Nucleic acid drugs targeting lncSULT1C2 and their application in the treatment of liver cancer
By using the ASO-lncSULT1C2 conjugate coupled with GalNAc and utilizing the ASGPR receptor-mediated endocytosis pathway, we achieved highly efficient targeted delivery and knockdown of lncSULT1C2 in liver cancer cells, solving the problem of targeted delivery in liver cancer treatment, significantly inhibiting liver cancer cell growth and slowing tumor progression.
Patent Information
- Application Number
- CN202610430157.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-02
- Publication Date
- 2026-06-02
AI Technical Summary
Existing technologies have difficulty effectively targeting and knocking down lncSULT1C2, which is specifically highly expressed in liver cancer cells, resulting in poor treatment outcomes for liver cancer.
Using a GalNAc-conjugated ASO-lncSULT1C2 conjugate, liver-targeted delivery was achieved via the endocytosis pathway mediated by the ASGPR receptor specifically expressed on the hepatocyte membrane surface, by specifically knocking down the abnormally high expression of lncSULT1C2 in hepatocellular carcinoma cells.
It achieves highly efficient targeted delivery and knockdown of lncSULT1C2 in liver cancer cells, significantly inhibits liver cancer cell growth, slows tumor progression, avoids damage to normal liver cells, and is convenient to administer, avoiding local damage caused by intravenous injection.
Smart Images

Figure CN122124084A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of tumor treatment, and in particular to nucleic acid drugs targeting lncSULT1C2 and their application in the treatment of liver cancer. Background Technology
[0002] Long non-coding RNA Coding RNA (lncRNA) is a class of non-coding RNA molecules with a sequence length greater than 200 nucleotides. They do not encode proteins or have very weak protein-coding capabilities, and primarily exert their biological functions in cells as RNA. Recent studies have shown that lncRNAs regulate gene expression at multiple levels, including epigenetics, transcription, and post-transcriptional processes, and are widely involved in important biological processes such as cell proliferation, differentiation, and apoptosis. Dysregulation of lncRNA expression is closely related to the occurrence and development of various diseases, particularly in the field of oncology. Many lncRNAs have been confirmed to function as oncogenes or tumor suppressor genes, and have become highly promising novel biomarkers for disease diagnosis and therapeutic targets.
[0003] siRNA / ASO-mediated RNA interference technology has shown broad application prospects in the treatment of oncological, metabolic, infectious, and neurological diseases. However, achieving effective interference in vivo as a therapeutic molecule requires overcoming multiple biological barriers, including delivery via receptor-mediated endocytosis, lysosomal escape, and resistance to nuclease degradation. Therefore, developing efficient and safe targeted delivery systems is a core challenge for the clinical translation of RNA interference therapy.
[0004] N-Acetylgalactosamine (GalNAc) is a hydrocarbon compound that specifically binds to the Asialoglycoprotein receptor (ASGPR) on the surface of hepatocytes, targeting and delivering GalNAc-conjugated siRNA / ASO into hepatocytes. [1,2] .
[0005] Therefore, there is an urgent need for a method to target and knock down lncRNAs that are specifically highly expressed in liver cancer cells by GalNAc-coupled ASO, thereby inhibiting the growth of liver cancer cells in vivo.
[0006] References: [1] Springer, AD&Dowdy, SF GalNAc-siRNA Conjugates: Leading the Way for Delivery of RNAi Therapeutics. Nucleic Acid Ther 28, 109-118 (2018). [2] Zhang, L. et al. The therapeutic prospects of N-acetylgalactosamine-siRNA conjugates. Front Pharmacol 13, 1090237 (2022). Summary of the Invention
[0007] This application uses lncSULT1C2, a non-coding RNA molecule that is specifically highly expressed in hepatocellular carcinoma and is the first to be identified, as a therapeutic target. It provides a nucleic acid drug that targets lncSULT1C2 and its application in the treatment of liver cancer. The delivery system achieves liver-targeted delivery of the GalNAc-ASO-lncSULT1C2 conjugate through the endocytosis pathway mediated by ASGPR specifically expressed on the surface of hepatocyte membranes. The therapeutic purpose is achieved by specifically knocking down the abnormally high expression of lncSULT1C2 in hepatocellular carcinoma cells.
[0008] In a first aspect, this application provides the application of a reagent for knocking down lncSULT1C2 expression in the preparation of drugs for tumor treatment, employing the following technical solution: The application of a reagent for knocking down lncSULT1C2 expression in the preparation of a drug for cancer treatment, wherein the nucleotide sequence of lncSULT1C2 is shown in SEQ ID NO.7.
[0009] Optionally, the reagent includes nucleic acid drugs; preferably, the nucleic acid drugs are selected from antisense oligonucleotides.
[0010] Optionally, the tumor is liver cancer; preferably, the liver cancer is hepatocellular carcinoma.
[0011] Secondly, this application provides an antisense oligonucleotide for treating liver cancer, employing the following technical solution: An antisense oligonucleotide for treating liver cancer, the antisense oligonucleotide comprising a nucleotide sequence complementary to the bases of lncSULT1C2, the nucleotide sequence of which is shown in SEQ ID NO.7.
[0012] Optionally, the nucleotide sequence of the antisense oligonucleotide is shown in SEQ ID NO.8.
[0013] Optionally, the nucleotide sequence of the antisense oligonucleotide is chemically modified; preferably, the chemical modification is selected from one or more of LNA modification or PS phosphate thiophosphate backbone modification; more preferably, the antisense oligonucleotide is modified with PS phosphate thiophosphate backbone and LNA modification is performed on 5 bases at each end of the antisense oligonucleotide.
[0014] Optionally, the antisense oligonucleotide is coupled to GalNAc at its 3' end.
[0015] Thirdly, this application provides a drug delivery system comprising the above-mentioned antisense oligonucleotide and delivery vector; preferably, the delivery vector is selected from GalNAc.
[0016] Fourthly, this application provides a pharmaceutical composition for treating liver cancer, employing the following technical solution: A pharmaceutical composition for treating liver cancer, comprising the above-described antisense oligonucleotide or the above-described drug delivery system; preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients.
[0017] Fifthly, this application provides the use of the above-described antisense oligonucleotide, the above-described drug delivery system, or the above-described pharmaceutical composition in the preparation of liver cancer drugs.
