 A:A Resistant to moisture damage JD0063 A:A Resistant to moisture damage JD0064 A:A Resistant to moisture damage JD0065 A:A Resistant to moisture damage JD0066 A:A Resistant to moisture damage JD0067 G:G Not resistant to moisture damage JD0068 A:A Resistant to moisture damage JD0069 A:A Resistant to moisture damage JD0070 A:G Resistant to moisture damage JD0071 A:A Resistant to moisture damage JD0072 A:A Resistant to moisture damage JD0073 A:A Resistant to moisture damage JD0074 A:A Resistant to moisture damage JD0075 A:A Resistant to moisture damage JD0076 A:A Resistant to moisture damage Table 4. Germplasm names and phenotypic information of 76 tested samples Sample Name Germplasm name Hypocotyl length CK Length W of the hypocotyl after water soaking treatment W / CK JD0001 R4463 3.26 0.1 0.030701754 JD0002 R4983 3.13 0.1 0.032 JD0003 R5142 2.48 0.1 0.040322581 JD0004 R5153 2.45 0.1 0.040816327 JD0005 R5057 2.25 0.1 0.044444444 JD0006 R5156 2.22 0.1 0.045045045 JD0007 R4580 2.00 0.1 0.05 JD0008 R5111 1.50 0.1 0.066666667 JD0009 R5145 1.45 0.1 0.068965517 JD0010 R4510 9.96 0.966666667 0.097054886 JD0011 R4376 2.60 0.675 0.259615385 JD0012 R5149 2.44 0.75 0.307017544 JD0013 R5017 2.13 0.7 0.329411765 JD0014 R4398 1.95 0.666666667 0.341880342 JD0015 R4247 3.08 1.08 0.350649351 JD0016 R4451 1.96 0.716666667 0.365646259 JD0017 R4971 2.72 1 0.367647059 JD0018 R4330 2.28 0.866666667 0.379562044 JD0019 R4910 1.55 0.6 0.387096774 JD0020 R5032 2.06 0.8 0.388349515 JD0021 R4877 1.26 0.5 0.396825397 JD0022 R4158 2.00 0.816666667 0.408333333 JD0023 R4239 1.80 0.75 0.416666667 JD0024 R4758 2.03 0.85 0.419753086 JD0025 R4420 2.06 0.875 0.424757282 JD0026 R4697 1.49 0.633333333 0.426282051 JD0027 R4810 1.64 0.7 0.426829268 JD0028 R5091 2.26 1 0.442477876 JD0029 R4638 2.40 1.075 0.447916667 JD0030 R4762 2.28 1.04 0.457142857 JD0031 R5112 2.20 1.014285714 0.461038961 JD0032 R4667 2.23 1.033333333 0.464419476 JD0033 R5027 2.14 1 0.46728972 JD0034 R5073 1.27 0.6 0.471910112 JD0035 R4272 1.94 0.92 0.474226804 JD0036 R4737 1.64 0.78 0.474782609 JD0037 R5003 2.10 1 0.476190476 JD0038 R4880 1.68 0.8 0.47761194 JD0039 R4601 2.30 1.114285714 0.48447205 JD0040 R4796 1.48 0.72 0.486486486 JD0041 R4474 2.53 1.233333333 0.486842105 JD0042 R5128 2.02 0.983333333 0.487603306 JD0043 R4191 2.22 1.083333333 0.488721805 JD0044 R4473 1.17 0.75 0.642857143 JD0045 R4258 1.68 1.083333333 0.64484127 JD0046 R4767 1.97 1.271428571 0.644927536 JD0047 R4794 1.32 0.85 0.64556962 JD0048 R4464 1.71 1.116666667 0.651388889 JD0049 R4500 1.87 1.216666667 0.651785714 JD0050 R4311 2.32 1.55 0.669064748 JD0051 R5087 1.25 0.85 0.68 JD0052 R4405 1.20 0.816666667 0.680555556 JD0053 R4904 1.70 1.166666667 0.68627451 JD0054 R4450 1.60 1.1 0.6875 JD0055 R4798 1.11 0.766666667 0.688034188 JD0056 R4977 1.82 1.25 0.688073394 JD0057 R4482 1.73 1.2 0.692307692 JD0058 R4817 1.18 0.82 0.694915254 JD0059 R4213 1.46 1.02 0.698630137 JD0060 R4180 1.48 1.04 0.701123596 JD0061 R4920 1.65 1.175 0.712121212 JD0062 R4640 1.65 1.185714286 0.718614719 JD0063 R4177 2.17 1.6 0.738461538 JD0064 R4507 1.67 1.24 0.744 JD0065 R4731 1.88 1.4 0.744680851 JD0066 R4801 1.52 1.15 0.756578947 JD0067 R5048 1.85 1.4 0.756756757 JD0068 R5161 2.30 1.825 0.793478261 JD0069 R4773 1.08 0.866666667 0.8 JD0070 R4415 1.68 1.4 0.831683168 JD0071 R4572 1.65 1.4 0.848484848 JD0072 R4324 1.77 1.5 0.849056604 JD0073 R4792 0.73 0.628571429 0.862745098 JD0074 R4870 1.78 1.566666667 0.878504673 JD0075 R4218 1.98 1.8 0.909090909 JD0076 R4484 2.12 1.925 0.909448819 The above results indicate that genotype AA corresponds to a phenotype of tolerance to moisture damage in rapeseed; genotype AG corresponds to a phenotype of tolerance to moisture damage in rapeseed; and genotype GG corresponds to a phenotype of intolerance to moisture damage. In 76 validation materials, the concordance rate between marker genotyping results and phenotype identification was as high as 100%. The KASP genotyping technology developed using the SNP loci in this invention can rapidly genotype the moisture damage tolerance trait in rapeseed, with accurate, efficient, and high-throughput detection, and can be used for marker-assisted selection.
