Molecular markers associated with acid detergent fiber content in alfalfa and uses thereof

By developing SNP genotyping C/A markers for chromosome Chr3 position 76671147 in alfalfa and using KASP detection, the problems of long breeding cycles and environmental interference in traditional breeding were solved, enabling early genotype screening and efficient breeding.

CN122104991APending Publication Date: 2026-05-29INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-04-14
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Traditional alfalfa breeding methods are time-consuming and easily affected by environmental factors, resulting in low breeding efficiency.

Method used

Molecular markers associated with the acid detergent fiber content of alfalfa were developed, specifically Chr3, position 76671147, SNP genotype C/A. KASP detection primer sets were designed, and materials were screened by KASP marker detection and genotyping.

Benefits of technology

Genotype screening can be completed during the seedling stage, shortening the breeding cycle, improving the accuracy and efficiency of target trait selection, and eliminating interference from environmental factors.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104991A_ABST
    Figure CN122104991A_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the acid detergent fiber content of alfalfa and application thereof. The present application aims to solve the problem of long breeding cycle in the traditional breeding mode. The technical scheme of the present application is a molecular marker related to the acid detergent fiber content of alfalfa, and the specific information is as follows: chromosome: Chr3; position: 76671147; SNP typing: C / A. The present application designs a KASP primer combination for the site, and specifically distinguishes and detects the A or C base of the SNP mutation site, thereby distinguishing the alfalfa materials with different ADF contents; the genotype screening can be completed at the seedling stage, and the selection can be performed without waiting for the plant to mature, thereby greatly shortening the breeding cycle.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to molecular markers related to the content of acid detergent fiber in alfalfa and their applications. Background Technology

[0002] In the alfalfa hay quality evaluation system, acid detergent fiber (ADF) content is a key indicator for measuring its digestibility, directly determining the efficiency of dairy cows' energy utilization from forage. ADF is mainly composed of cellulose and lignin; the lower the ADF content, the less lignified the alfalfa, and the higher the dry matter intake and digestibility. Studies have shown that for every 1 percentage point reduction in ADF, the average daily milk yield of dairy cows can increase by approximately 0.5 kg. Therefore, breeding alfalfa varieties with low ADF content is a core objective of forage breeding. However, traditional breeding selection methods mainly rely on field phenotypic identification, using visual assessment and chemical testing to screen superior individual plants. A complete selection cycle often takes 8 to 10 years and is easily affected by environmental conditions, resulting in low breeding efficiency. In contrast, marker-assisted selection (MAS) detects DNA molecular markers closely associated with ADF content, enabling genotypic screening at the seedling stage without waiting for plant maturity. This significantly shortens the breeding cycle, eliminates the interference of environmental factors, and significantly improves the accuracy and efficiency of target trait selection. Summary of the Invention

[0003] The technical problem that this invention aims to solve is the long cycle of traditional breeding methods.

[0004] The technical solution of this invention is a molecular marker related to the acid detergent fiber content of alfalfa, with the following specific information: Chromosome: Chr3; Location: 76671147; SNP type: C / A.

[0005] Specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No. 2.

[0006] The present invention also provides primer combinations for KASP detection and genotyping of the molecular markers, the nucleotide sequences of which are shown in SEQ ID No. 3-5.

[0007] The present invention also provides a molecular marker detection kit, comprising primers shown in SEQ ID No. 3-5.

[0008] The present invention also provides a molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

[0009] The present invention also provides the use of the molecular marker, the primer combination for amplifying the molecular marker, the kit and / or the molecular marker chip in any one of the following: a. Predict the acid detergent fiber content of alfalfa; b. Identification and screening of alfalfa with different acid detergent fiber contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

[0010] This invention also provides a method for screening alfalfa materials with different acid detergent fiber contents or predicting the acid detergent fiber content of alfalfa, comprising the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

[0011] Specifically, the amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0012] Specifically, the classification and screening criteria are as follows: if the classification result is AA, it is a material with low acid detergent fiber content; if the classification result is CC or AC, it is a material with high acid detergent fiber content.

[0013] The beneficial effects of this invention are as follows: This invention, through sequencing and analysis of 165 alfalfa germplasm materials, identified a SNP locus located near chromosome 76.67 Mb of the alfalfa genome (Chr3) that is significantly associated with ADF content. Detection primers were designed for this locus. The KASP primer combination developed in this invention was used to detect 78 materials, directly and specifically distinguishing and detecting the A or C bases at the SNP mutation site, thereby differentiating alfalfa materials with different ADF contents. Genotyping can be completed at the seedling stage, eliminating the need to wait for plant maturity, significantly shortening the breeding cycle, and eliminating interference from environmental factors, thus significantly improving the accuracy and efficiency of target trait selection. The molecular markers of this invention have good application value, enabling pre-selection of acid detergent fiber content in test materials and molecular-assisted breeding, which has important theoretical and practical significance for accelerating the genetic improvement process of alfalfa with low acid detergent fiber content. Attached Figure Description

[0014] Figure 1 1. Identification of sites significantly associated with ADF.