[0018] Optionally, the drug is administered via subcutaneous injection.
[0019] This application includes at least one of the following beneficial technical effects: 1. lncSULT1C2 is specifically highly expressed in liver cancer cells, but almost not expressed in normal liver cells, and has significant pro-cancer activity; 2. Hepatocytes specifically express the ASGPR receptor on their membrane surface. The ASGPR receptor is highly abundant on the hepatocyte membrane surface, with a single-cell expression level of approximately 500,000 copies. This extremely high expression abundance provides ample molecular docking sites for targeted delivery systems. GalNAc can specifically bind to the ASGPR receptor. By coupling GalNAc with ASO-lncSULT1C2 and specifically targeting and delivering it into hepatocytes via receptor-mediated endocytosis, the hepatocyte-specific knockdown of lncSULT1C2 is achieved, ensuring high efficiency and reliability of drug delivery. Furthermore, since lncSULT1C2 is almost not expressed in normal hepatocytes, damage to normal hepatocytes is avoided. 3. By modifying ASO-lncSULT1C2 with 5 bases at each end, the in vivo stability and target affinity of ASO were significantly improved. 4. GalNAc-ASO-lncSULT1C2 is mainly administered via subcutaneous injection. Compared to intravenous injection using conjugation technologies such as LNP, it offers advantages such as convenient administration and avoidance of damage to local skin and blood vessels caused by intravenous administration. 5. In a mouse model of orthotopic liver xenografts, mice treated with GalNAc-ASO-lncSULT1C2 showed a significant tumor growth slowdown compared to the control group; at the same time, the intrahepatic metastasis ability of orthotopic liver xenografts was weakened. This indicates that targeting the lncSULT1C2 molecule, which is specifically highly expressed in hepatocellular carcinoma, using the GalNAc-ASO-lncSULT1C2 system can effectively inhibit the progression of hepatocellular carcinoma.
[0020] In summary, this application provides a novel therapeutic target for the treatment of hepatocellular carcinoma and develops an ASO-based targeted therapy regimen, ultimately aiming to inhibit hepatocellular carcinoma. This has significant clinical translational value and application prospects. Attached Figure Description
[0021] Figure 1a This is the intersection diagram of the non-coding transcript with unique sequence characteristics in Example 1 of this application and the transcript that is highly expressed in liver cancer tissue and has a poor prognosis in liver cancer patients; Figure 1b This is a frequency graph of the expression of eight non-coding transcripts in liver cancer tissue in Example 1 of this application; Figure 1c This is a statistical graph showing the RNA expression level of lncSULT1C2 in 211 pairs of liver cancer and adjacent normal tissues in Example 1 of this application; Figure 1d This is a statistical graph showing the RNA expression levels of lncSULT1C2 in 40 pairs of liver cancer and adjacent normal tissues in Example 1 of this application; Figure 1e This is a graph showing the correlation between the expression level of lncSULT1C2 and the overall survival of liver cancer patients in Example 1 of this application; Figure 2a This is a cell proliferation curve from the CCK-8 experiment in Example 2 of this application; Figure 2b The images (left) and statistical chart (right) of the colony formation experiment in Embodiment 2 of this application are shown. Figure 2c The image shows the fluorescence photographs (left) and statistical graphs (right) of the EdU experiment in Example 2 of this application. Figure 2d The flow cytometry results (left) and statistical graph (right) of the apoptosis experiment in Example 2 of this application are shown. Figure 2e This is a diagram showing the results of the cell cycle experiment in Example 2 of this application; Figure 2f The images (left) and statistical graph (right) of the Transwell experiment in Example 2 of this application are shown. Figure 3a These are cell proliferation curves from the CCK-8 experiment in Example 3 of this application, where the left graph is the proliferation curve of HuH-7 cells and the right graph is the proliferation curve of HepG2 cells; Figure 3b These are the results and statistical graphs of the colony formation experiment in Example 3 of this application. The left image is the result of fluorescence microscopy, the middle image is the statistical graph of HuH-7 cells, and the right image is the statistical graph of HepG2 cells. Figure 3c These are the results and statistical charts of the EdU experiment in Example 3 of this application. The left figure is the result of fluorescence microscopy, the middle figure is the statistical chart of the positive proportion of HuH-7 cells, and the right figure is the statistical chart of the positive proportion of HepG2 cells. Figure 3d These are the results and statistical charts of the Transwell experiment in Example 3 of this application. The left image is a microscopic photograph, the middle image is a statistical chart of the number of HuH-7 cells, and the right image is a statistical chart of the number of HepG2 cells. Figure 4a This is a diagram of the subcutaneous xenograft tumor of MHCC97H cells knocked down with lncSULT1C2 in Example 4 of this application; Figure 4b This is a growth curve of a subcutaneous xenograft tumor in which MHCC97H cells knocked out lncSULT1C2 in Example 4 of this application. Figure 4c This is a statistical chart of the weight of the subcutaneous xenograft tumor of MHCC97H cell knockdown lncSULT1C2 in Example 4 of this application; Figure 4d This is a statistical chart of the number of Ki67 positive cells in Example 4 of this application; Figure 4e This is the Ki67 immunohistochemical staining image from Example 4 of this application; Figure 5a This is a diagram of a subcutaneous xenograft tumor in HuH-7 cells overexpressing lncSULT1C2, as shown in Example 5 of this application. Figure 5b This is a growth curve of a subcutaneous xenograft tumor in HuH-7 cells overexpressing lncSULT1C2 in Example 5 of this application; Figure 5c This is a statistical chart of the weight of subcutaneous xenografts of HuH-7 cells overexpressing lncSULT1C2 in Example 5 of this application; Figure 6a This is a schematic diagram of the spontaneous hepatocellular carcinoma tumor model in Embodiment 6 of this application; Figure 6bThis is a statistical graph showing the effect of lncSULT1C2 overexpression on liver weight, liver weight / body weight ratio, number of tumors, and maximum tumor diameter in spontaneous tumor mice in Example 6 of this application; Figure 6c This is a gross view of the effect of lncSULT1C2 overexpression on spontaneous tumor growth in liver cancer in Example 6 of this application; Figure 7a This is the HE staining diagram from Example 7 of this application; Figure 7b This is a statistical chart showing the number of intrahepatic metastatic tumors after knocking down lncSULT1C2 in Example 7 of this application; Figure 7c This is a statistical chart showing the number of lung metastases after knocking down lncSULT1C2 in Example 7 of this application; Figure 8a This is a schematic diagram of the GalNAc-ASO-lncSULT1C2 treatment experiment in Example 8 of this application; Figure 8b This is an in vivo imaging (left) and a statistical graph of the experimental results (right) of the GalNAc-ASO-lncSULT1C2 treatment experiment in Example 8 of this application. Figure 8c This is a HE staining of liver tissue from the GalNAc-ASO-lncSULT1C2 treatment experiment in Example 8 of this application (left) and a statistical graph of the experimental results (right). Figure 8d This is an immunofluorescence staining image (left) and a statistical graph of experimental results (right) of TUNEL and Ki67 cells in tumor tissue treated with GalNAc-ASO-lncSULT1C2 in Example 8 of this application. Figure 8e This is a graph showing the weight (left) and liver weight (right) of mice in the GalNAc-ASO-lncSULT1C2 treatment group and control group in Example 8 of this application. Detailed Implementation
[0022] The following examples provide further detailed description of this application, but these examples do not limit this application in any way.
