Methods for constructing and applying a spontaneous mouse model of psoriasis.
By inserting loxP sites into mouse embryonic stem cells and inducing them with Krt14-CreERT2+/- and tamoxifen, a spontaneous psoriasis mouse model was constructed, which solved the problem of short phenotype maintenance time in existing models and realized the simulation and long-term observation of the chronic course of psoriasis.
Patent Information
- Application Number
- CN202610631819.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-08
- Publication Date
- 2026-06-30
- Estimated Expiration
- 2046-05-08
AI Technical Summary
Existing animal models of psoriasis are induced by exogenous stimuli, and the phenotype is maintained for a short time. They cannot simulate the chronic process of human diseases and are therefore difficult to use for studying the natural course of the disease and evaluating long-term drug efficacy.
A spontaneous psoriasis mouse model was constructed by inserting the loxP site into the Fasn gene of mouse embryonic stem cells. The spontaneous psoriasis model was established by induction with Krt14-CreERT2+/- and tamoxifen.
The constructed spontaneous psoriasis mouse model can spontaneously mimic the chronic course of human psoriasis, exhibits a durable and stable phenotype, possesses the core pathological features of psoriasis, and is suitable for long-term observation and drug screening.
Smart Images

Figure CN122139697B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology. More specifically, this invention relates to a method for constructing a genetically engineered mouse model, and even more specifically, this invention relates to a method for constructing a spontaneous psoriasis mouse model using conditional gene knockout technology and its application. Background Technology
[0002] Existing animal models of psoriasis are usually obtained through induction by exogenous stimuli (such as imiquimod and interleukin-23). For example, in mice, continuous topical application of imiquimod for about 5 days can induce obvious erythematous scaling and thickening of the ears / skin. When imiquimod stimulation is stopped, the recovery period begins, and the dryness and roughness of the lesions gradually alleviate and tend to recover over time. The phenotype usually gradually fades within the set 30-day rest period.
[0003] This type of psoriasis animal model induced by exogenous stimuli has the drawback of short phenotypic maintenance time and cannot simulate the spontaneous chronic process of human disease. Therefore, it is difficult to use it for studying the natural course of the disease and evaluating long-term drug efficacy. Summary of the Invention
[0004] Based on this, the purpose of the present invention is to provide a method for constructing a spontaneous psoriasis mouse model. The psoriasis mouse model constructed by the method can spontaneously simulate the chronic course of human psoriasis, and the phenotype of the mouse model is durable and stable.
[0005] The specific technical solutions for achieving the above-mentioned objectives are as follows.
[0006] In a first aspect, the present invention provides fatty acid synthase. Fasn Genes in the construction of spontaneous psoriasis
[0007] Application in mouse models, the fatty acid synthase Fasn The nucleotide sequence of the gene is as shown in SEQ ID NO:1
[0008] As shown.
[0009] A second aspect of the present invention provides a method for constructing a spontaneous psoriasis mouse model, comprising the following steps:
[0010] (1) Fatty acid synthase in mouse embryonic stem cells Fasn After inserting two loxP sites in the same orientation into the gene, chimeric mice were obtained by injecting correctly identified embryonic stem cell clones into blastocysts; these chimeric mice were then mated with wild-type mice to obtain... Fasn -flox heterozygote (i.e. Fasn flox / + Mice; Fasn -flox heterozygous mice were self-crossed to obtainFasn flox / flox Mice;
[0011] (2) Take the steps from (1) Fasn flox / flox Mice and tool mice Krt14-CreERT2 + / - Pairing and grouping animals together to screen for genotypes that are suitable for breeding. Krt14-CreERT2 + / - ;Fasn flox / + Mice;
[0012] (3) The results obtained in step (2) Krt14-CreERT2 + / - ;Fasn flox / + The mice and the mice in step (1) Fasn flox / flox Mice were paired and housed together to screen for genotypes. Krt14-CreERT2 + / - ;Fasn flox / flox Mice;
[0013] (4) The genotype mentioned in step (3) is Krt14-CreERT2 + / - ;Fasn flox / flox A spontaneous psoriasis mouse model can be obtained by inducing mice with tamoxifen for 5 to 8 consecutive days.
