Use of a norepinephrine inhibitor in the manufacture of a medicament for treating or alleviating a deficiency of corneal limbal stem cells
By using norepinephrine inhibitors, including 6-hydroxydopamine hydrochloride and tyrosine hydroxylase inhibitors, the release and synthesis of norepinephrine are inhibited, the limbal microenvironment is improved, the treatment challenges of LSCD are solved, and corneal transparency is enhanced and the condition is alleviated.
Patent Information
- Application Number
- CN202610262594.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-05
- Publication Date
- 2026-06-05
AI Technical Summary
Current technology lacks effective drug treatments to alleviate limbal stem cell deficiency (LSCD), a major cause of corneal blindness, and transplanted limbal stem cells are unlikely to survive in the unhealthy microenvironment of the affected eye.
Norepinephrine inhibitors, including 6-hydroxydopamine hydrochloride and tyrosine hydroxylase inhibitors, are used to improve the limbal microenvironment, reduce neovascularization and corneal epithelial conjunctivalization, and enhance corneal transparency by inhibiting the release and synthesis of norepinephrine.
It effectively inhibits the release and synthesis of norepinephrine, improves the limbal microenvironment, reduces corneal neovascularization, decreases corneal epithelial conjunctivalization, enhances corneal transparency, and relieves corneal edema, providing a new pathogenic mechanism and intervention target for the treatment of LSCD.
Smart Images

Figure CN122140676A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to the application of a norepinephrine inhibitor in the preparation of drugs for treating or alleviating limbal stem cell deficiency. Background Technology
[0002] Limbal stem cell deficiency (LSCD) is a major cause of corneal blindness. LSCD is a disease caused by dysfunction or lack of limbal stem cells (LSCs), mainly manifested as corneal epithelial conjunctival hyperplasia, neovascularization, and corneal opacity, leading to decreased vision or even blindness. LSC transplantation is an effective treatment for LSCD, but the affected eye lacks a healthy limbal microenvironment, making LSC survival difficult and resulting in poor treatment outcomes.
[0003] Norepinephrine (NE), as the main neurotransmitter released after sympathetic nerve activation, can not only constrict blood vessels and raise blood pressure, but also inhibit epithelial damage repair in the cornea. However, its level and role in LSCD are still unclear.
[0004] Therefore, studying the pathogenesis and intervention targets of LSCD is crucial for its prevention and treatment. Currently, there are no effective drug treatments for LSCD. Summary of the Invention
[0005] Based on the above needs, the purpose of this invention is to provide an application of norepinephrine inhibitors in the preparation of drugs for treating or alleviating limbal stem cell deficiency. This invention demonstrates through experiments that the degree of sympathetic nerve invasion of the cornea and the increase of norepinephrine (NE) are positively correlated with limbal stem cell deficiency, and verifies that 6-hydroxydopamine hydrochloride and tyrosine hydroxylase inhibitors can inhibit NE levels, providing a new direction for the pathogenesis and intervention targets of limbal stem cell deficiency, with broad application prospects.
[0006] To achieve the above objectives, the present invention is implemented through the following solution:
[0007] This invention provides the use of a norepinephrine inhibitor in the preparation of a medicament for treating or alleviating limbal stem cell deficiency.
[0008] Furthermore, the norepinephrine inhibitor comprises 6-hydroxydopamine hydrochloride and / or a tyrosine hydroxylase inhibitor.
[0009] Furthermore, the dosage of the 6-hydroxydopamine hydrochloride is 50 mg / kg to 100 mg / kg; the dosage of the tyrosine hydroxylase inhibitor is 15 mg / kg to 40 mg / kg.
[0010] Furthermore, the 6-hydroxydopamine hydrochloride can disrupt the sympathetic nervous system and inhibit the release of norepinephrine.
[0011] Furthermore, the tyrosine hydroxylase inhibitor can inhibit norepinephrine synthesis.
[0012] Furthermore, the norepinephrine inhibitor can reverse conjunctival epithelium into corneal epithelium.
[0013] Furthermore, the norepinephrine inhibitor can improve the limbal microenvironment and reduce corneal neovascularization.
[0014] Furthermore, the norepinephrine inhibitor can reduce corneal epithelial conjunctivalization to enhance corneal transparency and relieve corneal edema.
[0015] Furthermore, the drug can be administered orally and / or by injection.