[0015] Figure 2 KASP marker typing results at Chr3_76671147 site.

[0016] Figure 3 Comparative analysis of ADF content in materials with different allelic genotypes. Detailed Implementation

[0017] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0018] Example 1: Obtaining Significantly Associated Sites The experimental population consisted of 165 alfalfa germplasm materials, representing different regions and phenotypes. Considering the variability among individual plants of the same alfalfa variety, cuttings were taken from the germplasm resource nursery in 2022 and propagated by cuttings in a greenhouse. After successful rooting, these germplasm materials were transplanted to experimental fields in Langfang, Hebei Province, and Changping, Beijing. In these experimental sites, a randomized block design was used to establish the experimental population, with three replicates, each containing 15 cuttings. To ensure sufficient growing space, the interval between replicates was 150 cm, and the distance between rows and plants was set to 150 cm and 60 cm, respectively. During the growing season, no fertilization or irrigation was applied; only manual weeding was performed. Winter watering was provided to help the plants overwinter.

[0019] Alfalfa was harvested at the initial flowering stage in two experimental plots. After harvesting, whole alfalfa plants were placed in nylon mesh belts and air-dried in a well-ventilated and shaded greenhouse, avoiding direct sunlight, until the stems became brittle and easily broken. These samples were then placed in a constant-temperature oven and dried thoroughly at 60°C for 6 hours. After drying, the samples were crushed using a cyclone mill to a particle size that could pass through a 40-mesh sieve, and packaged in resealable bags (keeping them dry and avoiding direct sunlight) for subsequent analysis. The acid detergent fiber content was then determined using a NIRS D2500F near-infrared spectroscopy system (three technical replicates, average value).

[0020] 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGIDNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0021] Each material yielded approximately 30.5 GB of raw data. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove the adapter and filter out low-quality base sequences. The cleaned sequencing data was then aligned to the haplotype reference genome of 'Zhongmu 1' alfalfa using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, resulting in filtered BAM files, which were then sorted. PCR repetitive sequences were marked using the Mark Duplicates function in the Picard toolkit (version 2.23.0). Finally, the processed BAM files were used for variant detection using GATK Haplotype Caller (version 4.2.3.062). The following parameters were set as screening criteria in the SNP filtering strategy: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, SOR (Strand Odds Ratio) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the selection criteria for a subset of alfalfa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a deletion rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter the basic SNP set based on linkage disequilibrium (LD), setting the LD filter window size to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2, to obtain a core SNP marker set. The missing genotypes in the LD-filtered SNP marker set were then filled using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a deletion rate less than 20% and a MAF greater than 0.05%.

[0022] GWAS analysis was performed using 2,821,247 high-quality SNP markers. To ensure the accuracy and reliability of the analysis, various software and statistical models were used: TASEEL 5.0 (GLM and MLM) (Bradbury PJ et al., 2007), BLINK (v1.01) (Huang et al., 2019). QQ plots (quantile-quantile plots) are used to measure the reliability of the model. By comparing QQ plots generated by different models, the GLM model in TASSEL 5.0 performed better. Therefore, the GLM model in TASSEL 5.0 was selected to present the final results. Principal component analysis was performed on the SNP data, and the first three principal component variables were used as covariates to correct for population structure. The Manhattan plot visualization was performed using the R package CMplot (Yin et al., 2021). A locus significantly associated with acid detergent fiber content was found on chromosome 3, with a LOD value of 7.98 and an explainable phenotypic contribution of 11.2%. Figure 1 ).

[0023] Example 2: Development of the KASP marker at the Chr3_76671147 locus The Chr3_76671147 locus is located near chromosome 76.67 Mb on the Chr3 chromosome of the alfalfa genome. The upstream and downstream reference sequences are shown in SEQ ID No. 1 and SEQ ID No. 2. Specific information about the Chr3_76671147 locus is as follows: Chromosome: chr3; Location: 76671147; SNP type: A / C.

[0024] SEQ ID No. 1, where lowercase letters represent SNP sites; CTCAATCAGATCTTTAGAGTTGTTAAGGTCGATGATCATTAAATTGTCAAGCCTCTGCAGGAAGAAAGAAACAACACATTGTTCAAAAATCATTAAAATTGGCTCATGAGCTTATACAAATGCATTTCGACAAACTAACAATAACAAGTATCTACCAACATTCCTTCAAAAAAAAAGTATATACAAACACGTTGATTAATTAATTTGTACaTGAATCCCATCCCAAAGCTTTCTAAGCTTGCTATGGGTCATGCTAAGTTGTACAAGCCATTTGGCACAAAAGGTTGATGGCAAAGACTCAAGTGGGAATGAATCCCAATAAAGGTGCCTCAATTTATCAGACAACCACTCAAGACCTTCAAGGAGGTGCACAGTGTACAATTCACACCTTAAGTAGAAGTCATTTATATTATTAGTGATATGAAGACATCTTAAGTTGGTCATGCTTTTGAAGCAATCAGAGCTCAAGTATAGATCTCCAATTTCTGAAATATTGAATAATATAACGTC。