Claims
1. SNP molecular markers associated with rapeseed's tolerance to moisture damage, characterized in that, The SNP molecular marker is located at position 11872958 on chromosome A04 of rapeseed; the SNP base difference is either A or G.
2. The SNP molecular marker related to rapeseed waterlogging tolerance as described in claim 1, characterized in that, The sequence of the SNP molecular marker is shown in SEQ ID No.
1.
3. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes: The A / G site at sequence 11872958 shown in SEQ ID No. 1 was detected, which included: forward primer F1, forward primer F2, and universal reverse primer R1. The nucleotide sequence of forward primer F1 is 5'-GAAGGTGACCAAGTTCATGCTCCAGTAAGCAGAACATCTCCAGTA-3', the nucleotide sequence of forward primer F2 is 5'-GAAGGTCGGAGTCAACGGATTCCAGTAAGCAGAACATCTCCAGTG-3', and the nucleotide sequence of universal reverse primer R1 is 5'-ATGCAGGGATGTCTCAAACAATCG-3'.
4. The primer set according to claim 3, characterized in that, The 5' ends of the forward primers F1 and F2 are respectively connected with tags used to distinguish the base types of their corresponding molecular marker sites.
5. The primer set according to claim 3, characterized in that, A connector sequence is connected between the forward primer F1, the forward primer F2 and the tag.
6. The primer set according to claim 5, characterized in that, The linker sequence between the 5' end of the forward primer F1 and the tag is GAAGGTGACCAAGTTCATGCT; The linker sequence between the 5' end of the forward primer F2 and the tag is GAAGGTCGGAGTCAACGGATT.
7. The primer set according to any one of claims 3 to 6, characterized in that, The tag used to distinguish the type of the base at position 1187295 of the molecular marker is a fluorescent reporter group; Preferably, the fluorescent reporter group is selected from FAM and HEX.
8. A test kit, characterized in that, The kit contains the primer set as described in any one of claims 3 to 7.
9. The use of the molecular marker as described in claim 1 or 2, the primer set as described in any one of claims 3 to 7, or the detection kit as described in claim 8 in any of the following: (1) Identify rapeseed varieties resistant to moisture damage; (2) Cultivate improved rapeseed germplasm resources with resistance to moisture damage.
10. A method for identifying whether rapeseed is resistant to moisture damage, characterized in that, Includes the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time PCR using the primer set of any one of claims 3 to 7 or the detection kit of claim 8. The fluorescence signal is read and analyzed to identify the genotype of the molecular marker. Based on the genotype, it is determined whether the rapeseed is resistant to moisture damage. If the genotype at molecular marker site 11872958 is AA or AG, then rapeseed is resistant to wet damage. If the genotype at molecular marker site 11872958 is GG, then rapeseed is not tolerant to wet damage. The molecular marker site 11872958 is located at 11872958 bp on chromosome A04 of the rapeseed genome, and the full genome sequence version of the rapeseed genome is Brassica_napus_Darmor_v4.1.