[0016] Compared with existing technologies, the effects and advantages of this invention are:
[0017] This invention experimentally demonstrates that the sympathetic nervous system is overactivated in a LSCD mouse model, increasing the release of norepinephrine (NE). It also demonstrates that 6-hydroxydopamine hydrochloride can disrupt the sympathetic nervous system and inhibit norepinephrine release, and that tyrosine hydroxylase inhibitors can inhibit norepinephrine synthesis. Both of these methods can improve the limbal microenvironment, reduce corneal neovascularization, and decrease corneal epithelial conjunctivalization, thereby enhancing corneal transparency and alleviating corneal edema. This provides a new approach to understanding the pathogenesis and intervention targets of limbal stem cell deficiency and has broad market value. Attached Figure Description
[0018] Figure 1 The LSCD model was successfully constructed, where A represents mouse genotype identification; B represents staining evidence of Pax6. + / - The mice were used as a model of LSCD.
[0019] Figure 2 Revealing Pax6 from the corneal transcriptome + / - The sympathetic nerve signals in mice were activated, with A representing the strongest KEGG enrichment of the adrenergic signaling pathway in the corneal transcriptome; B representing the ranking index and enrichment score of the adrenergic signaling pathway; and C representing the expression of related genes in the adrenergic signaling pathway.
[0020] Figure 3Pax6 + / - Excessive activation of the corneal sympathetic nervous system and increased norepinephrine (NE) in mice, where A represents Pax6. + / - Increased sympathetic nerve activity in both the limbus and central cornea of mice; B shows TH protein level detection; C shows limbal NE staining; D shows corneal NE ELISA detection.
[0021] Figure 4 The extent of sympathetic nerve invasion of the cornea and its impact on LSC function loss are shown in Figure A, where A represents the distribution of limbal sympathetic nerves at different time points and B represents the expression of limbal stem cell markers at different time points.
[0022] Figure 5 To inhibit the effect of NE on LSCD, where A is 6-OHDA or α-MLT treatment for Pax6 + / - Effects of mouse corneal phenotype, B is for quantitative assessment of corneal phenotype, and C is for limbal NE staining.
[0023] Figure 6 The effects of 6-OHDA and α-MLT treatment on the limbal microenvironment. Detailed Implementation
[0024] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. However, the scope of protection of the present invention is not limited to the scope of the examples described. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased.
[0025] The tyrosine hydroxylase inhibitor and 6-hydroxydopamine hydrochloride described in this invention are obtained through commercial channels.
[0026] Example 1
[0027] Tyrosine hydroxylase inhibitor (α-MLT) was purchased from MedChemExpress, catalog number: HY-W013407; 6-hydroxydopamine hydrochloride (6-OHDA) was purchased from Sigm-Aldrich, catalog number H4381.
[0028] This embodiment provides the impact of the extent of sympathetic nerve invasion of the cornea on the progression of LSCD and LSC function.
[0029] 1. LSCD Model Construction
[0030] Pax6 heterozygous mutant (Pax6) was constructed using CRISPR / Cas9 editing. + / -Mice (Jicui Yaokang, Strain Number: T011445, https: / / en.gempharmatech.com / product / details100035_3694293.html), male Pax6 + / - With female wild-type mouse Pax6 + / + After being put into cages, the offspring mice were separated from their parents at 3 weeks of age and then marked and numbered.
[0031] Genomic DNA was extracted from offspring mice by tail clipping. PCR was performed using the identified DNA, and genotype was determined based on the size of the amplified fragments. The mutant mouse fragment was 231 bp, and the wild-type fragment was 306 bp. Mice possessing both 231 bp and 306 bp amplified fragments were designated Pax6. + / - mice ( Figure 1 As shown in Figure A), further immunofluorescence staining of corneal sections indicated that Pax6 + / - The conjunctival-specific marker K19 appeared at the limbus of the mouse cornea, while the LSC marker ΔNp63 disappeared, and the corneal differentiation marker K12 was also lost. Figure 1 (As shown in B); normal corneal epithelium has 5-6 layers, while Pax6... + / - The mice showed reduced epithelial thickness, with only 2-3 layers, demonstrating the successful construction of the LSCD model, which showed a lack of LSCs and corneal conjunctivalization.