[0014] In a third aspect, the present invention provides a spontaneous psoriasis mouse model constructed by the above-described construction method.
[0015] In a fourth aspect, the present invention provides the application of the above-described spontaneous psoriasis mouse model in the study of the pathological mechanism of psoriasis and / or in the screening of drugs for the treatment of psoriasis.
[0016] The inventors of this invention discovered that by targeting and knocking out fatty acid synthase in mouse epidermal cells... FasnGenes were successfully used to construct a mouse model that spontaneously exhibits the core pathological features of psoriasis without the need for external stimulation. On days 7-8 after induction, this mouse model gradually developed psoriasis-like skin lesions (including erythema, scaling, and skin thickening) on multiple sites throughout the body, simulating the spontaneous initiation of the disease. The phenotype persisted for a long period after its appearance (the keratotic phenotype remained stable for up to six months, followed by a slow period of spontaneous remission; by one year after modeling, scaling on the palms, soles, and tail had significantly subsided, with only localized scaling remaining around the eyes, and typical post-inflammatory hyperpigmentation in the affected areas), simulating the chronic maintenance process of the disease. Histopathological examination showed that the mice possessed the core features of psoriasis, including hyperkeratosis, parakeratosis, acanthosis, neutrophilic microabscesses, and dermal inflammatory cell infiltration, highly similar to human psoriasis lesions. Simultaneously, activation of key inflammatory pathways in psoriasis (such as the IL-23 / Th17 axis) was observed, reproducing the key mechanisms of the disease from a metabolic-immune interaction perspective.
[0017] The spontaneous psoriasis mouse model constructed by this invention is superior to the acute model that requires exogenous induction, making it easier to conduct long-term observation and intervention experiments. It provides a more ideal tool for studying the pathogenesis of psoriasis and screening and evaluating new drug candidates for psoriasis.
[0018] The construction method of this invention has high reproducibility, and the proportion and time window of phenotypes appearing in individuals of the same batch / under the same conditions are basically consistent. Attached Figure Description
[0019] Figure 1 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox The phenotype of mice.
[0020] Figure 2 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox Histopathological features of mice.
[0021] Figure 3 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox Immunofluorescence results of the palms and soles of mice.
[0022] Figure 4 for Krt14-CreERT2 + / - ;Fasn flox / flox andFasn flox / flox Results of reverse transcription-real-time quantitative PCR of mouse epidermal differentiation and barrier-related transcription factors.
[0023] Figure 5 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox Mouse chemokine reverse transcription-
[0024] Results of real-time quantitative PCR.
[0025] Figure 6 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox Mouse inflammatory factor reverse transcription-
[0026] Results of real-time quantitative PCR.
[0027] Figure 7 for Krt14-CreERT2 + / - ;Fasn flox / flox and Fasn flox / flox Electrophoretic pattern of mouse skin tissue.
[0028] for + / - flox / flox and flox / flox mouse skin tissue Real-time quantitative PCR results of mRNA expression levels.
[0029] for + / - flox / flox and flox / flox Immunofluorescence staining results of Fasn protein in mouse back skin tissue. Detailed Implementation
[0030] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.
[0031] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.
[0032] Unless otherwise specified, experimental methods in the following examples were performed under standard conditions, such as those described in Green and Sambrook et al., *Molecular Cloning: A Laboratory Manual* (2013), or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.
[0033] In some embodiments of the present invention, fatty acid synthases are disclosed. Application of the gene in constructing a spontaneous psoriasis mouse model, the fatty acid synthase The nucleotide sequence of the gene is shown in SEQ ID NO:1.