[0023] Unless otherwise specified, the materials and equipment used in the various embodiments of this application are all commercially available products in the art.
[0024] Example 1 lncSULT1C2 is highly expressed in hepatocellular carcinoma tissues and is closely associated with poor prognosis in hepatocellular carcinoma patients. First, third-generation sequencing of liver cancer and adjacent tissue samples revealed 77 protein-coding transcripts that performed non-coding functions; among them, 8 transcripts had specific sequence characteristics, were highly expressed in liver cancer tissues, and were closely associated with poor prognosis in liver cancer patients. Figure 1a (1b). Since lncSULT1C2 (TCONS 00269335) was expressed most frequently in liver cancer tissues, it was selected as the subject of subsequent research.
[0025] Furthermore, 211 pairs of liver cancer and adjacent tissues (including 23 pairs of liver cancer and adjacent tissues) were analyzed. [3] RNA expression levels of TCGA_LIHC50, GSE94660, GSE124535, GSE77314, and GSE138485, as well as 40 pairs of liver cancer and adjacent normal liver tissues (from a hospital in Qidong City), were detected. The results showed that lncSULT1C2 was specifically expressed in liver cancer tissues, while almost no expression was observed in the corresponding normal liver tissues. Figure 1c Therefore, it provides a good therapeutic target for specific targeting of liver cancer. Furthermore, analysis of TCGA clinical data revealed a significant correlation between high expression of lncSULT1C2 and poor prognosis in liver cancer patients. Figure 1e This further enhances the significance of targeted lncSULT1C2 therapy.
[0026] [3]Chen, Z. et al. Long-read transcriptome landscapes of primary and metastatic liver cancers at transcript resolution. Biomark Res 12, 4 (2024). Example 2 Biological function of lncSULT1C2 knockdown in hepatocellular carcinoma (HCC) cells 1. Cell Culture MHCC97H cells were cultured in a 37°C, 5% CO2 incubator using complete medium (DMEM medium + 10% FBS + 1% penicillin-streptomycin). The MHCC97H cells mentioned above were obtained from the Cell Bank of the Chinese Academy of Sciences.
[0027] 2. lncSULT1C2 knockdown experiment shRNA was constructed using the Lenti-guide puro vector (Addgene, #52963). Specific primer information is as follows: sh-lncSULT1C2-1-Forward (SEQ ID NO.1):CACCGTGTCTAACAGATTTCTGCTTCTCATTCAAGATGAGAAGCAGAAATCTGTTAGACATTTTTT; sh-lncSULT1C2-1-Reverse (SEQ ID NO.2):AAACAAAAAATGTCTAACAGATTTCTGCTTCTCATCTTGAATGAGAAGCAGAAATCTGTTAGACAC; sh-lncSULT1C2-2-Forward (SEQ ID NO.3): CACCGTCAGGGAAGATTGTCTAACAGATTTTCAAGAAATCTGTTAGACAATCTTCCCTGATTTTTT; sh-lncSULT1C2-2-Reverse (SEQ ID NO.4): AAACAAAAAATCAGGGAAGATTGTCTAACAGATTTCTTGAAAATCTGTTAGACAATCTTCCCTGAC; Lentiviral cells were packaged in 293T cells and then infected with MHCC97H cells. lncSULT1C2 expression was knocked down, and two cell line samples with stable lncSULT1C2 knockdown were obtained, named sh-lncSULT1C2-1 and sh-lncSULT1C2-2, respectively.
[0028] 3. CCK-8 (Cell Counting Kit-8) Experiment The negative control used the MHCC97H cell line that had not undergone the lncSULT1C2 knockdown experiment, named shNC.
[0029] (1) Prepare cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively, and seed them into 96-well plates at a density of 2000 cells per well. The cell suspension is 100 μL / well, and each group has at least 3 replicates. The cells are then cultured in a cell culture incubator at 37°C and 5% CO2. (2) Cell adherent culture: 10 μL of CCK-8 reagent (product number: HY-K0301, MCE) was added to each well at 24 h, 72 h and 120 h respectively, and the cells were incubated in a cell culture incubator for 1.5 h. (3) The absorbance at 450 nm was measured using an ELISA reader, and cell proliferation curves of sh-lncSULT1C2-1, sh-lncSULT1C2-2, and shNC were plotted respectively. The results are as follows: Figure 2a As shown, the horizontal axis represents the incubation time (days), and the vertical axis represents OD. 450 value.
[0030] pass Figure 2a Analysis shows that the OD values of sh-lncSULT1C2-1 and sh-lncSULT1C2-2 are... 450 The values are similar, and both are lower than the OD of shNC. 450 The value indicates that knocking down lncSULT1C2 inhibited the activity of MHCC97H cells.
