A rapid and instant detection method for influenza based on electrochemical biosensing

By using an electrochemical sensor based on single-stranded DNA aptamers and magnetic beads, rapid detection of influenza A virus without nucleic acid amplification was achieved, solving the problems of detection speed and equipment dependence in existing technologies, and providing a rapid, sensitive and simple detection solution.

CN122128312APending Publication Date: 2026-06-02SHENZHEN TECH UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610401746.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-30
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing methods for detecting influenza A virus are difficult to achieve rapid and sensitive detection in field and resource-constrained scenarios. Traditional nucleic acid amplification techniques are complex to operate and rely on specialized equipment, which limits the application of portable electrochemical detection platforms.

Method used

A single-stranded DNA aptamer capture probe that specifically recognizes influenza A virus nucleic acid is used, combined with magnetic bead enrichment technology and screen-printed electrode electrochemical sensor to achieve rapid detection without nucleic acid amplification, and electrochemical detection is performed by differential pulse voltammetry.

Benefits of technology

It enables rapid and sensitive detection of influenza A virus, suitable for field and resource-constrained environments, simplifies operation, reduces costs, and is suitable for home testing and rapid screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128312A_ABST
    Figure CN122128312A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of rapid detection technology, specifically relating to a rapid, real-time detection method for influenza A based on electrochemical biosensors. This invention provides an aptamer that specifically recognizes the influenza A virus, and uses a pairing affinity reagent to enrich the aptamer onto magnetic beads to prepare a probe that specifically recognizes the influenza A virus. Then, using this probe, MB solution, and screen-printed electrodes, an electrochemical biosensor that specifically recognizes the influenza A virus is fabricated. Qualitative or quantitative detection of influenza A virus using the electrochemical biosensor of this invention eliminates the need for complex pretreatment and viral nucleic acid amplification, greatly simplifying the operation. The results are stable and reliable, making it suitable for real-time detection applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rapid detection technology, specifically relating to an electrochemical detection method for rapid detection of H1N1 influenza virus nucleic acid and the electrochemical sensor used for detection. Background Technology

[0002] Influenza A virus (H1N1) is one of the main pathogens causing seasonal influenza epidemics and periodic pandemics, resulting in numerous infections and deaths worldwide and posing a continuous threat to public health security. H1N1 exhibits significant genetic diversity, and is particularly harmful to the elderly, children, and immunocompromised populations. Therefore, developing rapid and accurate detection methods for influenza A virus is of great importance for early clinical diagnosis and epidemic prevention and control.

[0003] Currently, the detection of influenza A virus mainly relies on virus culture, immunological detection, and nucleic acid detection. Virus culture detection has a long cycle, making it difficult to meet the needs of rapid clinical diagnosis; immunological detection is simple to operate but has limited sensitivity and is prone to false negative results in low viral load or early infection. Nucleic acid detection based on reverse transcription polymerase chain reaction (RT-PCR) has high sensitivity and specificity and is considered the gold standard for clinical diagnosis, but it is highly dependent on instrument conditions and operating environment, limiting its application in on-site testing and resource-constrained scenarios. For example, CN102230938A discloses an influenza A virus detection kit and method based on immunomagnetic bead enrichment. The kit includes components of an immunoenrichment reaction system (A), a loop-mediated isothermal nucleic acid amplification system (B), antibody preparation (C), immunomagnetic bead preparation (D), and specific primers for influenza A H1N1 virus (E). The detection method includes immunoenrichment (a), using viral nucleic acid as a template for loop-mediated isothermal amplification reaction (b), loop-mediated isothermal amplification reaction (c), and result determination (d). The method's good specificity and high sensitivity are based on the detection principle of nucleic acid amplification. However, it requires pretreatment for influenza A virus nucleic acid amplification, making it difficult to integrate with portable electrochemical detection platforms and limiting its application in POCT (point-of-care testing) scenarios. Summary of the Invention

[0004] Based on this, this invention develops a rapid, real-time detection method for influenza A based on electrochemical biosensing. It utilizes a capture probe loaded with a single-stranded DNA aptamer that specifically recognizes influenza A nucleic acid, and employs screen-printed electrodes (SPEs) for electrochemical detection of the influenza A nucleic acid. This rapid, real-time detection method for influenza A based on electrochemical sensing eliminates the need for amplification of influenza A virus nucleic acid, achieving rapid, sensitive, and timely detection, significantly improving detection efficiency. Furthermore, compared to traditional methods, it is compact, easy to use, and has low production costs. It requires no professional personnel to operate, greatly reducing labor costs, and is particularly suitable for on-site testing, home testing, and rapid screening under resource-constrained conditions.