[0034] In other embodiments of the present invention, a method for constructing a spontaneous psoriasis mouse model is disclosed, comprising the following steps:
[0035] (1) Fatty acid synthase in mouse embryonic stem cells After inserting two loxP sites in the same orientation into the gene, chimeric mice were obtained by injecting correctly identified embryonic stem cell clones into blastocysts; these chimeric mice were then mated with wild-type mice to obtain... -flox heterozygous mice; the -flox heterozygous mice were self-crossed to obtain flox / flox Mice;
[0036] (2) Take the steps from (1) flox / flox Mice and tool mice + / - Pairing and grouping animals together to screen for genotypes that are suitable for breeding. + / - flox / + Mice;
[0037] (3) The results obtained in step (2) + / - flox / + The mice and the mice in step (1) flox / floxMice were paired and housed together to screen for genotypes. + / - flox / flox Mice;
[0038] (4) The genotype mentioned in step (3) is + / - flox / flox A spontaneous psoriasis mouse model can be obtained by inducing mice with tamoxifen for 5 to 8 consecutive days.
[0039] In one embodiment, the loxP sites described in step (1) are respectively inserted into The intron region between exon 3 and exon 4 (i.e., introns 3-4) and the intron region between exon 8 and exon 9 (i.e., introns 8-9) are between chr11:120,712,752 and chr11:120,712,751, respectively.
[0040] In one implementation, in step (2), the primer pair shown in SEQ ID NO:2 and SEQ ID NO:3 is used to screen for genotypes of... + / - flox / + Mice.
[0041] In one implementation, in step (3), one or more pairs of primer pairs shown in SEQ ID NO:4~SEQ ID NO:5, SEQ ID NO:6~SEQ ID NO:7 and SEQ ID NO:8~SEQ ID NO:9 are used to screen for genotypes of... + / - flox / flox Mice.
[0042] In one implementation, in step (4), the genotype is + / - flox / flox The mice were 8 to 10 weeks old.
[0043] In one implementation, in step (4), the induction period of tamoxifen is 5 to 7 days.
[0044] In one embodiment, in step (4), the induction dose of tamoxifen is 90 mg / kg body weight / day to 110 mg / kg body weight / day.
[0045] In other embodiments of the present invention, a spontaneous psoriasis mouse model constructed by the above-described construction method is disclosed.
[0046] In other embodiments of the present invention, the application of the above-described spontaneous psoriasis mouse model in the study of the pathological mechanism of psoriasis and / or in the screening of drugs for the treatment of psoriasis is disclosed.
[0047] In the following embodiments of the present invention, the nucleotide sequence of the fatty acid synthase (Fasn) gene involved is shown in SEQ ID NO:1.
[0048] SEQ ID NO:1
[0049]
[0050] In the following embodiments of the present invention, the tool mouse used is the commercially available Krt14-CreERT2 tool mouse ( + / - The strain of mouse, purchased from Cyagen (Suzhou) Biotechnology Co., Ltd., contains keratin 14 ( Driven by the promoter, it expresses Cre recombinase (CreERT2) fused with the human estrogen receptor ligand-binding domain. This enzyme can only enter the cell nucleus and exert its recombinant activity after administration of tamoxifen, thereby achieving time-specific gene manipulation.
[0051] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.
[0052] Example 1: Method for constructing a spontaneous psoriasis mouse model
[0053] This embodiment utilizes CRISPR-Cas9 gene editing technology and the Cre-loxP conditional knockout system to construct a tamoxifen-induced, spontaneous psoriasis mouse model. The specific steps include the following:
[0054] 1. Obtaining homozygous mice
[0055] (1) In C57BL / 6 mouse embryonic stem cells A first loxP site was inserted between chr11:120,712,752-chr11:120,712,751 (mouse reference genome version GRCm39) in the intron region between exon 3 and exon 4 (i.e., introns 3-4). A second loxP site was inserted between chr11:120,710,329-chr11:120,710,328 (GRCm39) in the intron region between exon 8 and exon 9 (i.e., introns 8-9).
