A method for preparing a sodium hyaluronate and recombinant humanized collagen type III complex solution
By modifying and designing recombinant type III humanized collagen and mixing it with sodium hyaluronate solution, a composite solution was prepared, which solved the problem of binding sodium hyaluronate with recombinant type III humanized collagen and improved skin cell vitality and collagen fiber regeneration.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-12
- Publication Date
- 2026-06-02
AI Technical Summary
The effective combination of sodium hyaluronate and recombinant type III humanized collagen to prepare a composite solution with excellent bioavailability and efficacy remains an unsolved problem.
By modifying and designing recombinant humanized type III collagen COL3A1-QS-1, the pPICZα A-COL3A1-QS-1 plasmid was constructed. The recombinant protein was expressed in Pichia pastoris and then mixed with sodium hyaluronate solution. The pH and osmotic pressure were adjusted to prepare a composite solution.
It achieves an effective combination of sodium hyaluronate and recombinant type III humanized collagen, enhancing skin cell vitality, adhesion, proliferation and migration capabilities, promoting skin collagen fiber regeneration, and showing a significant skin firming effect.
Smart Images

Figure CN122124324A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of medical aesthetics, specifically to a method for preparing a composite solution of sodium hyaluronate and recombinant type III humanized collagen. Background Technology
[0002] Hyaluronic acid is a mucopolysaccharide widely distributed throughout the human body. It possesses a unique molecular structure and physicochemical properties, exhibiting various important physiological functions within the body, such as lubricating joints, regulating vascular permeability, regulating protein and electrolyte diffusion and transport, and promoting wound healing. With age and the influence of environmental factors, the body's ability to synthesize hyaluronic acid gradually declines, leading to a decrease in the amount of hyaluronic acid in the skin. This results in signs of aging such as thinning, dryness, wrinkles, and sagging.
[0003] Collagen is an essential biomolecule that maintains the shape and structure of skin and tissues, primarily found in the skin, bones, cartilage, teeth, tendons, ligaments, and blood vessels of humans and animals. Type III collagen is the most abundant type of collagen in the skin, widely distributed in the skin, vascular endothelium, and intestines. It has a delicate fibrous structure that effectively supports skin suppleness, making it smooth and elastic. However, with age, the skin's ability to synthesize collagen declines, leading to premature aging and atrophy.
[0004] Currently, the application of hyaluronic acid and collagen in the field of medical aesthetics has received widespread attention. Sodium hyaluronate, as an ideal natural moisturizing factor, possesses excellent water-retention properties and biocompatibility, and has been widely used in cosmetics, medical products, and health foods. Recombinant humanized collagen, as a more controllable alternative, offers advantages such as no immunogenicity, no viral transmission, and high bioactivity, providing a new approach to addressing issues related to the immunogenicity, viral infection risk, and unclear relationship between bioactive sequences and functions associated with animal-derived collagen. However, how to effectively combine sodium hyaluronate with recombinant type III humanized collagen to prepare a composite solution with excellent bioavailability and efficacy remains a pressing technical challenge. Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a method for preparing a composite solution of sodium hyaluronate and recombinant type III humanized collagen, comprising:
[0006] To achieve the above objectives, the present invention proposes the following technical solution:
[0007] 1. A method for preparing a composite solution of sodium hyaluronate and recombinant type III humanized collagen, characterized by comprising the following steps:
[0008] Step 1: Preparation of recombinant type III humanized collagen;
[0009] Step 2: Prepare a sodium hyaluronate solution;
[0010] Step 3: Mix recombinant type III humanized collagen with sodium hyaluronate solution and stir until homogeneous to obtain a composite solution;
[0011] Step one includes:
[0012] Step 1 (1) Modify human natural type III collagen and artificially screen and design recombinant type III humanized collagen COL3A1-QS-1, whose amino acid sequence SEQ ID NO.1 is
[0013] SEQ ID NO1: GTSGYQGKDGESGERGHRGRNGEKGETGENGENGERGNDGSDGSNGQRGKNGERGKDGERGEKGERGRDGSDGSQGESGNDGKNGERGKNGETGDKGDTG ENGERGERGDKGKDGDKGERGETGQNGERGEKGERGSNGKDGNTGEKGRDGRDGDRGENGKSGDRGESGSRGDKGETGERGHRGQQGKDGTSGNRGERGSE
[0014] Step 1 (2) The nucleic acid sequence encoding the recombinant type III humanized collagen is shown in SEQ ID NO: 2.