[0031] 4. Colony Formation Experiment (1) Prepare cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively, seed them into 6-well plates at a density of 4000 cells per well, add 2 mL of complete culture medium to each well, and incubate in a cell culture incubator at 37℃ and 5% CO2 for 7-14 days; (2) When visible clones appear in the 6-well plate, stop the culture, discard the complete culture medium, wash once with PBS, and discard the PBS; add 1 mL of 4% paraformaldehyde to each well, fix for 10 min, and then discard the paraformaldehyde; add 1 mL of crystal violet staining solution (product number: C0121, Shanghai Beyotime Biotechnology Co., Ltd.) to each well and stain for 10-30 min, wash off the staining solution with running water, and air dry; (3) Count the number of clones with more than 50 cells under a microscope and take pictures. Calculate the clone (colony) formation rate by taking the average value of the clones from 3 replicates and draw a statistical chart. The formula for calculating the clonal (colony) formation rate is: Clonal (colony) formation rate = (average number of clones / number of individual cells inoculated) × 100%.
[0032] The results are as follows Figure 2b As shown, the left image is the photographic result, and the right image is the statistical graph. The horizontal axis of the statistical graph represents the group, and the vertical axis represents the colony formation rate. Analysis shows that the colony formation rates of sh-lncSULT1C2-1 and sh-lncSULT1C2-2 are both lower than that of shNC, indicating that knocking down lncSULT1C2 inhibits the proliferation activity of MHCC97H cells.
[0033] 5. EdU Experiment (1) Prepare cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively, at a ratio of 1×10⁻⁶ cells per well. 4 Cells were seeded at a density of 100 μL per well in 96-well plates and cultured in a cell culture incubator at 37°C and 5% CO2. (2) Cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2, and shNC were processed using an EDU detection kit (catalog number: C0075S, Shanghai Beyotime Biotechnology Co., Ltd.). Cells were then photographed and observed using a fluorescence microscope, and statistical graphs were plotted for analysis. The results are as follows: Figure 2c As shown, the left figure is the fluorescence imaging result, and the right figure is the statistical graph. In the statistical graph, the horizontal axis is the group, and the vertical axis is the proportion of EdU-positive cells (%).
[0034] Analysis showed that the proportion of EdU-positive cells in sh-lncSULT1C2-1 and sh-lncSULT1C2-2 was lower than that in shNC, indicating that the proportion of cells in the active DNA synthesis phase (S phase) was lower in sh-lncSULT1C2-1 and sh-lncSULT1C2-2, meaning that knocking down lncSULT1C2 inhibited the proliferation activity of MHCC97H cells.
[0035] In summary, the combined analysis of the results from the CCK-8 assay, colony formation assay, and EdU assay shows that knockdown of lncSULT1C2 significantly inhibited the viability and proliferation of MHCC97H cells.
[0036] 6. Apoptosis experiment (1) Separately, sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC cells in the logarithmic growth phase were divided into groups of 5 × 10⁻⁶ cells per well. 5 The cells were seeded at a density of 2 mL of culture medium into 6-well plates and incubated in a cell culture incubator at 37°C and 5% CO2. (2) Digest cells with trypsin without EDTA, centrifuge at 2000 rpm for 5 min at room temperature, and collect cell pellets of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively; (3) The cell pellets of sh-lncSULT1C2-1, sh-lncSULT1C2-2, and shNC were treated with Annexin V-FITC Apoptosis Detection Kit I (catalog number: 556547, BD Biosciences, USA). Flow cytometry was used to detect cell apoptosis, and statistical graphs were plotted. The results are as follows: Figure 2d As shown, the left figure is a result of cell loss, and the right figure is a statistical chart. In the statistical chart, the horizontal axis represents the group, and the vertical axis represents the cell apoptosis rate (%).
[0037] pass Figure 2d Analysis showed that the apoptosis rates of sh-lncSULT1C2-1 and sh-lncSULT1C2-2 were higher than those of the shNC group; this indicates that knocking down lncSULT1C2 increases the apoptosis rate of MHCC97H cells.
[0038] 7. Cell cycle experiment (1) Prepare cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively, at a ratio of 1×10⁻⁶ cells per well. 6 Cells were seeded at a density of 1,000 cells per well in 6-well plates with 2 mL of complete culture medium per well and incubated in a cell culture incubator at 37°C and 5% CO2. (2) Trypsin digestion was performed on sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC cells, the cell pellet was collected, the cells were washed once with 1 mL PBS, and the cell pellet was collected again after centrifugation at 1000 rpm for 3 min. (3) Resuspend the cells in 125 μL of pre-chilled PBS, then add 375 μL of pre-chilled anhydrous ethanol and fix overnight at -20°C; centrifuge at 1000 rpm for 3 min and discard the supernatant; wash the cells once with 500 μL of pre-chilled PBS, and resuspend the cells in 500 μL of PBS + 5 μL of RNase A (catalog number: EN0531, Thermo Fisher Scientific), and digest the cells in a water bath at 37°C for 30 min; add 5 μL of PI (catalog number: E607306, Sangon Biotech (Shanghai) Co., Ltd.) to the cell suspension, incubate at room temperature in the dark for 15 min, filter to remove larger cell clumps, and then perform flow cytometry analysis. The results are as follows: Figure 2e As shown in the figure; where the x-axis of the flow cytometry plot represents the fluorescence intensity of PI, and the y-axis represents the cell number.
[0039] pass Figure 2e Analysis showed that the proportion of cells in S phase in sh-lncSULT1C2-1 and sh-lncSULT1C2-2 was lower than that in shNC, while the proportion of cells in G0 / G1 phase was higher than that in the control group shNC. This indicates that knocking down lncSULT1C2 caused cell cycle arrest in G1 phase in MHCC97H cells.
[0040] 8. Transwell experiment (1) Prepare a 24-well plate and add 700 μL of complete culture medium to each well; place the Transwell chamber (catalog number: 3422, Corning) into the 24-well plate in advance; (2) Prepare cell suspensions of sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC respectively, at a ratio of 1×10⁻⁶ cells per well. 5 Cells were seeded at a density of 200 μL of DMEM medium in the upper chamber of a 24-well Transwell plate and cultured in a cell culture incubator at 37°C and 5% CO2. (3) Transwell chambers were collected 48 h after seeding sh-lncSULT1C2-1, sh-lncSULT1C2-2 and shNC cells; the Transwell chambers were stained at room temperature in a methanol solution containing 1% crystal violet, and after 15 min, the Transwell chambers were washed, and unstained cells in the wells were wiped off with cotton swabs; the wells were dried, photographed under a microscope and statistically analyzed; the results are as follows. Figure 2f As shown, the left image is the result of microscopic photography, and the right image is a statistical graph. In the statistical graph, the horizontal axis represents the group, and the vertical axis represents the number of cells that migrated to the lower layer of the chamber.