[0032] The mouse genotype identification information is shown below:
[0033] Primer pair 1: T011445-F1: TGTAGGCTTTGTGCCGCTGGTT (SEQ ID NO.1);
[0034] T011445-R1 ATCTGTGCTTCTTCGCAAATGACAAC (SEQ ID NO.2);
[0035] Primer pair 2: T011445-F2 CTGTCCAATTCCCTAATGCAGGTA (SEQ ID NO.3);
[0036] T011445-R2 AGGAGATAAAGACGCGCCAGAGAT (SEQ ID NO.4);
[0037] The mutant amplified fragment is 231 bp, and the wild-type amplified fragment is 306 bp.
[0038] 2. The impact of the degree of sympathetic nerve invasion of the cornea on the association between LSC function loss and LSCCD disease.
[0039] Source Pax6 + / - Transcriptome sequencing of mouse corneas revealed that the KEGG (Kyoto Encyclopedia of Genes and Genomes) dataset showed the strongest enrichment of the adrenergic signaling pathway in cardiomyocytes. Figure 2 (A) Gene set enrichment analysis shows sympathetic nerve signals in Pax6 + / - Significantly upregulated in mice ( Figure 2 (B) The heatmap shows Pax6 + / - The expression of genes related to sympathetic nerve signaling in mice was upregulated (Figure 2, C). These results indicate that sympathetic nerves play a crucial role in Pax6. + / - It is activated in the mouse cornea.
[0040] Corneal patch staining revealed sympathetic nerve activity in wild-type mice, specifically Pax6. + / + The limbus has fewer sympathetic nerves, while the central cornea lacks sympathetic nerves, whereas Pax6... + / - The limbal sympathetic nerves in mice are increased and invade the cornea, with a dense distribution of sympathetic nerves in the central cornea. Figure 3 (As shown in A).
[0041] Western blot results showed that Pax6 + / - The protein level of TH (tyrosine hydroxylase, the synthase of NE) in the mouse cornea was also significantly increased. Figure 3 As shown in Figure B, β-ACTIN is the internal reference protein. Staining revealed that NE specifically localized at the limbus of wild-type mice, exhibiting a punctate distribution along the cell boundary, and was present in Pax6. + / - In mice, NE signaling is significantly enhanced at the limbus ( Figure 3 (As shown in C). Meanwhile, ELISA results showed that, compared to wild-type mice, NE showed higher levels in Pax6. + / - Significantly elevated in mouse cornea ( Figure 3 (As shown in D). The above results indicate that Pax6 + / - The sympathetic nerves in the mouse cornea were overactivated, releasing large amounts of norepinephrine (NE).
[0042] For Pax6 + / - By tracking sympathetic nerve staining at different time points in mice, Pax6 was obtained. + / -Like wild-type mice, newborn mice have only a small number of sympathetic nerves at the limbus. By 3 weeks of age, the density of sympathetic nerves at the limbus increases and they begin to grow into the cornea, but the signal is weak. By 2 months of age, the sympathetic nerve fibers at the limbus become thicker and the signal is enhanced, while they invade the cornea in large numbers. In contrast, wild-type mice only have a small number of sympathetic nerves at the limbus. Figure 4 (A). Pax6 was obtained by staining ΔNp63 sections. + / - LSC markers are normally expressed in newborn mice, partially expressed at 3 weeks of age, and completely absent by 2 months of age. Figure 4 (B)
[0043] The experimental results of this embodiment demonstrate that, in Pax6 + / - In mice, the extent of sympathetic nerve invasion of the cornea and the release of norepinephrine (NE) were positively correlated with LSC function loss and LSC disease progression.
[0044] Example 2
[0045] This embodiment investigates the effects of norepinephrine inhibitors (NE inhibitors) on sympathetic nerve inhibition or NE synthesis in the progression of LSCD, specifically including the following:
[0046] Through Pax6 + / - Intervention of sympathetic nerves or NE synthesis in mice before the onset of disease, and the reduction of Pax6 + / - Mice were intraperitoneally injected with 6-hydroxydopamine hydrochloride (6-OHDA) at 2 weeks of age, once every 3 days during the treatment period, at a treatment dose of 80 mg / kg (prepared with physiological saline, dissolved and injected immediately, 100 μL per mouse), as experimental group 1; in addition, Pax6 was administered... + / - Mice were orally administered a tyrosine hydroxylase inhibitor (α-MLT, which inhibits NE synthesis) on day 5 after birth, once daily (10 mg / ml saline solution, sonicated, 10 μL per mouse). Starting at 2 weeks of age, α-MLT was intraperitoneally injected (3 mg / ml saline solution, sonicated, 100 μL per mouse), once every 2 days during the treatment period. This was the second experimental group. The control group (Vehicle) received Pax6. + / - Mice were given an oral dose of 10 μL of saline solution on day 5 after birth, and then an intraperitoneal injection of 100 μL of saline solution was given starting at 2 weeks of age.