[0015] GGTACTTCTGGTTATCAAGGTAAAGATGGTGAATCTGGTGAAAGAGGTCATAGAGGTAGAAATGGTGAAAAAGGTGAAACTGGTGAAAATGGTGAAAACGGTGAAAGAGGAAACGATGGTTCTGATGGTTCTAATGGTCAAAGAGGTAAAA ACGGTGAAAGAGGTAAAGATGGAGAAAGAGGTGAAAAAGGAGAAAGAGGAAGAGATGGTTCTGACGGTTCTCAAGGTGAATCTGGAAACGATGGAAAAAACGGTGAGAGAGGTAAAAATGGTGAAACTGGAGATAAGGGTGACACTGGTGAA AACGGAGAAAGAGGTGAGAGAGGAGATAAAGGTAAAGATGGTGACAAAGGTGAAAGAGGTGAAACTGGTCAAAATGGTGAAAGAGGTGAAAAGGGTGAAAGAGGTTCTAACGGTAAAGATGGTAACACTGGTGAAAAAGGTAGAGATGGTA GAGATGGAGATAGAGGTGAAAACGGTAAATCTGGTGACAGAGGTGAATCTGGTTCTAGAGGTGACAAAGGAGAAACTGGTGAGAGAGGTCATAGAGGACAACAAGGTAAAGACGGTACTTCTGGAAACAGAGGTGAAAGAGGTTCCGAAtaa
[0016] Step 1 (3) The optimized sequence was copied to the gene synthesis company to synthesize the collagen COL3A1-QS-1 gene (the sequence is shown in SEQ ID NO: 2). The synthesized sequence was integrated into the expression vector, and finally the pPICZα A-COL3A1-QS-1 plasmid was constructed and named YH-COL3A1-QS-1.
[0017] Step 1 (4) Amplify, extract and digest the recombinant type III humanized collagen COL3A1-QS-1 expression plasmid;
[0018] Step 1 (5) Add recombinant type III humanized collagen COL3A1-QS-1 recombinant plasmid to P. PastorisX-33 competent cells;
[0019] Step 1 (6) Pichia pastoris engineered strains induce expression of recombinant humanized collagen COL3A1-QS-1;
[0020] Step 1 (7) Culture the recombinant type III humanized collagen expression cells to an appropriate density, add an inducer, and express the collagen;
[0021] Step 1 (8) Collect the expression cells, break the cells by ultrasound, and obtain the recombinant type III humanized collagen expression solution;
[0022] Step 1 (9) Adjust the concentration of the purified recombinant type III humanized collagen expression solution to 1.0%~15.0%.
[0023] 2. The method for preparing the sodium hyaluronate and recombinant type III humanized collagen composite solution according to claim 1, characterized in that step two includes:
[0024] Step 2 (1) React sodium hyaluronate with sodium hyaluronate enzyme and stir at 37°C for 2-4 hours to obtain sodium hyaluronate solution;
[0025] Step 2 (2) Remove unreacted sodium hyaluronate enzyme from the sodium hyaluronate solution by ultrafiltration and centrifugation to obtain a pure sodium hyaluronate solution;
[0026] Step 2 (3) Measure the concentration of the sodium hyaluronate solution and adjust it to the required concentration;
[0027] Step 2 (4) Adjust the concentration of sodium hyaluronate solution to a mass fraction of 10%~30%.
[0028] 3. The method for preparing the sodium hyaluronate and recombinant type III humanized collagen composite solution according to claim 1, characterized in that step three includes:
[0029] Step 3 (1) Mix the two solutions from Step 1 and Step 2 above, and stir at 0~8℃ for 1~3 hours until they are evenly mixed;
[0030] Step 3 (2) Prepare a phosphate buffer system by adding the mixed solution from (1) and adjusting the pH to 6.0~8.0 and the osmotic pressure to 200mOsmoL / kg~400mOsmoL / kg;
[0031] Step 3 (3) Fill the above mixture into a pre-filled syringe under sterile conditions to obtain the finished product. Attached Figure Description
[0032] Figure 1 This is a graph showing the results of an in vitro cell viability test of the composite solution of this invention; Figure 2 In the study, the PLY group consisted of a complex solution of injectable sodium hyaluronate and recombinant type III humanized collagen; the NS group consisted of physiological saline; the HA group consisted of sodium hyaluronate solution; the RCo1 group consisted of recombinant type III humanized collagen solution; and the UVB group consisted of a skin aging model group.