[0041] Analysis showed that the number of migrating cells in sh-lncSULT1C2-1 and sh-lncSULT1C2-2 was significantly lower than that in the control group shNC, indicating that knocking down lncSULT1C2 can inhibit the migration ability of MHCC97H cells.
[0042] In summary, through apoptosis, cell cycle and Transwell experiments, it can be seen that knockdown of lncSULT1C2 significantly inhibited cell cycle progression of MHCC97H cells, significantly promoted apoptosis, and significantly inhibited the migration ability of MHCC97H cells.
[0043] Example 3 Biological functions of overexpression of lncSULT1C2 in HCC cells 1. Cell Culture HuH-7 cells and HepG2 cells were cultured in complete medium (DMEM medium + 10% FBS + 1% penicillin-streptomycin) at 37°C and 5% CO2. The HuH-7 and HepG2 cells mentioned above were both obtained from the Cell Bank of the Chinese Academy of Sciences. 2. lncSULT1C2 overexpression experiment The PCDH-lncSULT1C2 overexpression plasmid was constructed using the pCDH-CMV-MCS-EF1-Puro vector (Addgene, 7384bp). Specific primer information is as follows: PCDH-lncSULT1C2-Forward (SEQ ID NO.5): AGAAGATTCTAGAGCTAGCGAATCCGGATTCTTCCAGTAAAAGC; PCDH-lncSULT1C2-Reverse (SEQ ID NO.6): GCAGATCCTTCGCGGCCGCGGATGTGAAGAGAAACACTTCTAGG; Lentiviral cells were packaged in 293T cells. After 48 hours of viral packaging, HuH-7 and HepG2 cells were infected to construct stable cell lines overexpressing HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2, HepG2-PCDH, and HepG2-PCDH-lncSULT1C2.
[0044] 3. CCK-8 Experiment The constructed stable cell lines HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2, HepG2-PCDH and HepG2-PCDH-lncSULT1C2 were seeded into 96-well plates, and the remaining steps were the same as those in the "CCK-8 experiment" in Example 2. The results are as follows Figure 3a As shown, the proliferation curves of HuH-7 cells (HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2) (left) and HepG2 cells (HepG2-PCDH, HepG2-PCDH-lncSULT1C2) (right) are displayed. The horizontal axis represents the culture time (days), and the vertical axis represents the OD value. 450 value.
[0045] Analysis revealed that in HuH-7 cells and HepG2 cells, OD after overexpression of PCDH-lncSULT1C2 was significantly reduced. 450 The values were all higher than the OD values of the negative control. 450 The value indicates that overexpression of PCDH-lncSULT1C2 promotes cell activity / proliferation.
[0046] 4. Colony Formation Experiment HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2, HepG2-PCDH and HepG2-PCDH-lncSULT1C2 cell suspensions were prepared respectively, and the remaining steps were the same as the "colony formation experiment" steps in Example 2. The results are as follows Figure 3b As shown, the left image is the result of fluorescence microscopy, the middle image is the clonal statistics of HuH-7 cells (HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2), and the right image is the clonal statistics of HepG2 cells (HepG2-PCDH, HepG2-PCDH-lncSULT1C2).
[0047] Analysis showed that the colony formation rate of overexpressing PCDH-lncSULT1C2 was higher in HuH-7 and HepG2 cells than in the negative control, indicating that overexpression of PCDH-lncSULT1C2 promoted cell activity / proliferation.
[0048] 5. EdU Experiment (1) Prepare HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2, HepG2-PCDH and HepG2-PCDH-lncSULT1C2 cell suspensions respectively, and the remaining steps are the same as the “EdU experiment” steps in Example 2; The results are as follows Figure 3c As shown, the left image is the result of fluorescence microscopy, the middle image is the positive percentage of HuH-7 cells (HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2), and the right image is the positive percentage of HepG2 cells (HepG2-PCDH, HepG2-PCDH-lncSULT1C2).
[0049] Analysis showed that the number of EdU-positive cells in the PCDH-lncSULT1C2 overexpression group was significantly higher than that in the control PCDH group (i.e., Vector), indicating that the proportion of cells in the active DNA synthesis phase (S phase) of PCDH-lncSULT1C2 was higher, meaning that overexpression of PCDH-lncSULT1C2 promoted the proliferation activity of HuH-7 and HepG2 cells.
[0050] In summary, the combined analysis of the results from the CCK-8 assay, colony formation assay, and EdU assay shows that overexpression of PCDH-lncSULT1C2 significantly promotes the viability and proliferation of HuH-7 and HepG2 cells.
[0051] 6. Transwell experiment HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2, HepG2-PCDH, and HepG2-PCDH-lncSULT1C2 cell suspensions were seeded into the upper chamber of a 24-well Transwell plate, and the remaining steps were the same as those in the "Transwell Experiment" in Example 2. The Transwell chambers were collected 24 h after seeding HuH-7-PCDH and HuH-7-PCDH-lncSULT1C2 cell suspensions, and the Transwell chambers were collected 48 h after seeding HepG2-PCDH and HepG2-PCDH-lncSULT1C2 cell suspensions.
[0052] The results are as follows Figure 3d As shown, the left image is the result of microscopic photography, the middle image is a statistical chart of the number of HuH-7 cells (HuH-7-PCDH, HuH-7-PCDH-lncSULT1C2), and the right image is a statistical chart of the number of HepG2 cells (HepG2-PCDH, HepG2-PCDH-lncSULT1C2).
[0053] Analysis showed that in HuH-7 and HepG2 cells, the number of cells that migrated after overexpressing PCDH-lncSULT1C2 was higher than that of the negative control cells; this indicates that overexpression of lncSULT1C2 enhances cell migration ability.