[0056] (2) Chimeric mice were obtained by injecting ES cell clones that had passed positive and negative screening and Southern blot identification into blastocysts. These chimeric mice were then mated with wild-type mice to obtain germline-transferred Fasn-flox heterozygous mice. flox / + ). flox / + Mice obtained homozygotes through self-fertilization. flox / flox Mice.
[0057] 2. Epidermal-specific knockout homozygous mice + / - flox / flox The acquisition
[0058] (1) homozygous flox / flox Mice and tool mice + / - Pairing and housing the offspring mice. Genotyping of the offspring mice was used to screen for double-positive heterozygotes. + / - flox / + .
[0059] (2) The filtered results + / - flox / + mice and flox / flox Mice were paired and housed together to screen offspring with the following genotypes. + / - flox / flox Mice with epidermal-specific knockout Homozygous mice (experimental group mice). Genotypes of littermates are: flox / flox Mice were used as the control group.
[0060] In steps 1 and 2, the genotype identification process includes: taking tail tip or ear tissue from 3-4 week old mice and extracting genomic DNA using a commercial tissue DNA extraction kit. The PCR reaction system used was 2 × Phanta FlashMaster Mix (Dye Plus) (Nanjing Novizan), with a total reaction volume of 25 μL. The specific reaction system is shown in Table 1.
[0061] Table 1
[0062]
[0063] The PCR reaction program was as follows: pre-denaturation at 94°C for 3 minutes; followed by 35 cycles: denaturation at 94°C for 30 seconds, annealing at 62°C for 35 seconds, extension at 72°C for 35 seconds, and final extension at 72°C for 5 minutes.
[0064] The primers used to identify whether mice carry the Fasn-flox allele (wild type, flux heterozygote, and flux homozygote) are as follows, with expected amplification product sizes of 234 bp for the wild type and 388 bp for the flux allele. F (SEQ ID NO:2): ATCGAGACAACCACACATCCCC; R (SEQ ID NO:3): CCCTGTGGTAGATGTGCCGACT. The PCR products were separated by 2% agarose gel electrophoresis, and the band sizes were observed and recorded using a gel imaging system to determine the mouse genotype.
[0065] Primers used to identify the genotype of Krt14-CreERT2 transgenic mice included: primer pairs for transgene-specific amplification (Region 1) (SEQ ID NO:4~SEQ ID NO:5, expected amplification product 775 bp), primer pairs for amplification of the internal control positive control (Region 2) (SEQ ID NO:6~SEQ ID NO:7, expected amplification product 507 bp), and primer pairs for amplification of the ERT fragment (Region 3) (SEQ ID NO:8~SEQ ID NO:9, expected amplification product 441 bp). PCR products were separated by 2% agarose gel electrophoresis, and the band sizes were observed and recorded under a gel imaging system to determine the mouse genotype. Krt14-CreERT2 transgenic mice showed amplification bands in Regions 1, 2, and 3, while wild-type mice only showed the internal control band (Region 2).
[0066] F1 (SEQ ID NO:4): 5'-CCAATTTACCCGAGGATCTTGAGAA-3'
[0067] R1 (SEQ ID NO:5): 5'-GGTGTACGGTCAGTAAATTGGAC-3'
[0068] F2 (SEQ ID NO:6): 5'-CTATCAGGGATACTCCTCTTTGCC-3'
[0069] R2 (SEQ ID NO:7): 5'-GATACAGGAATGACAAGCTCATGGT-3'
[0070] F3 (SEQ ID NO:8): 5'-TGCCTTGTTGGATGCTGAACCG-3'
[0071] R3 (SEQ ID NO:9): 5'-CTGGACAGAAACGTGTACACT-3'
[0072] 3. Obtaining a spontaneous psoriasis mouse model
[0073] Select 8-10 week old, healthy experimental group mice ( + / - flox / flox The mouse model of spontaneous psoriasis was induced by intraperitoneal injection of tamoxifen solution at a dose of 100 mg / kg body weight / day. The injection was administered once daily at a fixed time for 7 consecutive days, thus obtaining the mouse model of spontaneous psoriasis.