[0033] Figure 2 This is a diagram showing the results of the cell adhesion experiment of the composite solution of the present invention; Figure 2 In the study, the following groups were included: blank group: culture medium solution; PLY-8 group: sodium hyaluronate for injection and recombinant type III humanized collagen complex solution; PLY-4 group: sodium hyaluronate for injection and recombinant type III humanized collagen complex solution (PLY-8 diluted proportionally); JB group: recombinant type III humanized collagen lyophilized fiber solution (marketed product, National Medical Device Registration Certificate No. 20213130488); control group: bovine type I collagen reference solution (China National Institutes for Food and Drug Control); collagen implant "Sunmax" Collagen Implant I; and D-PBS solution group.
[0034] Figure 3 This is a diagram showing the results of a cell proliferation assay using the composite solution of this invention. Figure 3 In the study, the blank group consisted of culture medium solution; the PLY-8 group consisted of a complex solution of sodium hyaluronate for injection and recombinant type III humanized collagen; the PLY-4 group consisted of a complex solution of sodium hyaluronate for injection and recombinant type III humanized collagen (PLY-8 diluted proportionally); the JB group consisted of a lyophilized fiber solution of recombinant type III humanized collagen (a marketed product, National Medical Device Registration Certificate No. 20213130488); and the control group consisted of bovine type I collagen reference solution (China National Institutes for Food and Drug Control).
[0035] Figure 4 This is a diagram showing the results of a cell migration assay using the composite solution of this invention. Figure 4 In the control group, blank: serum-free culture medium; JB group: recombinant type III humanized collagen lyophilized fiber solution; PLY group: sodium hyaluronate for injection and recombinant type III humanized collagen complex solution; control group: bovine type I collagen reference solution.
[0036] Figure 5 This is a diagram showing the results of Masson's experiment, in which the composite solution of the present invention was implanted into rats for one week. Figure 5 In the middle: the relative proportion of collagen fiber area in the dermis of rat dorsal skin (*: P<0.05, **: P<0.01, ***: P<0.001, ****: P<0.0001, ns: no significant difference).
[0037] Figure 6 The expression of type I and type III collagen mRNA in the dorsal skin of rats was measured after two weeks of cell implantation with the composite solution of this invention. Figure 6 In the middle: the relative proportion of collagen fiber area in the dermis of rat dorsal skin (*: P<0.05, **: P<0.01, ***: P<0.001, ****: P<0.0001, ns: no significant difference).
[0038] Figure 7 This is an electron micrograph of the dermal layer of the skin on the back of a rat one week after the composite solution of the present invention was implanted into the rat. Figure 7 In the study, the normal group was given no treatment; the control group was given a saline injection; the sodium hyaluronate group was given a recombinant type III humanized collagen solution; and the composite solution group was given a composite solution of sodium hyaluronate for injection and recombinant type III humanized collagen. Detailed Implementation
[0039] To better understand the technical content of this invention, specific embodiments are described below in conjunction with the accompanying drawings. Various aspects of the invention are described in this disclosure with reference to the accompanying drawings, which illustrate numerous illustrative embodiments. The embodiments of this disclosure are not necessarily defined to include all aspects of the invention. It should be understood that the various concepts and embodiments described above, as well as those described in more detail below, can be implemented in any of many ways, because the concepts and embodiments disclosed in this invention are not limited to any particular implementation. Furthermore, some aspects of this invention can be used alone or in any suitable combination with other aspects of this invention.