[0054] Example 4 Biological function of lncSULT1C2 knockdown in mice 1. Establishment of a subcutaneous xenograft model in nude mice Stable knockdown cell lines of shNC and sh-lncSULT1C2-2 were constructed using MHCC97H cells to establish a subcutaneous xenograft model in nude mice. (1) Purchase 6-week-old male BALB / c nude mice, 6 mice per group, for a total of 12 mice; The BALB / c nude mice mentioned above were purchased from the Experimental Animal Center of East China Normal University. (2) Prepare shNC and sh-lncSULT1C2-2 cell suspensions (constructed from Example 2), and resuspend the cell suspensions in PBS; 2×10 6 200 μL of shNC cells or sh-lncSULT1C2-2 cells were subcutaneously injected into BALB / c nude mice; (3) Seven days after subcutaneous xenograft inoculation, observe the growth of the xenograft. When visible tumor growth is observed, measure the tumor diameter three times a week. When the tumor volume approaches 2000 mm, the tumor diameter is considered to be 7 days after inoculation. 3Mice were sacrificed under CO2 anesthesia; subcutaneous xenografts of shNC (Vector in the image) and sh-lncSULT1C2-2 (sh-lncSUL-2 in the image) were photographed, and the results are as follows. Figure 4a As shown in the results, the subcutaneous xenograft volume in the sh-lncSULT1C2-2 group was significantly smaller than that in the control shNC group.
[0055] The tumor growth curve was plotted, and the results are as follows: Figure 4b As shown, the horizontal axis represents the number of days (Days), and the vertical axis represents the tumor volume (mm). 3 The results showed that the tumor growth rate was significantly slowed in the sh-lncSULT1C2-2 group.
[0056] Simultaneously, the weight of the tumor was statistically analyzed and plotted, with the results as follows: Figure 4c As shown in the figure, the horizontal axis represents the group and the vertical axis represents the tumor weight (g). The results showed that the tumor weight in the sh-lncSULT1C2-2 group was also significantly lower than that in the control shNC group.
[0057] In summary, knockdown of lncSULT1C2 significantly inhibited the in vivo growth capacity of subcutaneous xenografts in nude mice.
[0058] 2. Immunohistochemical analysis (1) Subcutaneous xenograft tissues from the shNC group and the sh-lncSULT1C2-2 group were fixed with paraformaldehyde; (2) After the tissue samples are fixed, they are subjected to dehydration-clearing-wax impregnation-embedding treatment in sequence, so that the tissue samples are embedded in paraffin; (3) Use a slicer to slice the slices, and then bake the slices at 60°C for 2 hours; (4) Perform dewaxing, hydration, antigen retrieval, inactivation, and blocking treatments in sequence; (5) Dilute Ki-67 antibody (catalog number: 27309-1-AP, Wuhan Sanying Biotechnology Co., Ltd.) at a ratio of 1:200. Add the diluted Ki-67 antibody evenly to the blocked tissue section, place it in a humidified box, and incubate at room temperature for 1 hour to allow Ki-67 antibody to fully bind to the antigen. (6) Perform secondary antibody incubation, PBS washing, and DAPI staining of cell nuclei in sequence, and observe the staining of Ki67 under a fluorescence microscope.
[0059] The statistical chart of Ki67 positive cells is shown below. Figure 4d As shown, the immunohistochemical staining pattern is as follows: Figure 4e As shown, the results showed that knocking down lncSULT1C2 significantly reduced the number of Ki67-positive cells in the xenograft tissue.
[0060] In summary, knocking down lncSULT1C2 can delay liver tumor growth at the in vivo level.
[0061] Example 5 Biological functions of overexpression of lncSULT1C2 in vivo Take the stable cell lines overexpressing HuH-7-PCDH and HuH-7-PCDH-lncSULT1C2 from Example 3 and establish a nude mouse subcutaneous xenograft model; the remaining establishment steps are the same as the steps in "Establishment of nude mouse subcutaneous xenograft model" in Example 4.
[0062] Subcutaneous xenografts of HuH-7-PCDH (i.e., Vector in the image) and HuH-7-PCDH-lncSULT1C2 (i.e., lncSULT1C2 in the image) were removed and photographed, and the results are as follows. Figure 5a As shown in the figure, the results showed that the subcutaneous xenograft volume in the HuH-7-PCDH-lncSULT1C2 group was significantly larger than that in the negative control HuH-7-PCDH group.
[0063] Plot a tumor growth curve, where the horizontal axis represents days and the vertical axis represents tumor volume (mm). 3 ), the result is as follows Figure 5b As shown in the figure, the results showed that the subcutaneous xenografts in the HuH-7-PCDH-lncSULT1C2 group grew significantly faster than those in the negative control HuH-7-PCDH group.
[0064] Meanwhile, the results were obtained by measuring the weight of the subcutaneous xenograft. Figure 5c As shown in the figure, the horizontal axis represents the group and the vertical axis represents the tumor weight (g). The results showed that the tumor weight of the subcutaneous xenografts in the HuH-7-PCDH-lncSULT1C2 group was significantly higher than that in the negative control HuH-7-PCDH group.
[0065] In summary, overexpression of PCDH-lncSULT1C2 promotes the in vivo growth of liver tumors.
[0066] Example 6 Overexpression of lncSULT1C2 promotes the development of liver tumors. The pT3-myr-AKT-HA vector was digested with EcoRV enzyme (product number: R3195V, NEB), and the full-length lncSULT1C2 sequence was ligated into the pT3-myr-AKT-HA vector to construct the PT3-lncSULT1C2 overexpression plasmid. A spontaneous liver tumor model was induced by high-pressure injection of plasmids via the tail vein. (Flowchart shown below) Figure 6a As shown, the specific implementation steps are as follows: (1) Order 6-week-old male C57BL / 6J mice (Experimental Animal Center of East China Normal University), 6 mice per group, for a total of 12 mice; (2) Prepare plasmid mixtures for each mouse in each group according to the following proportions: Control group: PT3-MYC (10μg), PT3-CTNNB1 (10μg), CMV-SB100 (3μg); Experimental group: PT3-MYC (10μg), PT3-CTNNB1 (10μg), PT3-lncSULT1C2 (10μg), CMV-SB100 (3μg); The above plasmid mixture was diluted with physiological saline, mixed well, and placed at room temperature. It was then injected via high-pressure tail vein at a rate of 2 mL / animal. The above-mentioned pT3-myr-AKT-HA vector, PT3-MYC, PT3-CTNNB1, and CMV-SB100 plasmid were donated by Dr. Zhixiang Hu from the Institute of Biomedical Sciences, Fudan University.
