Molecular marker related to tail fat deposition in sheep, detection method and application thereof
By amplifying the sheep rBAT gene and detecting its polymorphic sites, especially the C/T mutation at position 689bp, KASP primer pairs were designed, and KASPar technology was used to screen for small-tailed sheep, solving the problem of fat deposition in sheep tails and achieving efficient and low-cost breeding improvement.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- LANZHOU UNIV
- Filing Date
- 2022-08-15
- Publication Date
- 2026-06-05
AI Technical Summary
In the prior art, the problem of fat deposition in sheep tails limits the commercial value of mutton and breeding progress, and high-fat diets lead to increased health risks. There is a lack of effective molecular markers to control fat deposition in tails.
By amplifying the sheep rBAT gene and detecting its polymorphic sites, especially the C/T mutation at position 689 bp, competitive allele-specific PCR (KASP) primer pairs were designed. High-throughput detection was performed using KASPar technology, and a molecular marker detection method was established to screen for small-tailed sheep.
It provides a simple, accurate, and low-cost molecular marker detection method that can effectively identify low-fat sheep, improve breeding efficiency, reduce feeding costs, and enhance mutton quality and economic benefits.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the technical field of molecular markers, specifically relating to the rBAT gene fragment as a molecular marker affecting fat deposition in sheep tails, its detection methods, and applications. Background Technology
[0002] rBAT (associated with the b0,+ amino acid transporter) (SLC3A1) belongs to solute transporter family 3 and has been identified (Fotiadis, Kanai, & Palacín, 2013). The rBAT gene encodes a type II membrane glycoprotein, a component of renal amino acid transporters, which transport neutral and basic amino acids in the renal tubules and intestines. rBAT protein is highly expressed in the apical membrane of renal and small intestinal epithelial cells (Furriols et al., 1993; Pickel et al., 1993), and forms heterodimers with b0,+AT (SLC7A9) and AGT1 (SLC7A13) (Feliubadaló et al., 1999; Nagamori, Wiriyasermkul, Guarch, Okuyama, & Kanai, 2016), but whether the rBAT gene is related to sheep tail fat deposition remains unclear.
[0003] Sheep, as a common domestic animal, are an important means of production and livelihood in agricultural areas. Their meat and wool products play a crucial role in improving local production and daily life. Historically, the wild ancestor of sheep was the fine-tailed sheep. Later, through artificial selection, fat-tailed or fat-rumped sheep were bred. Sheep can be divided into five types based on tail size: short-tailed sheep, long-tailed sheep, short-fat-tailed sheep, long-fat-tailed sheep, and fat-rumped sheep. The fat in a sheep's tail provides sufficient energy to sustain normal needs during winter when forage is scarce. However, people choose to buy low-fat mutton products for a healthier diet, as high-fat diets increase the incidence of cardiovascular disease, diabetes, and colon cancer. With the commercialization of sheep farming, excessive tail fat deposition limits the commercial value of mutton. It also reduces feed conversion ratio and increases feeding costs. In actual production, it has been found that fat-tailed sheep have a lower conception rate than small-tailed sheep because the large tail hinders natural mating. Therefore, studying the molecular regulatory mechanisms of fat deposition in sheep tails and searching for molecular markers related to tail fat deposition to reduce excess tail fat deposition is of great theoretical and practical significance and provides a basis for breeding low-fat meat sheep. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides a molecular marker associated with sheep tail fat deposition and its application. The molecular marker of this invention is amplified from the sheep rBAT gene, and its specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying and sequencing the DNA sequence of the sheep rBAT gene, polymorphic sites in the rBAT gene are identified, the correlation between different genotypes and sheep tail fat deposition is analyzed, and a detection method for the molecular marker containing polymorphic sites is established. This molecular marker can be applied to the breeding of new fast-growing, small-tailed, high-quality meat sheep breeds.
[0005] To achieve the above objectives, the present invention adopts the following technical solution:
[0006] In one aspect, the present invention provides a molecular marker associated with fat deposition in sheep tails. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where the Y at position 689 bp represents C or T. Since there is a C / T mutation at position 689 of the above sequence, it leads to the C / T polymorphism of the sheep rBAT gene at this site.