[0025] SEQ ID No.2, where lowercase letters represent SNP sites; CTCAATCAGATCTTTAGAGTTGTTAAGGTCGATGATCATTAAATTGTCAAGCCTCTGCAGGAAGAAAGAAACAACACATTGTTCAAAAATCATTAAAATTGGCTCATGAGCTTATACAAATGCATTTCGACAAACTAACAATAACAAGTATCTACCAACATTCCTTCAAAAAAAAAGTATATACAAACACGTTGATTAATTAATTTGTACcTGAATCCCATCCCAAAGCTTTCTAAGCTTGCTATGGGTCATGCT AAGTTGTACAAGCCATTTGGCACAAAAGGTTGATGGCAAAGACTCAAGTGGGAATGAATCCCAATAAAGGTGCCTCAATTTATCAGACAACCACTCAAGACCTTCAAGGAGGTGCACAGTGTACAATTCACACCTTAAGTAGAAGTCATTTATATTATTAGTGATATGAAGACATCTTAAGTTGGTCATGCTTTTGAAGCAATCAGAGCTCAAGTATAGATCTCCAATTTCTGAAATATTGAATAATATAACGTC.

[0026] KASP primers were designed for the Chr3_76671147 site and flanking sequence using Bacthprimer 3 software. Each KASP marker consisted of two specific primers and one universal primer. Fluorescent adapter sequences were ligated to the 5' end of the specific primers (GAAGGTGACCAAGTTCATGCT is the FAM fluorescent adapter sequence; GAAGGTCGGAGTCAACGGATT is the HEX fluorescent adapter sequence).

[0027] Specific primer 1 (SEQ ID No. 3): GAAGGTGACCAA GTTCATGCTTAGAAAGCTTTGGGATGGGATTCAT; Specific primer 2 (SEQ ID No. 4): GAAGGTCGGAGTCAACGGATTTAG AAAGCTTTGGGATGGGATTCAG; Universal primer (SEQ ID No. 5): TGCATTTCGACAAACTAACAATAACA.

[0028] Example 3: Application of Chr3_76671147 site Seventy-eight alfalfa germplasm materials were planted (using the same planting method as in Example 1). Then, 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were then determined using a Nano Photometer NP80 (Germany).

[0029] KASP marker validation and detection were performed using Douglas Scientific's ArrayTape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for signal scanning, and INTELLICS for data analysis.

[0030] The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 1.

[0031] Table 1 KASP Reaction System

[0032] Primer C represents a universal primer, while Primer X and Primer Y represent specific primers 1 and 2, respectively. PCR amplification was performed using a SOELLEX instrument. The touch-down PCR amplification conditions were as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ per cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0033] After the PCR reaction was completed, the fluorescence signal of the reaction system was scanned using ARAYA; then, data analysis and genotyping were performed using INTELLICS. A schematic diagram of the marker genotyping is shown below. Figure 2 As shown in the table, red represents the AA allele at this locus, purple represents the A / C heterozygous type, and blue represents the CC allele. The allele types of the 78 germplasm materials at this locus are shown in Table 2. Subsequently, the acid detergent fiber content of the three allele types was statistically analyzed using the t-test method. It was found that the acid detergent fiber content of the AA allele was significantly lower than that of the A / C and CC types (P<0.01) (see Table 2). Figure 3 ).

[0034] Table 2. Allelic types of 78 germplasm materials at this locus.

[0035] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A molecular marker associated with the content of alfalfa acid detergent fiber, characterized in that: The specific information is as follows: Chromosome: Chr3; Location: 76671147; SNP type: C / A.

2. The molecular marker according to claim 1, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or SEQ ID No.

2.

3. Primer combinations for KASP detection and typing of the molecular markers described in claim 1 or 2, the nucleotide sequences of which are shown in SEQ ID No. 3-5.

4. A molecular marker detection kit, characterized in that: Includes the primers shown in SEQ ID No. 3~5.

5. A molecular marker chip, characterized in that: Includes the primers shown in SEQ ID No. 3~5.

6. The use of the molecular marker of claim 1 or 2, the primer combination of claim 3, the kit of claim 4, and / or the molecular marker chip of claim 5, in any one of the following: a. Predict the acid detergent fiber content of alfalfa; b. Identification and screening of alfalfa with different acid detergent fiber contents; c. Molecular marker-assisted breeding of alfalfa; d. Alfalfa breeding; e. Prepare products for alfalfa breeding.

7. A method for screening alfalfa materials with different acid detergent fiber contents or predicting the acid detergent fiber content of alfalfa, characterized in that: The process includes the following steps: extracting genomic DNA from the alfalfa material to be tested, amplifying molecular markers using primers described in SEQ ID No. 3~5, sequencing the amplified products, and screening by typing.

8. The method according to claim 7, characterized in that: The amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by -0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

9. The method according to claim 7, characterized in that: The classification and screening criteria are as follows: if the classification result is AA, it is a material with low acid detergent fiber content; if the classification result is CC or AC, it is a material with high acid detergent fiber content.