[0067] (3) Four weeks after high-pressure injection of plasmid into the tail vein, observe the condition and survival of the mice. When any mice die, the experiment is terminated. The mice are anesthetized with CO2 and their weight is measured. The livers of the mice are removed and weighed. The liver weight, liver weight / body weight ratio, number of tumors and maximum tumor diameter of the experimental and control groups are statistically analyzed.
[0068] The results are as follows Figures 6b-6c As shown, the results revealed that overexpression of PT3-lncSULT1C2 in the experimental group significantly increased liver weight and liver weight-to-body weight ratio, and the number of liver tumors and the largest tumor diameter were also significantly higher than those in the control group; thus, it is indicated that overexpression of lncSULT1C2 promotes the occurrence of liver tumors.
[0069] Example 7 The effect of lncSULT1C2 on the metastatic ability of liver cancer cells in vivo 1. Establishment of a nude mouse orthotopic xenograft liver tumor model Using the stable knockdown lncSULT1C2 cell line sh-lncSULT1C2-2 constructed from MHCC97H cells in Example 2 and the control cell line shNC, an orthotopic liver xenograft model was established in nude mice. The specific experimental procedure is as follows: (1) Order 6-week-old male BALB / c nude mice, 10 mice per group, for a total of 20 mice; (2) 5 × 10 per mouse 6Cell volume: shNC or sh-lncSULT1C2-2 cells were seeded in situ into the livers of nude mice; (3) Six to eight weeks after in situ inoculation, the survival of mice was observed. The experiment was terminated when the condition of the mice deteriorated. Mice were sacrificed under CO2 anesthesia, and their lungs and livers were removed. After fixation with paraformaldehyde, subsequent HE staining was performed to observe and statistically analyze the effect of lncSULT1C2 knockdown on the ability of liver and lung metastasis. The results are as follows: Figure 7a -c is shown.
[0070] Analysis revealed that the number of liver and lung metastases in the sh-lncSULT1C2-2 group was significantly lower than that in the control shNC group.
[0071] The above results indicate that knocking down lncSULT1C2 can inhibit the metastatic ability of liver cancer cells at the in vivo level.
[0072] Example 8 GalNAc-ASO-lncSULT1C2 in vivo treatment trial Based on the fact that LncSULT1C2 is specifically highly expressed in liver cancer tissues but almost not expressed in adjacent normal tissues; GalNAc is part of a hydrocarbon compound that can specifically bind to the ASGPR receptor on the surface of hepatocyte membranes, delivering GalNAc-coupled siRNA / ASO into hepatocytes to achieve liver-specific knockdown of lncSULT1C2.
[0073] 1. Synthesis of GalNAc-ASO-lncSULT1C2 The nucleotide sequence of ASO-lncSULT1C2 is: AGGGTGATGCAAACACCAAG (SEQ ID NO.8); The synthesis of ASO-lncSULT1C2 and the negative control ASO-NC was commissioned to Guangzhou Ruibo Biotechnology Co., Ltd. LNA modification ( / + / ) was performed on each of the five bases at both ends of ASO-lncSULT1C2, followed by PS phosphate thiophosphate backbone modification. The modified sequence is: / +A / / +G / / +G / / +G / / +T / G A T G C A A A C A / +C / / +C / / +A / / +A / / +G / ;ASO-NC was modified in the same way, and the 3' ends of ASO-lncSULT1C2 and ASO-NC were coupled with trivalent GalNAc to obtain GalNAc-ASO-lncSULT1C2 conjugate and GalNAc-ASO-NC conjugate, respectively. The synthesis of the aforementioned GalNAc-ASO-NC and GalNAc-ASO-lncSULT1C2 was commissioned to Huzhou Hippo Biotechnology Co., Ltd. 2. Drug administration experiment (1) Construction of MHCC97H-GFP-luciferase cell line ① 293T cells in the logarithmic growth phase were seeded into 6-well plates and transiently transfected with pWPXL-GFP-luciferase plasmid for lentiviral packaging; The aforementioned 293T cells were purchased from the Cell Bank of the Chinese Academy of Sciences; The construction method of the above pWPXL-GFP-luciferase plasmid is as follows: The luciferase gene is cloned into the pWPXL vector (Addgene, #12257), which already contains the EGFP gene. Luciferase is inserted after EGFP to achieve fusion expression and obtain the pWPXL-EGFP-Luciferase fusion expression plasmid.
[0074] ② MHCC97H cells in the logarithmic growth phase were seeded into 10cm culture dishes, infected with pWPXL-GFP-luciferase virus, and GFP-positive MHCC97H-GFP-luciferase cell lines were screened by flow cytometry. ③ Expand MHCC97H-GFP-luciferase cells for orthotopic liver xenograft experiments.
[0075] (2) Establishment of an orthotopic liver xenograft tumor model Order 6-8 week old male BALB / c nude mice and administer 5×10⁵ mmol / L via orthotopic injection into the liver. 6 Establish an orthotopic liver xenograft model using MHCC97H-GFP-luciferase cells; (3) Imaging and drug delivery intervention The operating procedure is attached. Figure 8aOn the fifth day after orthotopic liver transplantation, nude mice were injected intraperitoneally with 150 mg / kg D-luciferin; mice were anesthetized with isoflurane inhalation anesthesia system and then in vivo imaging was performed to monitor the in vivo growth of the orthotopic liver transplant tumor. Experimental mice were randomly divided into two groups (n=6 per group), and were treated with subcutaneous injection of GalNAc-ASO-NC or GalNAc-ASO-lncSULT1C2 (5 mg / kg) (GalNAc-ASO-NC and GalNAc-ASO-lncSULT1C2 were ordered as dry powder and dissolved with DEPC). During the administration period, the mice's mental state and any mortality were closely monitored. A second drug injection and fluorescence imaging were performed on day 15 after cell inoculation. Fluorescence imaging was performed on day 25 after inoculation to assess whether the GalNAc-ASO-lncSULT1C2 conjugate had an inhibitory effect on the in vivo growth of orthotopic liver tumors. After imaging, the mice were anesthetized with CO2, dissected, and their livers were photographed. Liver tumor tissue was collected for subsequent analysis. The imaging results are attached. Figure 8b .