[0007] A second aspect of the present invention provides a primer pair for detecting the above-mentioned molecular marker. Any primer that can specifically amplify the above-mentioned molecular marker of the present invention or a fragment containing the above-mentioned polymorphic site is suitable for detecting the molecular marker. Preferably, the primer pair for detecting the above-mentioned molecular marker includes an upstream primer rF and a downstream primer rR. The nucleotide sequence of the upstream primer rF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer rR is shown in SEQ ID NO.3.
[0008] A third aspect of the present invention provides a KASPar primer pair for detecting the above-mentioned molecular marker, comprising primer A1, primer A2 and primer C, wherein the nucleotide sequence of primer A1 is shown in SEQ ID NO.4, the nucleotide sequence of primer A2 is shown in SEQ ID NO.5, and the nucleotide sequence of primer C is shown in SEQ ID NO.6.
[0009] A fourth aspect of the present invention provides a kit for detecting the above-mentioned molecular markers, the kit comprising PCR primer pairs or KASPar primer pairs for detecting the above-mentioned molecular markers.
[0010] A fifth aspect of the present invention provides a method for detecting molecular markers associated with tail fat deposition in sheep, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the Y at position 689 bp represents C or T. The method includes detecting sheep genomic DNA using the primer pairs or kit described above, and the specific detection method includes the following steps:
[0011] a) Amplify sheep genomic DNA using the primer pairs described above, KASPar primer pairs, or kits containing the primer pairs described above;
[0012] b) Identify the polymorphic sites in the amplification products obtained in step a).
[0013] In step b), the above-mentioned typing identification methods include, but are not limited to, direct sequencing, probe method, gene chip method, and high-resolution melting curve method.
[0014] The method for detecting molecular markers related to sheep tail fat using the above primer pairs includes the following steps:
[0015] a) Genomic DNA was extracted from sheep blood samples and amplified by high-throughput water bath PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;
[0016] b) After amplification, fluorescence signals were detected and genotyping results were viewed using a BMG PHERAstar instrument.
[0017] The sixth aspect of the present invention provides the application of the detection method of the molecular markers and their polymorphic sites, primer pairs or kits as described above in the detection of tail fat traits in sheep. By detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the type of polymorphic sites, the level of tail fat in sheep can be determined, thereby screening out sheep with small tails.
[0018] The application of molecular markers and their polymorphic sites, primer pairs, or kits described above in sheep breeding involves amplifying and detecting the genomic DNA of sheep using these primer pairs or kits to determine the genotype of the rBAT gene in the sample. This allows for the selection of small-tailed sheep breeds. Identifying gene variation sites and analyzing their association with traits is a crucial method for studying gene function and forms the basis for marker-assisted selection.
[0019] This invention, through PCR amplification and sequencing of the rBAT gene in the representative sheep breed, Hu sheep, revealed a C / T polymorphic site at position 689 of the amplified fragment. By detecting polymorphisms in 1286 Hu sheep and establishing a least-squares model, a molecular marker associated with sheep tail fat was identified. This molecular marker can be used for the breeding of small-tailed sheep, providing an effective genetic engineering method for the genetic improvement of sheep tail fat deposition, and has significant practical application value.
[0020] This invention detects the aforementioned molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not require the synthesis of specific fluorescent probes for each SNP site. Instead, it is based on its unique ARM PCR principle, allowing all site detections to ultimately use universal fluorescent primers for amplification. This significantly reduces reagent costs and provides high accuracy, offering a simple, accurate, and low-cost method for detecting the molecular markers of this invention.
[0021] The beneficial effects of this invention are as follows:
[0022] This invention provides molecular markers related to sheep tail fat and their C / T polymorphic sites. By determining the genotype of this polymorphism, sheep with low tail fat can be effectively identified, providing an effective detection method for the breeding of small-tailed sheep. Through the detection of molecular markers and polymorphic sites, this invention can be used to select sheep with homozygous TT genes for breeding, thereby improving sheep quality and contributing to increased economic benefits in sheep farming. Attached Figure Description
[0023] Figure 1 This is a gel electrophoresis image of the sheep rBAT gene fragment used as a molecular marker in this invention.