[0005] The technical solution of this invention is an aptamer that specifically recognizes influenza A virus nucleic acid, having the nucleotide sequence shown in SEQ ID NO. 1. This aptamer can recognize both influenza A virus RNA and influenza A virus cDNA.

[0006] CTGTGGATGTTGACGATGGT (SEQ ID NO. 1).

[0007] The present invention also provides a capture probe for specifically recognizing influenza A virus nucleic acid, comprising magnetic beads and an aptamer specifically recognizing influenza A virus nucleic acid coated on the surface of the magnetic beads, wherein the aptamer specifically recognizing influenza A virus nucleic acid has the nucleotide sequence shown in SEQ ID NO.1.

[0008] The aptamer specifically recognizing influenza A virus nucleic acid is coated onto magnetic beads using a pairing affinity reagent. This pairing affinity reagent is selected from any one of the following: biotin and streptavidin, biotin and avidin, small molecule hapten and anti-hapten antibody, short peptide tag and anti-tag antibody, protein tag and immobilized ligand, lectin and specific carbohydrate structure, preferably biotin and streptavidin, with the biotin containing triethylene glycol (TEG). The small molecule hapten and anti-hapten antibody are selected from any one of digoxigenin and anti-digoxigenin antibody, DNP and anti-DNP antibody, and FITC and anti-FITC antibody. The short peptide tag and anti-tag antibody are selected from Flag and anti-Flag antibody, Myc and anti-Myc antibody, HA and anti-HA antibody, His and immobilized metal ions (such as Ni). 2+ -NTA, Co 2+ -CMA / IDA, Cu 2+ The protein tag and immobilized ligand are selected from GST and glutathione, MBP and cross-linked starch / maltose, respectively.

[0009] The present invention also provides a method for preparing a capture probe that specifically recognizes influenza A virus nucleic acid, comprising the following steps: incubating magnetic beads with an aptamer that specifically recognizes influenza A virus nucleic acid under the action of a pairing affinity reagent, coating the aptamer that specifically recognizes influenza A virus nucleic acid onto the surface of the magnetic beads, thereby obtaining a capture probe that specifically recognizes influenza A virus nucleic acid; wherein the aptamer that specifically recognizes influenza A virus nucleic acid has the nucleotide sequence shown in SEQ ID NO.1. Specifically, the steps include: (1) coating the magnetic beads with pairing affinity reagent one, washing and resuspending them with buffer 1, washing 1-3 times; (2) adding the aptamer that specifically recognizes influenza A virus nucleic acid, wherein the 5' end of the aptamer is connected to pairing affinity reagent two, incubating, coating the aptamer that specifically recognizes influenza A virus nucleic acid onto the surface of the magnetic beads, washing with buffer 3, thereby obtaining a capture probe that specifically recognizes influenza A virus nucleic acid. As one implementation method, the steps include: (1) coating magnetic beads with streptavidin, washing and resuspending them with buffer 1, washing 1-3 times; (2) adding an aptamer that specifically recognizes influenza A virus nucleic acid, with biotin attached to the 5' end of the aptamer, incubating, coating the surface of the magnetic beads with the aptamer that specifically recognizes influenza A virus nucleic acid, washing with buffer 3, and obtaining a capture probe that specifically recognizes influenza A virus nucleic acid. Triethylene glycol (TEG) is also attached between the aptamer and the biotin attached to its 5' end.

[0010] The pairing affinity reagent is selected from any one of biotin and streptavidin, biotin and avidin, small molecule hapten and anti-hapten antibody, short peptide tag and anti-tag antibody, protein tag and immobilized ligand, lectin and specific carbohydrate structure, preferably biotin and streptavidin, with the biotin containing triethylene glycol (TEG). The small molecule hapten and anti-hapten antibody is selected from any one of digoxigenin and anti-digoxigenin antibody, DNP and anti-DNP antibody, FITC and anti-FITC antibody. The short peptide tag and anti-tag antibody is selected from Flag and anti-Flag antibody, Myc and anti-Myc antibody, HA and anti-HA antibody, His and immobilized metal ions (such as Ni). 2+ -NTA, Co 2+ -CMA / IDA, Cu 2+ The protein tag and immobilized ligand are selected from GST and glutathione, MBP and cross-linked starch / maltose, respectively.