[0074] Control group mice of the same littermate and sex with similar body weight to the experimental group mice were selected. flox / flox Perform the same treatment on the mice. During and after administration, closely monitor the mice's mental state, activity level, food and water intake, and weight changes.
[0075] The preparation method of tamoxifen solution is as follows: Accurately weigh 200 mg of tamoxifen powder and place it in a sterile glass or organic solvent-resistant centrifuge tube. Add 1 mL of anhydrous ethanol and sonicate in a 37°C water bath or constant temperature metal bath until the powder is completely dissolved and the solution is clear. Slowly add the above ethanol solution to 9 mL of autoclaved corn oil. Place the mixture on a 37°C constant temperature metal bath shaker and vortex at 1000-1200 rpm until a homogeneous and stable milky white suspension is formed. Filter the suspension using a disposable sterile 0.22 μm syringe filter for sterilization. Aliquot the filtered solution into sterile, light-protected microcentrifuge tubes. For long-term storage, the aliquoted solution should be stored at -80°C in the dark for no more than 6 months. For short-term use (within 1 week), it can be stored at 4°C in the dark. Before use, briefly warm to 37°C and vortex to mix.
[0076] Example 2: Validation of a spontaneous psoriasis mouse model
[0077] The mouse model obtained in Example 1 was validated as follows:
[0078] 1. Phenotypic Validation
[0079] experimental group mice + / - flox / flox and control mice flox / flox Appearance and appearance, such as As shown. From It can be seen that after tamoxifen induction, the experimental group mice... + / - flox / flox Ocular keratosis appeared on days 7-8, and perioral keratosis was observed on days 10-12. Around two weeks later, fine scales appeared on the auricle and back. Simultaneously, typical psoriatic lesions began to appear on the palms and soles, characterized by erythema, keratosis, scaling, and significant skin thickening and roughness. Keratosis appeared on the tail at week 3, and worsened further with swelling in week 4. Over time, the extent of lesions in each area gradually expanded. (Control group mice) flox / flox No observable phenotypic changes were observed throughout the entire course of treatment after the administration was completed.
[0080] 2. Verification of histopathological characteristics
[0081] For the experimental group mice + / - flox / flox and control mice flox / flox Hematoxylin-eosin staining was performed on skin tissues from various locations, and the histopathological characteristics were as follows: As shown. From It can be seen that: the experimental group mice + / - flox / flox The obtained model exhibits the core pathological changes of psoriasis: (1) Epidermal abnormalities: hyperkeratosis and parakeratosis coexist, the granular layer is significantly thinned or even disappears, and the acanthosis is significantly thickened; (2) Inflammatory cell aggregation: neutrophil infiltration and formation of Munro microabscesses are visible in the epidermis; (3) Dermal changes: vasodilation and congestion of the papillary dermis, with infiltration of a large number of inflammatory cells such as lymphocytes and neutrophils. In contrast, the control group mice flox / flox The overall skin tissue structure in all areas was intact and clearly layered: the epidermal thickness was within the physiological range, the stratum corneum was relatively regularly arranged, the granular layer was continuous and identifiable, and no significant thickening of the stratum spinosum was observed; no typical neutrophil aggregation or Munro microabscess formation was observed in the epidermis. The vascular morphology of the papillary dermis was basically normal, with no significant dilation and congestion observed; the inflammatory cell infiltration in the dermis was mainly scattered or mild, without the dense inflammatory infiltration seen in the experimental group mice.
[0082] 3. Verification of immune cell infiltration
[0083] Further immunofluorescence staining was used to detect the experimental group mice. + / - flox / flox and control mice flox / flox The macrophage marker F4 / 80 in the palms and soles showed the following results: As shown in the figure. The results showed that the experimental group mice + / - flox / flox Macrophages were found to accumulate in large numbers in the dermis of the affected skin at the site of the lesion. (Control group mice) flox / flox Only a few scattered macrophage signals were observed, without any lesion-like aggregation.