[0040] Example 1: A method for preparing a composite solution of sodium hyaluronate and recombinant type III humanized collagen, comprising the following steps:
[0041] This embodiment uses the following steps for preparation:
[0042] (1) Preparation of recombinant type III humanized collagen;
[0043] (A) The amino acid sequence of human collagen was artificially designed using the repeating sequence of SEQ ID NO:1 to obtain the amino acid sequence of recombinant type III humanized collagen containing amino acid monomers:
[0044] (B) The amino acid sequence of the recombinant type III humanized collagen was cloned into the expression vector pET-24a(+) to obtain the recombinant type III humanized collagen expression plasmid;
[0045] (C) The recombinant type III humanized collagen expression plasmid was transformed into competent E.coli BL21(DE3) cells to obtain recombinant type III humanized collagen expression cells;
[0046] (D) The recombinant type III humanized collagen expression cells were cultured at 37°C and 500 rpm until the OD600 value reached 0.8~1.0;
[0047] (E) Add sodium isopropyl sulfate to a final concentration of 0.5 mM, induce expression for 4 hours, collect the expressing cells, and break the cells by sonication to obtain recombinant type III humanized collagen expression solution;
[0048] (2) Preparation of sodium hyaluronate solution;
[0049] (F) Sodium hyaluronate and sodium hyaluronate enzyme were stirred at 37°C for 3 hours to obtain a sodium hyaluronate solution, wherein the initial concentration of sodium hyaluronate was 40 mg / mL and the concentration of sodium hyaluronate enzyme was 1 mg / mL.
[0050] (G) The sodium hyaluronate solution was centrifuged at 3000g for 30 minutes at 4°C to remove unreacted sodium hyaluronate enzyme and obtain a pure sodium hyaluronate solution.
[0051] (H) The concentration of sodium hyaluronate solution was determined by ultraviolet absorbance and adjusted to 16 mg / mL.
[0052] (I) Mix the recombinant type III humanized collagen solution and sodium hyaluronate solution at a ratio of 1:5, stir evenly to obtain a composite solution, and stir for 2 hours.
[0053] (J) Mix the composite solution described in (I) with phosphate buffer at a mass ratio, adjust the pH to 7.0, and the osmotic pressure to 270 mOsmol / kg;
[0054] (K) Load the (J) mixture into a pre-filled syringe.
[0055] Example 2:
[0056] In vitro cell viability assay of the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared using Example 1, see [link to Example 1]. Figure 1 .
[0057] Example 3:
[0058] Cell adhesion assay using the sodium hyaluronate and recombinant type III humanized collagen composite solution prepared in Example 1, see [link to example]. Figure 2 .
[0059] Example 4:
[0060] Proliferation assay of the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared using Example 1, see [link to example]. Figure 3 .
[0061] Example 5:
[0062] Cell migration assays using the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared in Example 1 are shown below. Figure 4 .
[0063] Example 5:
[0064] Masson's test in rats using the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared in Example 1 for 1 week is shown in [link to example 1]. Figure 5 .
[0065] Example 6:
[0066] The expression of type I and type III collagen mRNA in rat dorsal skin for 2 weeks using the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared in Example 1 is shown in the figure. Figure 6 .
[0067] Example 7:
[0068] Electron micrograph of the dermal layer of the dorsal skin of rats after one week in vivo using the sodium hyaluronate and recombinant type III humanized collagen complex solution prepared in Example 1 is shown below. Figure 7 .
[0069] In the above embodiments, the recombinant type III humanized collagen can be sourced from Jiangsu Yaohai Nuoxin Biotechnology Co., Ltd., with the product name: Recombinant Type III Humanized Collagen Solution, model: CHYHCOL002-Ⅲ, production batch number: CH202401001, and packaging specifications: 250mL / bottle, 1L / bottle.
[0070] While the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the invention. Those skilled in the art can make various modifications and refinements without departing from the spirit and scope of the invention. Therefore, the scope of protection of the present invention shall be determined by the claims.