[0024] Figure 2 This is the sequencing result of the C / T mutation site in the sheep rBAT gene in this invention.
[0025] Figure 3 The results of KASPar SNP typing of the C / T mutation site in the sheep rBAT gene in this invention are shown; where the red dot near the left represents the TT genotype, the green dot near the middle represents the TC genotype, and the blue dot near the right represents the CC genotype. Detailed Implementation
[0026] This invention analyzed the relationship between single nucleotide polymorphisms (SNPs) of the rBAT gene in Hu sheep and tail fat deposition traits using PCR amplification, Sanger sequencing, and KASPar genotyping techniques. This invention can provide valuable molecular markers for Hu sheep breeding.
[0027] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.
[0028] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in this method are of analytical grade or higher.
[0029] Example 1: Amplification of the rBAT gene
[0030] Using sheep rBAT gene DNA (GenBank accession number: NC_040254.1) as a template, a pair of primers was designed using Oligo 7.0 software: upstream primer rF and downstream primer rR. The primer sequences are as follows:
[0031] Upstream primer rF (SEQ ID NO.2): 5'-AATGTGTCCTTCTTCTGTGC-3'
[0032] Downstream primer rR (SEQ ID NO.3): 5'-GCCACCTTTTAGAATGCTGGA-3'
[0033] (2) Amplification and sequencing of the rBAT gene
[0034] Genomic DNA extracted from sheep blood was used as a DNA template for PCR amplification. The total reaction volume was 35 μL, including 17.5 μL of 2×PCR Master Mix, 1 μL of upstream primer rF (10 μmol / L), 1 μL of downstream primer r-R (10 μmol / L), 14 μL of ddH2O, and 1.5 μL of DNA template. PCR amplification conditions were: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 55.5℃ annealing for 30 s, 72℃ extension for 30 s, for 35 cycles, followed by a final extension at 72℃ for 10 min.
[0035] The PCR amplification products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents the DL2000 Marker, and lanes 1-10 represent the rBAT gene amplification results. The amplified PCR fragment was sequenced, revealing a specific amplified fragment at 853 bp. The specific nucleotide sequence of this fragment is shown in SEQ ID NO.1. This fragment contains a polymorphic site, specifically at position 689 bp where R is either C or T. That is, the amplified rBAT gene fragment (SEQ ID NO.1) exhibits C / T polymorphism at position 689 bp (see [link to SEQ ID NO.1]). Figure 2 ).
[0036] Among them, SEQ ID NO.1:
[0037] AATGTGTCCTTCTTCTGTGCACTTTAGAGTTTGTCATCTCGGAATGACTGTTTAGAATCTTTAGAATCCCTTTTCCAGGGTGCACAGTGGCTAGTTTGATAATCTGGCAGAGAGATTCTGATTAACGAGCAAAGCATAATTCATTATTTTAGAAGAAGATTAAGTGATATCTTTGAAATGTATAGACTGAGTCTTTAAAGCTTAAATCTTGAGAAATGAAGAAAAGGTATAGTGTGGGTTGGTCGTTAGTTGAATTAAGGGTTACTTAAGAAATATCCATCTTAATAAAGAAAGTAAAAAATATTTTTAAAGTTATGCTAATAATTTCCTAGTGTGTTATGTGTGGGATGTCCTTATTATTTATTGCTCAAATGAGGACACAAACCAATCGCTGGAAAGTGTCCCAGGCAAATTGGTTGATATGGTTACCCAGTTAAGGGAAGCAATAAGGAACAAATAAACTAATAAGATAATTTTCGATAATGCTATTTGGCTTGAAGAAGACAAAATAATGATTTAAGAGTATGGGATAGAGAAGGGAATGACAACCCACTCCAGTGTTCTTGTCTGGAAAATTCCACGGGCAGAGGAGCCTGATAGGCTACAGTCTGGGGGGTCTCAAAGAGTTGGACACAACTGAGCAACTGAGCACACATGACTGCATTTGGTATAGCTCTAGACGCGGATAYGTAATAGCTTGCTGAATTGTTTGGTTTTGGCTAGTTGCTTGGCTCCCTTCCTGGTGCTTAGTATTCCTCTTTTCATTGCTGTAGAGTCTGTAAAGGCCTCCATTCTGCAGCCCCTTCTTCTGGCTTACCGGAGAAGGCCCCAGTCCAGCATTCTAAAAGGTGGC。
[0038] DNA sequence homology search and identification:
[0039] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 99% homology with a partial sequence of sheep rBAT gene DNA (GenBank accession number: NC_040254.1).
