SNP molecular marker related to acid content of sesame seed oil and application

Abstract

The application discloses a SNP molecular marker related to the content of oleic acid in sesame seeds and application, and belongs to the technical field of molecular marker breeding. The SNP molecular marker related to the content of oleic acid in sesame seeds is located at 2754308 bp of the No. 3 chromosome, the genotype GG corresponds to the content of oleic acid which is significantly higher than that of AA (the difference reaches the extremely significant level of 0.01), and the accurate differentiation of high / low oleic acid germplasm can be realized. Early genotype identification can be carried out at the seedling stage of sesame by using the marker, and the breeding cycle is greatly shortened and the selection efficiency is improved without waiting for seed maturation. The marker is stable and reliable under different genetic backgrounds, is less affected by the environment, and is simple, high-flux and low-cost in detection, is suitable for large-scale automatic screening, can be directly used for molecular marker assisted selection of high-oleic-acid sesame varieties, accelerates the cultivation of high-quality new varieties, and has important application value for improving the sesame oil quality and market competitiveness.

Description

Technical Field

[0001] This invention relates to the field of molecular marker breeding technology, and in particular to an SNP molecular marker related to the oleic acid content of sesame seeds and its application. Background Technology

[0002] Oleic acid is the most essential unsaturated fatty acid in sesame seed oil, and it is a key indicator determining the quality, nutritional characteristics, and processing stability of sesame oil. As a monounsaturated fatty acid, oleic acid has strong oxidative stability and good storage resistance, which can effectively improve the shelf life and processing suitability of sesame products. At the same time, sesame oil rich in oleic acid has excellent nutritional value, can regulate human lipid metabolism, and enhance antioxidant capacity, meeting the market demand and consumption trends of high-quality oilseed crops.

[0003] In sesame production and breeding practices, significant genetic variations in seed oleic acid content exist among different genotypes. These differences are primarily determined by genetic factors and form a crucial foundation for quality improvement. Traditional high-oleic acid sesame breeding relies on phenotypic identification, which suffers from limitations such as long cycles, low efficiency, significant environmental influences, and low selection accuracy. This hinders rapid and precise quality improvement and severely restricts the breeding process of high-quality sesame varieties.

[0004] SNP molecular markers, as third-generation molecular markers, have advantages such as abundant quantity, genetic stability, convenient detection, and high-throughput automated analysis, and have become a core tool for precision breeding of quality traits in oil crops. Developing functional SNP markers closely related to oleic acid content in sesame seeds enables early identification of target traits at the seedling stage, allowing for the selection of high-quality individual plants without waiting for seed maturity, significantly improving breeding selection efficiency and reducing field workload and breeding costs.

[0005] Currently, there is a lack of efficient and practical SNP markers for the oleic acid content trait in sesame, and existing markers are insufficient to meet the actual needs of sesame quality breeding. Therefore, identifying SNP molecular markers significantly associated with oleic acid content and establishing a supporting molecular marker-assisted selection technology system is of significant theoretical and practical value for accelerating the breeding of new high-oleic acid, high-quality sesame varieties and promoting the upgrading of sesame oilseed quality. Summary of the Invention

[0006] The purpose of this invention is to provide an SNP molecular marker and its application related to the oleic acid content of sesame seeds, so as to solve the problems existing in the prior art.

[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an SNP molecular marker related to the oleic acid content of sesame seeds, wherein the SNP molecular marker is located at 2754308 bp on chromosome 3 of the sesame genome.

[0008] The second technical solution of the present invention is the application of the SNP molecular marker in the identification or auxiliary identification of oleic acid content in sesame seeds.

[0009] The third technical solution of the present invention is a method for identifying the oleic acid content of sesame seeds using the SNP molecular marker, wherein the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of the sesame sample to be identified is detected, and the oleic acid content of the sesame seeds is determined based on the genotype.

[0010] The fourth technical solution of the present invention is the application of the SNP molecular marker in the cultivation of new sesame varieties with high oleic acid content.

[0011] The fifth technical solution of the present invention is a method for breeding new sesame varieties with high oleic acid content, comprising the following steps: detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of sesame samples, and selecting germplasm with the genotype GG for breeding.