Claims
1. A method for preparing a composite solution of sodium hyaluronate and recombinant type III humanized collagen, characterized in that, Includes the following steps: Step 1: Preparation of recombinant type III humanized collagen; Step 2: Prepare a sodium hyaluronate solution; Step 3: Mix recombinant type III humanized collagen with sodium hyaluronate solution and stir until homogeneous to obtain a composite solution; Step one includes: Step 1 (1) Modify human natural type III collagen and artificially screen and design recombinant type III humanized collagen COL3A1-QS-1, whose amino acid sequence SEQ ID NO.1 is SEQ ID NO1: GTSGYQGKDGESGERGHRGRNGEKGETGENGENGERGNDGSDGSNGQRGKNGERGKDGERGEKGERGRDGSDGSQGESGNDGKNGERGKNGETGDKGDTG ENGERGERGDKGKDGDKGERGETGQNGERGEKGERGSNGKDGNTGEKGRDGRDGDRGENGKSGDRGESGSRGDKGETGERGHRGQQGKDGTSGNRGERGSE Step 1 (2) The nucleic acid sequence encoding the recombinant type III humanized collagen is shown in SEQ ID NO:
2. GGTACTTCTGGTTATCAAGGTAAAGATGGTGAATCTGGTGAAAGAGGTCATAGAGGTAGAAATGGTGAAAAAGGTGAAACTGGTGAAAATGGTGAAAACGGTGAAAGAGGAAACGATGGTTCTGATGGTTCTAATGGTCAAAGAGGTAAAA ACGGTGAAAGAGGTAAAGATGGAGAAAGAGGTGAAAAAGGAGAAAGAGGAAGAGATGGTTCTGACGGTTCTCAAGGTGAATCTGGAAACGATGGAAAAAACGGTGAGAGAGGTAAAAATGGTGAAACTGGAGATAAGGGTGACACTGGTGAA AACGGAGAAAGAGGTGAGAGAGGAGATAAAGGTAAAGATGGTGACAAAGGTGAAAGAGGTGAAACTGGTCAAAATGGTGAAAGAGGTGAAAAGGGTGAAAGAGGTTCTAACGGTAAAGATGGTAACACTGGTGAAAAAGGTAGAGATGGTA GAGATGGAGATAGAGGTGAAAACGGTAAATCTGGTGACAGAGGTGAATCTGGTTCTAGAGGTGACAAAGGAGAAACTGGTGAGAGAGGTCATAGAGGACAACAAGGTAAAGACGGTACTTCTGGAAACAGAGGTGAAAGAGGTTCCGAAtaa Step 1 (3) The optimized sequence was copied to the gene synthesis company to synthesize the collagen COL3A1-QS-1 gene (the sequence is shown in SEQ ID NO: 2). The synthesized sequence was integrated into the expression vector, and finally the pPICZα A-COL3A1-QS-1 plasmid was constructed and named YH-COL3A1-QS-1. Step 1 (4) Amplify, extract and digest the recombinant type III humanized collagen COL3A1-QS-1 expression plasmid; Step 1 (5) Add recombinant type III humanized collagen COL3A1-QS-1 recombinant plasmid to P. PastorisX-33 competent cells; Step 1 (6) Pichia pastoris engineered strains induce expression of recombinant humanized collagen COL3A1-QS-1; Step 1 (7) Culture the recombinant type III humanized collagen expression cells to an appropriate density, add an inducer, and express the collagen; Step 1 (8) Collect the expression cells, break the cells by ultrasound, and obtain the recombinant type III humanized collagen expression solution; Step 1 (9) Adjust the concentration of the purified recombinant type III humanized collagen expression solution to 1.0%~15.0%.
2. The method for preparing the sodium hyaluronate and recombinant type III humanized collagen composite solution according to claim 1, characterized in that, Step two includes: Step 2 (1) React sodium hyaluronate with sodium hyaluronate enzyme and stir at 37°C for 2-4 hours to obtain sodium hyaluronate solution; Step 2 (2) Remove unreacted sodium hyaluronate enzyme from the sodium hyaluronate solution by ultrafiltration and centrifugation to obtain a pure sodium hyaluronate solution; Step 2 (3) Measure the concentration of the sodium hyaluronate solution and adjust it to the required concentration; Step 2 (4) Adjust the concentration of sodium hyaluronate solution to a mass fraction of 10%~30%.
3. The method for preparing the sodium hyaluronate and recombinant type III humanized collagen composite solution according to claim 1, characterized in that, Step three includes: Step 3 (1) Mix the two solutions from Step 1 and Step 2 above, and stir at 0~8℃ for 1~3 hours until they are evenly mixed; Step 3 (2) Prepare a phosphate buffer system by adding the mixed solution from (1) and adjusting the pH to 6.0~8.0 and the osmotic pressure to 200mOsmoL / kg~400mOsmoL / kg; Step 3 (3) Fill the above mixture into a pre-filled syringe under sterile conditions to obtain the finished product.