[0040] Example 2: Establishment of a genotyping detection method
[0041] (1) Primer sequence design
[0042] KASPar primer pairs were designed targeting the C / T polymorphism site of the amplified fragment in Example 1 for the specific detection of this polymorphism site. The nucleotide sequence of the designed KASPar primer pairs is as follows:
[0043] Forward primer A1 (SEQ ID NO.4) used to detect AlleleC:
[0044] GAAGGTGACCAAGTTCATGCTGTATAGCTCTAGACGCGGATAC;
[0045] Forward primer A2 (SEQ ID NO.5) used for detecting AlleleT:
[0046] GAAGGTCGGAGTCAACGGATTGGTATAGCTCTAGACGCGGATAT;
[0047] Universal reverse primer C (SEQ ID NO.6): ACTAGCCAAAACCAAACAATTCAGCAAG.
[0048] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the KASPar primer pair was diluted to 10 μmol / L and mixed thoroughly at a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C.
[0049] (2) DNA quality control
[0050] Genomic DNA can be extracted from sheep blood using a DNA extraction kit.
[0051] The extracted genome
[0052] DNA quality was tested using 1% agarose gel electrophoresis and Nanodrop 2100. The acceptable DNA requirements were: (1) Agarose gel electrophoresis showed a single DNA band without significant diffusion; (2) Nanodrop 2100 showed A260 / 280 between 1.8 and 2.0; A260 / 230 between 1.8 and 2.0; and no significant light absorption at 270 nm. Based on the KASPar detection technology from LGC (UK) and the conversion of genome size, the required DNA dosage was calculated to be 10–20 ng / sample. The extracted genomic DNA was diluted to a concentration of 10–20 ng / μL as a DNA template.
[0053] (3) Genotyping
[0054] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10–20 ng / μL) and a blank control (No template control, NTC, using sterile water) were added to 384-well reaction plates, respectively. The plates were then dried at 60°C for 30 min (drying oven, LGC Corporation) until the DNA became a dry powder for later use.
[0055] Each primer in the above KASPar primer pair was diluted to 10 μmol / L and mixed with primer A1:A2:C in a volume ratio of 12:12:30 to prepare a primer mixture for later use.
[0056] Then, using a Meridian loading station under the Kraken operating system, 1×Master mix (1536 microplate, catalog number: Part No. KBS-1016-011) and primer mixture were added to each reaction well. Immediately after mixing, the microplates were sealed sequentially using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler high-throughput water bath system. The specific procedure was as follows:
[0057] Pre-denaturation at 94℃ for 15 minutes;
[0058] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplified in touch-down sequence for 10 cycles, decreasing the temperature by 0.6℃ per cycle;
[0059] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.
[0060] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3 As shown in the figure. Each dot represents a sample to be tested. The red dot near the left indicates that the locus is homozygous for the genotype "TT"; the blue dot near the right indicates that the locus is homozygous for the genotype "CC"; the green dot near the center indicates that the locus is heterozygous for the genotype "TC" or "CT"; and the black dot represents NTC (…). Figure 3 (If it cannot be displayed in the text), that is, a blank control.
[0061] (4) Application of the molecular markers of the present invention in association analysis of sheep growth traits
[0062] The experiment examined the polymorphism of 1286 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and growth traits.