[0012] Based on the above technical solution, the present invention has the following technical effects: The SNP molecular marker related to oleic acid content in sesame seeds provided by this invention is located at 2754308 bp on chromosome 3. The genotype GG corresponds to a significantly higher oleic acid content than AA (the difference reaches a highly significant level of 0.01), enabling precise differentiation between high / low oleic acid germplasm. This marker can be used for early genotyping of sesame seedlings without waiting for seed maturity, significantly shortening the breeding cycle and improving selection efficiency. The marker is stable and reliable under different genetic backgrounds, is less affected by the environment, and the detection method is simple, high-throughput, and low-cost, making it suitable for large-scale automated screening. It can be directly used for marker-assisted selection of high-oleic acid sesame varieties, accelerating the breeding of high-quality new varieties and having important application value for improving the quality and market competitiveness of sesame oil. Attached Figure Description

[0013] Figure 1 This is the phenotypic analysis result in Example 1 of this application.

[0014] Figure 2 This is the analysis result of the phenotype and genotype association in Example 1 of this application.

[0015] Figure 3 This is the result of the phenotypic and genotypic association analysis in Example 2 of this application. Detailed Implementation

[0016] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0017] This invention provides an SNP molecular marker related to the oleic acid content of sesame seeds, wherein the SNP molecular marker is located at 2754308 bp on chromosome 3 of the sesame genome.

[0018] In some specific implementations, the SNP molecular markers include genotypes AA and GG.

[0019] This invention also provides the application of the SNP molecular marker in the identification or auxiliary identification of oleic acid content in sesame seeds.

[0020] This invention also provides a method for identifying the oleic acid content of sesame seeds using the SNP molecular marker, which involves detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of the sesame sample to be identified, and determining the oleic acid content of the sesame seeds based on the genotype.

[0021] In some specific implementation schemes, the method for determining the oleic acid content of sesame seeds based on genotype is as follows: the oleic acid content of samples with genotype GG is significantly higher than that of samples with genotype AA.

[0022] This invention also provides the application of the SNP molecular marker in the cultivation of new sesame varieties with high oleic acid content.

[0023] This invention also provides a method for breeding new sesame varieties with high oleic acid content, comprising the following steps: detecting the genotype of the single nucleotide polymorphism site corresponding to the SNP molecular marker in the genomic DNA of sesame samples, and selecting germplasm with the genotype GG for breeding.

[0024] Example 1 Acquisition of SNP markers associated with oleic acid content in sesame seeds 1. The sesame materials used in this invention comprise a natural population of 423 sesame germplasm resources, including black and white sesame. All materials were cultivated at the Dishan Experimental Station of the Grain and Oil Crops Research Institute of the Hebei Academy of Agricultural and Forestry Sciences. Each material was replicated three times. Sowing took place in early May, and harvesting took place at the end of August. The materials were stored at room temperature for experimental use.

[0025] 2. Sample processing and phenotypic analysis The oleic acid content of the 376 final samples (see Table 1) was determined using a DA7250 near-infrared spectrometer. The specific method was as follows: ① After cleaning impurities from the samples, they were placed into sample cups and leveled; ② The sample cups were placed on the sample stage, fixed in place, and the measurement was started. The instrument automatically scanned, and each sample was measured twice in parallel, and the average value was taken. The phenotypic analysis results are as follows: Figure 1 As shown in the figure, the population phenotype selected in this invention follows a normal distribution, and subsequent analysis can be performed using parametric statistical methods.

[0026] Of the 376 samples, 171 were common sesame varieties sold in Zhengzhou, Henan Province; 103 were common sesame varieties sold in Wuhan, Hubei Province; and 102 were local varieties from Hebei Province.

[0027] Table 1 Varieties of 102 Samples

[0028] 3. Genotype data collection and analysis Genotypic data for all samples were obtained through resequencing. The sesame reference genome version was Zhongzhi13_v2.0. The data volume for this analysis was 1671.70 Gbp of clean data, with a Q30 of 92.88%. The average alignment rate between the samples and the reference genome was 86.30%, the average coverage depth was 4X, and the genome coverage was 93.87%.