[0084] 4. Validation of inflammatory markers and molecular pathways
[0085] Reverse transcription-real-time quantitative PCR was used to analyze the experimental group mice. + / - flox / flox and control mice flox / flox Quantitative analysis of the expression of key genes in the lesioned skin was performed, and the results are as follows: As shown.
[0086] The results showed that the experimental group mice + / - flox / flox Epidermal differentiation and barrier-related transcription factors such as Compared with the control group mice flox / flox Downregulation of expression suggests impaired epidermal terminal differentiation, consistent with barrier dysfunction in psoriasis. ). Experimental group mice + / - flox / flox Chemokines that promote the recruitment of neutrophils and monocytes / macrophages Expression was higher than that of the control group mice flox / flox Synergistic upregulation explains the infiltration of a large number of inflammatory cells in the lesion. ). Experimental group mice + / - flox / flox of Il1b, Il6, Il12, Il17a, Il23a, Il36a, Tnf, Ifng The expression of pro-inflammatory factors was lower than that of the control group mice. Fasn flox / flox Significantly elevated levels, exhibiting typical Th1 / Th17 type inflammatory response characteristics. Experimental group mice Krt14-CreERT2 + / - ; Fasn flox / flox of Il4, Il13 Th2-related factor expression and control mice Fasn flox / floxNo significant difference was observed, and no significant upregulation was seen, consistent with the immunological characteristic of a relatively lack of Th2 response in psoriatic lesions. Figure 6 Therefore, the model mice exhibit a "psoriasis-like inflammatory molecular expression profile" centered on the activation of the TNF-α / IL-23 / IL-17 axis, IFN-γ-related pathways, and IL-36 inflammatory amplification pathway, accompanied by the inhibition of keratinization differentiation transcriptional programs.
[0087] Example 3: Knockout efficiency of a spontaneous psoriasis mouse model
[0088] The knockout efficiency of the mouse model constructed in Example 1 was tested.
[0089] 1. Genomic DNA level
[0090] Seven days after the induction was completed, mice in the experimental group were harvested. Krt14-CreERT2 + / - ; Fasn flox / flox and control mice Fasn flox / flox Genomic DNA was extracted from back skin tissue samples and used as a PCR template. PCR amplification was performed using recombinant identification primers (SEQ ID NO:10~SEQ ID NO:11) (the reaction system and procedure were the same as in Example 1), followed by electrophoretic analysis.
[0091] F (SEQ ID NO:10): 5'- CGGTCTGGAAAGCTGAAGGA-3'
[0092] R (SEQ ID NO:11): 5'-TGGGTCATCGAGACAACCAC-3'
[0093] Krt14-CreERT2 + / - ; Fasn flox / flox and Fasn flox / flox Electrophoretic patterns of mice as follows Figure 7 As shown, from Figure 7 It can be seen that, Krt14-CreERT2 + / - ; Fasn flox / flox A recombination band mediated by CreERT2 (approximately 500 bp) appeared, while Fasn flox / flox The band did not appear in the mice.
[0094] 2. mRNA level
[0095] RT-qPCR was used to detect the experimental group mice. Krt14-CreERT2 + / -; Fasn flox / flox and control mice Fasn flox / flox In skin tissue Fasn mRNA expression levels.
[0096] Krt14-CreERT2 + / - ; Fasn flox / flox and Fasn flox / flox mouse skin tissue Fasn Real-time quantitative PCR results of mRNA expression levels are as follows: Figure 8 As shown, from Figure 8 It can be seen that, with Fasn flox / flox Compared to mice, Krt14-CreERT2 + / - ; Fasn flox / flox mouse skin tissue Fasn mRNA was significantly downregulated.