[0011] The incubation conditions are: shaking incubation at room temperature or 25°C for 15±2 minutes.

[0012] In the incubation system, the concentration of the aptamer that specifically recognizes the nucleic acid of influenza A virus is 0.5-2 μM, preferably 1 μM.

[0013] The buffer solution 1 contains: 10 mM Tris-HCl, 1 mM EDTA, and 2 M NaCl.

[0014] The buffer solution 3 is a PBS solution containing: NaCl 136.89 mM, KCl 2.67 mM, Na2HPO4 8.10 mM, KH2PO4 1.76 mM, pH 7.2-7.4.

[0015] The magnetic beads are sealed before being coated with the pairing affinity reagent, such as by using BSA for sealing.

[0016] This invention also provides an electrochemical biosensor for rapid, real-time detection of influenza A, comprising a screen-printed electrode, a detector connected to the screen-printed electrode, and the aforementioned capture probe for specifically recognizing influenza A virus nucleic acid. The screen-printed electrode is an electrochemical sensor fabricated by depositing conductive material on a substrate using screen printing technology, and includes a reference electrode, a counter electrode, and a working electrode. The screen-printed electrode is used to precisely control the potential and measure the current response, converting the signal generated by biorecognition into a quantifiable electrical signal (such as changes in current, voltage, or charge). The detector is used to acquire, amplify, and digitize the electrical signal generated by the screen-printed electrode. The detector also incorporates a smartphone integration module to transmit the digitized electrical signal to a mobile phone for calculation and result display.

[0017] This invention also provides a rapid, real-time detection method for influenza A based on electrochemical biosensing, comprising the following steps: the capture probe specifically recognizing influenza A virus nucleic acid provided above is washed and resuspended with buffer 2, then the sample to be tested is added and incubated to obtain a capture probe that has been captured and incubated; the capture probe that has been captured and incubated is washed and resuspended with buffer 3, then MB (methylene blue) solution is added and incubated, then washed and resuspended with buffer 3 again, and then dropped onto the screen-printed electrode of the electrochemical biosensor above, followed by the addition of electrolyte, and electrochemical detection is performed to achieve qualitative and / or quantitative detection of influenza A virus.

[0018] This invention relates to a rapid and immediate detection method for influenza A based on electrochemical biosensing, which can identify influenza A virus nucleic acids as RNA and / or cDNA.

[0019] The electrochemical detection method is differential pulse voltammetry (DPV).

[0020] The buffer solution 2 contains: 120 mM NaCl, 10 mM Tris-HCl, 20 mM MgCl2, 5 mM KCl, pH 7.4.

[0021] The electrolyte was prepared using PBS solution as a solvent and contained: 5 mM [Fe(CN)6]3+ / 4+ 0.1 M KCl. The composition of the PBS solution is shown in Buffer 3.

[0022] When the sample to be tested contains viral RNA, it can be inactivated first. The inactivation method is high-temperature inactivation, such as heating at 100°C for 5 minutes.

[0023] The buffer solution 2 is washed 1-3 times.

[0024] The buffer solution 3 is used for washing 1-3 times.

[0025] In the incubation system, the concentration of the MB solution is 10-80 μM, preferably 50 μM.

[0026] Compared with traditional nucleic acid detection (PCR), this invention uses magnetic bead capture probes and magnetic bead enrichment and separation technology for influenza A virus detection based on electrochemical biosensing, which eliminates the need for pretreatment and nucleic acid amplification steps, greatly simplifying the operation, shortening the time, and improving the detection efficiency.

[0027] This invention proposes an electrochemical biosensing method for influenza A virus RNA that does not require nucleic acid amplification by constructing an electrochemical nucleic acid detection system based on functionalized magnetic beads. This method enables rapid and sensitive detection of influenza A virus and is suitable for on-site testing, home testing, and rapid screening applications in resource-constrained environments. Attached Figure Description

[0028] Figure 1 This is a schematic diagram of an electrochemical nucleic acid sensor for rapid detection of H1N1 influenza virus nucleic acid and its detection principle.

[0029] Figure 2 This is a schematic diagram of the H1N1 virus nucleic acid detection concentration range of an electrochemical nucleic acid sensor used for rapid detection of H1N1 virus nucleic acid.