[0029] 4. Genome-wide association analysis and locus mining Using GEMMA (lm model) combined with phenotypic and genotypic data, genome-wide association analysis was performed to identify loci associated with oleic acid content. The formula for the mixed linear model (LM) in GEMMA software is as follows: y=Wα+xβ+μ+e Candidate threshold selection was performed using 0.1 and 0.01 divided by the number of effective marker sites after the quality control. To uncover more potential candidate regions, values ​​within -log10(p) = 5 were further fixed as candidate regions. Functional annotation was performed on the candidate genes selected by the above threshold selection.

[0030] GWAS results showed that the SNP at 2754308 bp on chromosome 3 could effectively distinguish the oleic acid content of the population. The average oleic acid content of seeds with genotype AA was 53.10%, while the average oleic acid content of seeds with genotype GG was 54.69%, with a difference reaching a significant level of 0.01 (see [link to GWAS results]). Figure 2 This demonstrates that the base AA at 2754308bp on chromosome 3 is highly effective in identifying low oleic acid content in sesame seeds, while GG is highly effective in identifying high oleic acid content in sesame seeds.

[0031] SEQ ID NO.1: TTTGGTCCTGTAAAACTGAAAACTTCGCAATTTCAGTCCAAATTTGGCTG G AAAATTTTGTGGGTCGCCGGAAAAATTTACATGCAATGCATGTGACTTTT.

[0032] Note: The underlined positions are SNP sites.

[0033] Example 2 SNP verification 1. A hybrid combination was constructed using Jihangzhi 2 (oleic acid content 55.5%) as the female parent and Jizhi 9 (oleic acid content 79.8%) as the male parent. Hybridization was completed in Shijiazhuang, Hebei Province in the summer of 2024. F1 plants were then planted in Sanya, Hainan Province in the winter of the same year, self-pollinated, and F2 plants were harvested. In the summer of 2025, these F2 plants were planted in Shijiazhuang, Hebei Province, resulting in 169 individual plants, managed using conventional field methods. The oleic acid content of seeds from both the parental lines and the F2 population was investigated.

[0034] 2. DNA was extracted from the parental lines and F2 single plants using the CTAB method. DNA integrity was detected by agarose gel electrophoresis, and DNA concentration was determined using NanoDrop 2000.

[0035] 3. SNPs of the population were developed using resequencing technology. The experimental procedure was performed according to the standard protocol provided by Illumina, including sample quality testing, library construction, library quality testing, and library sequencing.

[0036] 4. According to LI et al. (High-density genetic linkage map construction by F2populations and QTL analysis of early-maturity traits in upland cotton( Gossypium hirsutumData analysis methods were used to filter the machine data, and high-quality sequences were aligned to the sesame reference genome using BWA (0.7.17) software (Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 2009, 25(14): 1754-1760.). SNP markers were identified using GATK (4.0.11.0) software (The genomeanalysis toolkit: a MapReduce framework for analyzing next-generation DNAsequencing data. Genome Research, 2010, 20: 1297-1303.).

[0037] 5. The bases at position 2754308 bp on chromosome 3 of F2 individual plants were detected, and the F2 population was genotyped. The results showed that the average oleic acid content in the seeds of F2 individual plants with genotype AA was 53.10%, while the average oleic acid content in the seeds of F2 individual plants with genotype GG was 54.69%, a difference of approximately 1.59%, which reached a statistically significant level of 0.01. Figure 3 This proves that the base AA at position 2754308bp on chromosome 3 can identify and detect low oleic acid content in sesame seeds, while GG can identify and detect high oleic acid content in sesame seeds.

[0038] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. The application of SNP sites in identifying oleic acid content in sesame seeds, characterized in that, The SNP site is located at 2754308 bp on chromosome 3 of the sesame genome; The sesame reference genome version is Zhongzhi13_v2.0; The SNP locus has genotypes AA and GG, and the oleic acid content of the sample with genotype GG is significantly higher than that of the sample with genotype AA.

2. A method for identifying oleic acid content in sesame seeds using SNP sites, characterized in that, The genotype of the SNP sites in the genomic DNA of the sesame sample to be identified is detected, and the oleic acid content of the sesame seeds is determined based on the genotype. The SNP site is located at 2754308 bp on chromosome 3 of the sesame genome; The sesame reference genome version is Zhongzhi13_v2.0; The SNP locus contains genotypes AA and GG; The method for determining the oleic acid content of sesame seeds based on genotype is as follows: the oleic acid content of samples with genotype GG is significantly higher than that of samples with genotype AA.

Images