[0063] Y ijk =μ+Genotype i +P j +S k +ε ijk
[0064] Among them, Y ijk The observed values for tail fat deposition traits are given, where μ is the population mean and Genotype. i For genotype effect, P j Due to the batch effect, S k Due to seasonal effects, ε ijk Assuming random error, let ε ijk They are independent of each other and follow an N(0, σ2) distribution.
[0065] Genotyping results showed that among 1286 individuals, 401 had the CC genotype, 643 had the CT genotype, and 242 had the TT genotype. The results of the genotype-trait association analysis are shown in Table 1.
[0066] Table 1. Association analysis between rBAT gene polymorphism and tail fat deposition trait in sheep.
[0067]
[0068]
[0069] Note: Different superscript letters between data in the same column indicate significant differences (P<0.05), while the same superscript letter indicates no significant differences (P>0.05).
[0070] The results showed that the C>T mutation site in SEQ ID NO.1 was significantly associated with tail fat deposition in sheep. Sheep carrying the TT genotype had lower tail fat deposition than sheep carrying the CC genotype (P<0.05). This indicates that the T allele is the dominant allele. This suggests that the C>T mutation site in SEQ ID NO.1 can serve as a potential molecular marker affecting tail fat deposition in sheep (P<0.05). Selecting the TT genotype for breeding can reduce fat deposition in sheep tails, resulting in a superior flock with lower tail fat deposition.
Claims
1. The application of a molecular marker associated with sheep growth traits in the detection of tail fat traits in Hu sheep or in Hu sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 689bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the TT genotype have a smaller tail fat trait than sheep carrying the CC and CT genotypes. The purpose of the breeding is to select small-tailed Hu sheep.
2. The application of PCR primer pairs for detecting molecular markers associated with sheep growth traits in the detection of tail fat traits in Hu sheep or in Hu sheep breeding, characterized in that, It includes an upstream primer rF and a downstream primer rR. The nucleotide sequence of the upstream primer rF is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer rR is shown in SEQ ID NO.
3. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 689bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the TT genotype have a smaller tail fat trait than sheep carrying the CC and CT genotypes. The purpose of the breeding is to select small-tailed Hu sheep.
3. The application of KASPar primer pairs for detecting molecular markers related to sheep growth traits in the detection of tail fat traits in Hu sheep or in Hu sheep breeding, characterized in that, It includes primers A1, A2, and C. The nucleotide sequence of primer A1 is shown in SEQ ID NO.4, the nucleotide sequence of primer A2 is shown in SEQ ID NO.5, and the nucleotide sequence of primer C is shown in SEQ ID NO.
6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 689 bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the TT genotype have a smaller tail fat trait than sheep carrying the CC and CT genotypes. The purpose of the breeding is to select small-tailed Hu sheep.
4. A kit for detecting molecular markers associated with sheep growth traits, used in the detection of tail fat traits in Hu sheep or in Hu sheep breeding, characterized in that... It contains PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6; the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 689bp represents C or T, and this mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the TT genotype have a smaller tail fat trait than sheep carrying the CC and CT genotypes; the purpose of the breeding is to select small-tailed Hu sheep.
5. A method for detecting molecular markers associated with sheep growth traits, applied to the detection of tail fat traits in Hu sheep or in Hu sheep breeding, comprising the following steps: a) Amplify sheep genomic DNA using PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2-3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4-6, or using a kit containing the aforementioned PCR primer pairs or KASPar primer pairs; b) Genotyping and identification of polymorphic sites in the amplification products obtained in step a); in, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 689bp represents C or T. This mutation leads to C / T polymorphism of the molecular marker. Sheep carrying the TT genotype have a smaller tail fat trait than sheep carrying the CC and CT genotypes. The purpose of the breeding is to select small-tailed Hu sheep.
6. The application according to claim 5, characterized in that, The typing identification method in step b) is sequencing, fluorescent probe, gene chip or high-resolution melting curve.
7. The application according to claim 5, characterized in that, PCR amplification was performed using the KASPar primer pair described in claim 3. After amplification, the genotyping result was determined by detecting the fluorescence signal.