[0030] Figure 3 This is a diagram of an electrochemical nucleic acid clinical sample test used for rapid detection of H1N1 virus nucleic acid. Detailed Implementation

[0031] I. Buffer Preparation Buffer 1: 10 mM Tris-HCl, 1 mM EDTA, 2 M NaCl.

[0032] Buffer 2: 120 mM NaCl, 10 mM Tris-HCl, 20 mM MgCl2, 5 mM KCl, pH 7.4.

[0033] Buffer 3 (PBS solution): NaCl 136.89 mM, KCl 2.67 mM, Na2HPO4 8.10 mM, KH2PO4 1.76 mM, pH 7.2-7.4.

[0034] MB solution: 500 µM MB solution, prepared using PBS solution as solvent.

[0035] Electrolyte: Prepared using buffer 3 (PBS solution) as the solvent, containing 5 mM [Fe(CN)6] in each solution. 3+ / 4+ 0.1 M KCl.

[0036] II. Preparation of Functionalized Magnetic Bead Trapping Probes To immobilize the DNA oligomer capture probe, streptavidin-coated magnetic beads (1 μm in diameter and pre-blocked with BSA) were brought to room temperature and then resuspended by gentle agitation for more than 30 seconds. 10 μL of the magnetic beads were then transferred to a new centrifuge tube.

[0037] Magnetic separation and supernatant disposal: Wash the streptavidin-coated magnetic beads three times with buffer 1, place the centrifuge tube on a magnet for 1 minute, then discard the supernatant and resuspend the magnetic beads in 50 μL of buffer 1.

[0038] Add 1 μL of 100 μM biotinylated single-stranded DNA (CTGTGGATGTTGACGATGGT, 5' end modified with 5' Biotin-TEG), and 49 μL of enzyme-free ultrapure water. Incubate the mixture at 25°C (room temperature) in a shaker at 200 rpm for 15 minutes. Finally, wash the obtained biotinylated single-stranded DNA with streptavidin-coated magnetic beads three times with buffer 3 to remove excess biotinylated single-stranded DNA.

[0039] III. Blank Sample Configuration Add 10 μL of 500 μM MB solution to the functionalized magnetic bead capture probe, incubate on a shaker for 30 min, wash 3 times with buffer 3, and resuspend in 50 μL of buffer 3.

[0040] IV. Viral RNA or viral cDNA capture Wash the functionalized magnetic bead capture probe three times with buffer 2, and resuspend the solution in 90 μL of buffer 2. Heat the viral RNA (Target) in a 100°C metal bath for 5 min. After the heating program is complete, immediately transfer the sample to an ice bath, and then add 10 μL to the functionalized magnetic bead capture probe; or add 10 μL of viral cDNA solution to the functionalized magnetic bead capture probe; react the mixture in a 37°C metal bath for 10 min to form double-stranded modified magnetic microspheres. Wash the obtained product three times with buffer 3, and then disperse it in 90 μL of buffer 3. Add 10 μL of 500 μM MB solution to the functionalized magnetic bead capture probe, incubate on a shaker for 30 min, wash three times with buffer 3, and resuspend in 50 μL of buffer 3.

[0041] V. Manufacturing of Biosensors Commercial product of three-electrode system prepared by screen printing (Changsha Sanjun Electronics Technology Co., Ltd., model C2000).

[0042] VI. Detection using biosensors (1) The screen-printed electrode prepared by screen printing is connected to the detector, and the detector is connected to the smartphone through the built-in smartphone integration module; (2) Open the APP on your smartphone and confirm that the device is connected properly; (3) First, add the blank sample solution prepared in step 3 and the sample solution prepared in step 4 that captures viral RNA or captures viral cDNA to different screen-printed electrodes, and then add the electrolyte. (4) Click the "Start" button in the APP; (5) The detection system starts working and obtains detection data. The specific detection method is to use the differential pulse voltammetry (DPV) method built into the system, drop the sample solution onto the sensor for detection, the detection potential range is -0.5 to -0.1V, the scanning speed is 20mV / s, and the detection curve is displayed on the mobile phone. (6) Save and analyze data on the mobile phone; (7) Clean the electrodes or change the electrodes; (8) Repeat the above steps to perform cyclic multi-sample testing.