[0076] The results showed that, compared with the GalNAc-ASO-NC control group, the tumor growth rate of mice in the GalNAc-ASO-lncSULT1C2 treatment group was significantly slowed down.
[0077] (4) HE staining ① Paraffin-embedded and sectioned liver tumor tissue samples fixed with paraformaldehyde; ② Perform the following steps in sequence: dewaxing, hematoxylin staining, eosin staining, dehydration, clearing, and mounting. The results are as follows Figure 8c As shown, the intrahepatic metastasis ability of mice in the GalNAc-ASO-lncSULT1C2 treatment group was significantly lower than that in the GalNAc-ASO-NC control group.
[0078] (5) Immunofluorescence staining ① Ki67 immunofluorescence staining was performed on liver tumor tissue samples, following the same steps as the "immunohistochemical analysis" steps in Example 4; ② TUNEL staining of liver tumor tissue samples: a. Paraffin-embedded and sectioned liver tumor tissue samples fixed with paraformaldehyde; b. Dewaxing in xylene for 5-10 minutes; then dewaxing again in fresh xylene for 5-10 minutes; followed by anhydrous ethanol for 5 minutes; 90% ethanol for 2 minutes; 70% ethanol for 2 minutes; and distilled water for 2 minutes. c. Add 20 μg / mL of DNase-free proteinase K (catalog number: ST532, Shanghai Beyotime Biotechnology Co., Ltd.), incubate at 37°C for 30 minutes, and then wash 3 times with PBS; d. Incubate the sections in a 3% hydrogen peroxide solution prepared in PBS at room temperature for 20 minutes to inactivate endogenous peroxidase in the sections; then wash the sections three times with PBS. e. Prepare biotin labeling solution and biotin label the sample (TUNEL kit number: C1091, Shanghai Beyotime Biotechnology Co., Ltd.); prepare Streptavidin-HRP working solution and DAB chromogenic solution and perform chromogenic reaction on the sample; The results are as follows Figure 8d As shown, the results revealed that the number of Ki67-positive cells in liver tumor tissue was significantly reduced in the GalNAc-ASO-lncSULT1C2 treatment group, accompanied by an increase in the proportion of apoptotic cells.
[0079] Furthermore, the body weight and liver weight of mice in the GalNAc-ASO-lncSULT1C2 treatment group were measured compared with those in the control group. Figure 8e As shown, the results indicate that there were no significant changes in body weight and liver weight between the treatment group and the control group, suggesting that the GalNAc-ASO-lncSULT1C2 conjugate has good in vivo safety.
[0080] In summary, the GalNAc-ASO-lncSULT1C2 conjugate of this application significantly inhibited the in vivo growth and metastasis of hepatocellular carcinoma in a nude mouse orthotopic liver xenograft model, suggesting that targeted intervention of lncSULT1C2 may be a potential new strategy for the treatment of HCC.
[0081] In summary, this application discovered that lncSULT1C2 is specifically highly expressed in hepatocellular carcinoma (HCC), while it is not expressed in normal liver tissue and exhibits significant pro-cancer activity. Furthermore, a specific ASO (ASO-lncSULT1C2) was designed targeting the lncSULT1C2 sequence, and a GalNAc-ASO-lncSULT1C2 conjugate was constructed via chemical conjugation. GalNAc, as a targeting molecule that specifically recognizes the ASGPR receptor on the hepatocyte membrane surface, can precisely deliver the conjugated siRNA / ASO into hepatocytes via receptor-mediated endocytosis. In a mouse model of orthotopic liver xenografts, mice treated with GalNAc-ASO-lncSULT1C2 showed a significant reduction in tumor growth compared to the control group; simultaneously, the intrahepatic metastasis ability of the orthotopic liver xenografts was weakened. In vivo studies have confirmed that targeting the lncSULT1C2 molecule, which is specifically highly expressed in hepatocellular carcinoma, using the GalNAc-ASO system can effectively inhibit the progression of hepatocellular carcinoma, providing a new treatment strategy for clinical translation and laying an important experimental foundation for the development of targeted technology based on RNA interference.
[0082] The specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Those skilled in the art can make modifications to these embodiments without contributing any inventive step after reading this specification, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.
Claims
1. The application of a reagent for knocking down lncSULT1C2 expression in the preparation of drugs for tumor treatment, characterized in that, The nucleotide sequence of lncSULT1C2 is shown in SEQ ID NO.
7.
2. The application as described in claim 1, characterized in that, The reagent includes nucleic acid drugs; preferably, the nucleic acid drugs are selected from antisense oligonucleotides.
3. The application as described in claim 1, characterized in that, The tumor is liver cancer; preferably, the liver cancer is hepatocellular carcinoma.
4. An antisense oligonucleotide for treating liver cancer, characterized in that, The antisense oligonucleotide comprises a nucleotide sequence that is complementary to the bases of lncSULT1C2, the nucleotide sequence of which is shown in SEQ ID NO.
7.
5. The antisense oligonucleotide as described in claim 4, characterized in that, The nucleotide sequence of the antisense oligonucleotide is shown in SEQ ID NO.
8.
6. The antisense oligonucleotide as described in claim 5, characterized in that, The nucleotide sequence of the antisense oligonucleotide is chemically modified; preferably, the chemical modification is selected from one or more of LNA modification or PS phosphate thiophosphate backbone modification; more preferably, the antisense oligonucleotide is modified with PS phosphate thiophosphate backbone and LNA modification is performed on 5 bases at each end of the antisense oligonucleotide.
7. A drug delivery system, characterized in that, It comprises the antisense oligonucleotide of claim 5 and a delivery vector; preferably, the delivery vector is selected from GalNAc.
8. A pharmaceutical composition for treating liver cancer, characterized in that, The pharmaceutical composition comprises an antisense oligonucleotide as described in any one of claims 4-6 or a drug delivery system as described in claim 7; preferably, the pharmaceutical composition further comprises pharmaceutically acceptable excipients.
9. The use of the antisense oligonucleotide as described in any one of claims 4-6, the drug delivery system as described in claim 7, or the pharmaceutical composition as described in claim 8 in the preparation of a liver cancer drug.
10. The application as described in claim 9, characterized in that, The drug is administered via subcutaneous injection.