[0047] The above three groups of mice were continuously treated until Pax6. + / - The mice reached 2 months of age.
[0048] Slit-lamp imaging and analysis showed that both 6-OHDA and α-MLT treatments significantly reduced corneal opacity; combined with optical coherence tomography (AS-OCT) imaging and analysis, both 6-OHDA and α-MLT treatments significantly reduced central corneal thickness, alleviated corneal edema, and significantly improved anterior chamber angle opening, relieving iris-corneal adhesions. Figure 5 As shown in Figures A and B). NE is a neurotransmitter released by the sympathetic nervous system. Immunofluorescence staining demonstrated that 6-hydroxydopamine hydrochloride and α-MLT effectively inhibited NE levels (…). Figure 5 (As shown in C); This embodiment further verifies that inhibiting NE can effectively suppress LSCD progression.
[0049] After sampling, corneal smear staining verified that 6-OHDA and α-MLT treatment could enhance LSC differentiation marker K12 (manufacturer Proteintech, catalog number 24789-1-AP), reduce conjunctivalization marker K19 (manufacturer Santa Cruz, catalog number sc-376126), and neovascularization marker CD31 (manufacturer Biolegend, catalog number 102416). Figure 6 This demonstrates that conjunctival epithelium was reversed to corneal epithelium, indicating that 6-OHDA and α-MLT treatments prevent LSCD progression by improving the limbal microenvironment.
[0050] In summary, this invention demonstrates through experimental data that the sympathetic nervous system is overactivated in the LSCD mouse model, increasing norepinephrine release. This invention also provides 6-hydroxydopamine hydrochloride and a tyrosine hydroxylase inhibitor as norepinephrine inhibitors. The 6-hydroxydopamine hydrochloride can disrupt the sympathetic nervous system and inhibit norepinephrine release, while the tyrosine hydroxylase inhibitor can inhibit norepinephrine synthesis. The norepinephrine inhibitors provided by this invention can improve the limbal microenvironment, reduce corneal neovascularization, and decrease corneal epithelial conjunctivalization to enhance corneal transparency and alleviate corneal edema, providing a new approach to the pathogenesis and intervention targets of limbal stem cell deficiency.
[0051] The above examples only represent the technical solutions of this invention and are not intended to limit the experiments. Although we have improved the experimental scheme, researchers in the same field can still further improve the experimental scheme described above or make scientifically equivalent substitutions for the experimental steps. These changes do not cause the substance of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed in this invention.
Claims
1. The use of a norepinephrine inhibitor in the preparation of a drug for treating or alleviating limbal stem cell deficiency.
2. The application according to claim 1, characterized in that, The norepinephrine inhibitors comprise 6-hydroxydopamine hydrochloride and / or tyrosine hydroxylase inhibitors.
3. The application according to claim 2, characterized in that, The dosage of the 6-hydroxydopamine hydrochloride is 50 mg / kg to 100 mg / kg; the dosage of the tyrosine hydroxylase inhibitor is 15 mg / kg to 40 mg / kg.
4. The application according to claim 2, characterized in that, The 6-hydroxydopamine hydrochloride can disrupt the sympathetic nervous system and inhibit the release of norepinephrine.
5. The application according to claim 2, characterized in that, The tyrosine hydroxylase inhibitor can inhibit norepinephrine synthesis.
6. The application according to claim 1, characterized in that, The norepinephrine inhibitor can reverse conjunctival epithelium into corneal epithelium.
7. The application according to claim 1, characterized in that, The norepinephrine inhibitor can improve the limbal microenvironment and reduce corneal neovascularization.
8. The application according to claim 1, characterized in that, The norepinephrine inhibitor can reduce corneal epithelial conjunctivalization to enhance corneal transparency and relieve corneal edema.
9. The application according to claim 1, characterized in that, The drug can be administered orally and / or by injection.