[0043] VII. Test Results (1) Examination of linear relationships The influenza A virus cDNA (sequence: AGCTCTATGTTGACAAAATGACCATCGTCAACAT) CCACAG (SEQ ID NO.2, provided by Sangon Biotech (Shanghai) Co., Ltd.) was used as a sample. The sample solution was prepared according to the procedure in "IV. Viral RNA or Viral cDNA Capture". The concentrations of influenza A virus cDNA in each capture system were 10 aM, 100 aM, 1 fM, 10 fM, 100 fM, and 1 pM, respectively. The biosensor of this invention was used for detection.

[0044] like Figure 2 As shown, the calibration data can be well fitted by the following linear regression equation: target RNA: ΔI = 0.374×logC + 6.68, R 2 = 0.933, where C represents the target concentration. Based on the limit of detection (LOD) = 3.3σ / S, where σ is the standard deviation of the blank sample and S is the slope of the calibration curve, the target RNA detection limit is calculated to be approximately 3 aM.

[0045] (2) Spiked recovery investigation Preparation of blank sample solution: First, add artificial saliva (Shanghai Yuanye Biotechnology Co., Ltd., KR44173A) to the functionalized magnetic bead capture probe, react in a metal bath at 37℃, and then incubate with 500 μM MB solution to obtain blank sample solution.

[0046] Preparation of test sample solution: Using artificial saliva containing influenza A virus cDNA as a sample, the test sample solution was prepared according to the procedure in "IV. Viral RNA or Viral cDNA Capture". In each capture system, the concentration of influenza A virus cDNA was 100 aM, 1 fM, 10 fM and 100 fM, respectively. The biosensor of the present invention was used for detection.

[0047] The artificial saliva spiked recovery experiment performed well at all four concentration points: 100 aM: 97.43% ± 2.85%, 1 fM: 97.86% ± 3.68%, 10 fM: 96.02% ± 4.80%, and 100 fM: 96.38% ± 4.52%. The overall recovery rate was concentrated between 96.0% and 97.9% with small errors, indicating that the method is reliable in terms of quantitative accuracy and suitable for concentration determination of real samples.

[0048] (3) Specificity assessment The specificity of the biosensor of the present invention for detecting influenza A virus was investigated using severe acute respiratory syndrome coronavirus cDNA (GTTCCTCATCACGTAGTCGCAACAGTTCAA, SEQ ID NO.3, provided by Sangon Biotech (Shanghai) Co., Ltd.) and influenza B virus cDNA (CTCCATCTTCTGTCAATGAAAGCAGGTAGG, SEQ ID NO.4, provided by Sangon Biotech (Shanghai) Co., Ltd.) as interferences.

[0049] Specificity results showed a significant distinction between the target sequence and the interfering sequence: the average response of 1 fM influenza A virus cDNA was 100% (9.732 × 10⁻⁶). -7 Compared to other strains, the response rates for severe acute respiratory syndrome coronavirus (SARS-CoV) and influenza B virus were only 13.48% (1.312 × 10⁻⁶). -7 ), 15.44% (1.502×10 -7 The responses to single-base mismatches (base substitution A>C at position 21 of the sequence shown in SEQ ID NO.2, provided by Sangon Biotech (Shanghai) Co., Ltd.), three-base mismatches (three consecutive base substitutions at positions 24-26 of the sequence shown in SEQ ID NO.2: A>C, T>G, C>A, provided by Sangon Biotech (Shanghai) Co., Ltd.), and full-sequence mismatches (base differences at positions 1, 3-9, 11, 13, 15-16, 18-23, 25, 29-32, 35-37, and 40 of the sequence shown in SEQ ID NO.2, totaling 27 mismatch sites, are as follows: GGTATACGTTAGGCGTACCTTGGAACGTTCCGATAGTCAA, SEQ ID NO.5, provided by Sangon Biotech (Shanghai) Co., Ltd.) in the mismatched sequences were 16.76%, 16.32%, and 15.69%, respectively. The corresponding selectivity ratio (target sequence / interference) is approximately 5.97-7.42 times.

[0050] (4) Stability test Biosensor detection was performed continuously for 30 days using the same blank sample. The results are as follows: The current on the first day was 8.469 × 10⁻⁶. -7 Based on 100% baseline, the current on the third day was 7.126 × 10⁻⁶. -7 (Retention rate 84.14%), current on day 30 was 6.642 × 10⁻⁶. -7 (Retention rate 78.43%). The results show that the sensor can still maintain about 78% of the signal output on a 30-day timescale, demonstrating a certain degree of storage stability.