[0097] 3. Protein level
[0098] Mice in the experimental group were detected by immunofluorescence (IF). Krt14-CreERT2 + / - ; Fasn flox / flox and control mice Fasn flox / flox Expression and localization of Fasn protein in skin tissue sections.
[0099] Krt14-CreERT2 + / - ; Fasn flox / flox and Fasn flox / flox The results of Fasn immunofluorescence staining of mouse dorsal skin tissue are as follows: Figure 9 As shown. From Figure 9 It can be seen that, Krt14-CreERT2 + / - ; Fasn flox / flox
[0100] Fasn protein is specifically lost in Krt14-positive cells such as mouse epidermal basal cells.
[0101] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0102] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A method for constructing a spontaneous psoriasis mouse model, characterized by, Includes the following steps: (1) Fatty acid synthase in mouse embryonic stem cells Fasn After inserting two loxP sites in the same orientation into the gene, chimeric mice were obtained by injecting correctly identified embryonic stem cell clones into blastocysts; these chimeric mice were then mated with wild-type mice to obtain... Fasn -flox heterozygous mice; the Fasn -flox heterozygous mice were self-crossed to obtain Fasn flox / flox Mouse; the loxP sites are respectively inserted into Fasn The fatty acid synthase is found between chr11:120,712,752 and chr11:120,712,751 in the intron region between exon 3 and exon 4, and between chr11:120,710,329 and chr11:120,710,328 in the intron region between exon 8 and exon 9. Fasn The nucleotide sequence of the gene is shown in SEQ ID NO:1; (2) Take the steps from (1) Fasn flox / flox Mice and tool mice Krt14-CreERT2 + / - Pairing and grouping animals together to screen for genotypes that are suitable for breeding. Krt14-CreERT2 + / - ;Fasn flox / + Mice; (3) The results obtained in step (2) Krt14-CreERT2 + / - ;Fasn flox / + The mice and the mice in step (1) Fasn flox / flox Mice were paired and housed together to screen for genotypes. Krt14-CreERT2 + / - ;Fasn flox / flox Mice; (4) The genotype mentioned in step (3) is Krt14-CreERT2 + / - ;Fasn flox / flox A spontaneous psoriasis mouse model can be obtained by inducing mice with tamoxifen for 5 to 8 consecutive days.
2. The method for constructing a spontaneous psoriasis mouse model according to claim 1, characterized in that, In step (2), the primer pairs shown in SEQ ID NO:2 and SEQ ID NO:3 are used to screen for genotypes that are... Krt14-CreERT2 + / - ;Fasn flox / + Mice.
3. The method for constructing a spontaneous psoriasis mouse model according to claim 1, characterized in that, In step (3), one or more of the primer pairs shown in SEQ ID NO:4~SEQ ID NO:5, SEQ ID NO:6~SEQ ID NO:7, and SEQ ID NO:8~SEQ ID NO:9 are used to screen for genotypes that are... Krt14-CreERT2 + / - ;Fasn flox / flox Mice.
4. The method for constructing a spontaneous psoriasis mouse model according to claim 1, characterized in that, In step (4), the genotype is Krt14-CreERT2 + / - ;Fasn flox / flox The mice were 8 to 10 weeks old.
5. The method for constructing a spontaneous psoriasis mouse model according to claim 1, characterized in that, In step (4), the induction period of tamoxifen is 5 to 7 days.
6. The method for constructing a spontaneous psoriasis mouse model according to claim 1, characterized in that, In step (4), the induction dose of tamoxifen is 90 mg / kg body weight / day to 110 mg / kg body weight / day.
7. The application of the spontaneous psoriasis mouse model constructed by the construction method according to any one of claims 1 to 6 in the study of the pathological mechanism of psoriasis and / or the screening of drugs for the treatment of psoriasis.
Citation Information
Patent Citations
Method for building human psoriasis mouse model and application of model
CN104335970A
Method for establishing chronic psoriasis inflammation animal model
CN114568386A