[0051] (5) Repeatability testing Five blank samples were set up in parallel, and each was tested using an independent electrode. The test results are as follows: the average current detected by the five independent electrodes was approximately 1.022 × 10⁻⁶. -6 A, standard deviation 5.55 × 10 -8 A, Relative Standard Deviation (RSD) = 5.43%. This RSD is within the acceptable range commonly found in electrochemical biosensing, indicating good batch-to-batch consistency in electrode preparation and detection processes.

[0052] (6) Clinical sample testing applications Sample solutions were prepared using the viral RNA capture method described above in this invention. Electrochemical biosensing was used to detect RNA in clinical negative and clinical positive samples. The correlation between the electrochemical biosensing detection results of clinical positive samples and their reverse transcription quantitative PCR cycle threshold was analyzed to examine the clinical sample detection application of the biosensor of this invention.

[0053] The results are as follows Figure 3 As shown, negative and positive samples can be clearly distinguished based on their electrochemical responses. For positive samples, the electrochemical signal (ΔI) and the corresponding reverse transcription quantitative PCR cycle threshold (Ct value) show a significant negative correlation (Figure 3b). Pearson correlation analysis showed a correlation coefficient |r| > 0.9, indicating a high degree of consistency between the electrochemical detection results and the reverse transcription quantitative PCR results. This study also fitted a regression line and labeled the 95% confidence interval, further confirming the statistical robustness of this correlation.

Claims

1. An aptamer that specifically recognizes influenza A virus nucleic acid, characterized in that, It has the nucleotide sequence shown in SEQ ID NO.

1.

2. A capture probe that specifically recognizes influenza A virus nucleic acid, characterized in that, The invention comprises magnetic beads and an aptamer coated on the surface of the magnetic beads that specifically recognizes influenza A virus nucleic acid, the aptamer having the nucleotide sequence shown in SEQ ID NO.

1.

3. The capture probe according to claim 2, characterized in that, The aptamer that specifically recognizes influenza A virus nucleic acid is coated onto magnetic beads using a pairing affinity reagent.

4. A method for preparing a capture probe that specifically recognizes influenza A virus nucleic acid, characterized in that, The steps include: Magnetic beads were incubated with aptamers that specifically recognize influenza A virus nucleic acid under the action of a pairing affinity reagent. The aptamers that specifically recognize influenza A virus nucleic acid were coated on the surface of the magnetic beads to obtain capture probes that specifically recognize influenza A virus. The aptamer that specifically recognizes influenza A virus nucleic acid has the nucleotide sequence shown in SEQ ID NO.

1.

5. The preparation method according to claim 2, characterized in that step include: (1) The magnetic beads are coated with the pairing affinity reagent 1, washed and resuspended with buffer 1; (2) Add the aptamer that specifically recognizes the nucleic acid of influenza A virus, the 5' end of the aptamer is connected to the pairing affinity reagent 2, incubate, the aptamer that specifically recognizes the nucleic acid of influenza A virus is coated on the surface of the magnetic beads, washed with buffer 3, and the capture probe that specifically recognizes the nucleic acid of influenza A virus is obtained.

6. An electrochemical biosensor for rapid, real-time detection of influenza A, characterized in that, It includes a screen-printed electrode, a detector connected to the screen-printed electrode, and a capture probe as described in claim 2 or 3.

7. A rapid and real-time detection method for influenza A based on electrochemical biosensing, characterized in that the steps include... include: The capture probe described in claim 2 or 3 is washed with buffer 2 and resuspended, then the sample to be tested is added and incubated to obtain the capture probe after capture incubation. The capture probe, after being washed and resuspended with buffer 3, is incubated with MB solution, washed and resuspended again with buffer 3, and then dropped onto the screen-printed electrode of the electrochemical biosensor of claim 6 for electrochemical detection, thereby realizing the qualitative and / or quantitative detection of influenza A virus.

8. The rapid and immediate detection method for influenza A according to claim 7, characterized in that, The buffer solution 2 contains: 120 mM NaCl, 10 mM Tris-HCl, 20 mM MgCl2, 5 mM KCl, pH 7.4; The buffer solution 3 is a PBS solution.

9. The rapid and immediate detection method for influenza A according to claim 7, characterized in that, The electrochemical detection method is differential pulse voltammetry.

10. The rapid and immediate detection method for influenza A according to claim 7, characterized in that, In the incubation system, the concentration of the MB solution is 10-80 μM.

Citation Information

Patent Citations

  • Kit and method for detecting influenza A virus based on immune magnetic bead enrichment

    CN102230938A