Synthesis of a key gene for xanthosternaline and its encoding protein and application
By introducing a key gene for cartanben synthesis into Huangliang wood through genetic engineering, the problem of insufficient cartanben content in existing technologies has been solved, resulting in a significant increase in cartanben content and promoting the medicinal and timber application value of Huangliang wood.
Patent Information
- Application Number
- CN202610277196.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-09
- Publication Date
- 2026-06-05
Smart Images

Figure CN122145599A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of a key gene for the synthesis of cardanine compound from *Symplocos edulis* and its encoded protein. Background Technology
[0002] Yellow beam wood ( Neolamarckia cadamba *Pterocarya stenoptera*, a perennial evergreen broad-leaved tree belonging to the Rubiaceae family, is a multifunctional tree species with significant economic value. It grows rapidly, reaching maturity in about ten years. The tree is tall, and its timber is of excellent quality and has a wide range of uses, including furniture making, interior decoration materials, plywood, packing boards, and pulp. Furthermore, its beautiful shape, lush foliage, and large, glossy leaves make it a popular choice for street trees or landscape shade trees in urban gardens. *Pterocarya stenoptera* has a long history of use in traditional medicine; its bark and leaves are used medicinally for their heat-clearing and detoxifying effects, and are commonly used in folk medicine to treat high fever, headaches, insomnia, and certain skin diseases. Modern research has isolated various active secondary metabolites from *Pterocarya stenoptera*. These compounds possess broad pharmacological activities, including antimalarial, antitumor, antioxidant, and anti-inflammatory properties, demonstrating the potential for development in the pharmaceutical field. Currently, its extracts are used in the development of herbal formulas and pharmaceutical preparations (Huang Gaofeng et al., 2021).
[0003] Cardanine is a relatively abundant monoterpenoid indole alkaloid found in Pandanus tectorius (Zhong Jiyu et al., 1985). Studies have found that cardanine has anti-inflammatory, anticancer, and antimalarial activities (Pandey). et al. , 2016; Jin et al. (2022). Cardanidine and 3α-dihydrocardanidine accumulate in large quantities in the bark and leaves of the *Symplocos edulis* tree (Xu Xiaoyu et al., 2011; Takayama). et al. The content in the bark and roots reached 300 μg / g (FW) in 2003. Since the molecular structure of catanben in *Symplocos edulis* was first determined in 1983, the biosynthetic pathway of catanben has not been fully elucidated (Zhao et al., 2003). et al. (2022). With the development of molecular biology techniques and gene editing tools, researchers have been able to elucidate to some extent the regulatory mechanisms of the synthesis of certain plant monoterpenoid indole alkaloids, such as those in periwinkle (Tatsis). et al Vincrine and Rauvolfia (Dang) (2017) et alThe synthetic pathways of alkaloids such as amaryl in *Cartaninium bracteatum* (2018) have been studied. However, due to the significant differences in the genetic backgrounds of different plants, current research on *Cartaninium bracteatum* still lacks novel genes that can be utilized to regulate the synthesis of monoterpenoid indole alkaloids, and effective methods to improve the synthesis of indole alkaloids by regulating the expression of key genes have not yet been developed. Therefore, discovering new regulatory genes for the synthesis of monoterpenoid indole alkaloids in *Cartaninium bracteatum*, especially cartanin, and proposing corresponding new synthetic regulation methods, has important application value for promoting the germplasm improvement, variety optimization, and industrialization of *Cartaninium bracteatum*. Summary of the Invention
[0004] The first object of the present invention is to provide a protein that can be used to regulate the synthesis of cardanben compounds in plants, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.2.
[0005] A second object of the present invention is to provide a gene encoding the above-mentioned protein, preferably, the base sequence of the gene is shown in SEQ ID NO.1.
[0006] A third objective of this invention is to provide a recombinant plant expression vector for expressing the protein as described in claim 1.
[0007] The expression vector can be any binary vector that can be used for Agrobacterium-mediated transformation of plants or a vector that can be used for plant micro-projectile attack, such as the pCAMBIA series vectors, pBI series vectors, pBin series vectors, or Gateway™ series vectors.
[0008] The fourth objective of this invention is to provide a method for increasing the content of cartanbin in plants, characterized in that a gene encoding the aforementioned protein is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are then cultivated into plants, thereby overexpressing the gene in the plants.
[0009] Preferably, the gene is introduced into plant cells, tissues, or organs via a plant expression vector, and the plant is *Symplocos edulis*.
[0010] A fifth objective of this invention is to provide the application of the aforementioned protein, its encoding gene, and recombinant plant expression vector in promoting cardanben synthesis.
[0011] The regulation of cartanbin synthesis in plants is achieved by increasing the expression of key genes involved in cartanbin synthesis in *Symplocos edulis*, thereby promoting an increase in cartanbin content.
[0012] The fifth objective of this invention is to provide a method for promoting cartanbin synthesis in plants, characterized in that a key gene for cartanbin synthesis from *Symplocos henryi* is introduced into plant cells, tissues, or organs, and the transformed plant cells, tissues, or organs are then cultivated into plants, thereby overexpressing the gene in the plants.
[0013] Preferably, the gene is introduced into plant cells, tissues, or organs via a plant expression vector, and the plant is *Symplocos edulis*.
[0014] The sixth objective of this invention is to provide the application of the aforementioned proteins, genes, or recombinant plant expression vectors in regulating the synthesis of cartanbin in plants.
[0015] Preferably, the regulation of cartanbin synthesis in plants is achieved by increasing the expression of key genes involved in cartanbin synthesis in *Symplocos edulis*, thereby increasing the cartanbin content.
[0016] A seventh objective of this invention is to provide the application of the aforementioned proteins, genes, or recombinant plant expression vectors in the breeding of high-carb d'ambin plant varieties.
[0017] Preferably, the cultivation of plant varieties with high cartanbin content is achieved by increasing the expression of key genes for cartanbin synthesis in *Symplocos henryi*.
[0018] Preferably, the aforementioned plant is *Symplocos edulis*.
[0019] Compared with the prior art, the present invention has the following advantages:
[0020] 1) This invention provides a novel protein that regulates the content of cardanidine in plants and its encoding gene.
[0021] 2) This invention provides a new protein and its encoding gene, which has the function of regulating the content of cardanine in plants with different genetic backgrounds.
[0022] 3) This invention provides a novel method for increasing the content of cartanbin in plants, namely, increasing the expression of the aforementioned gene or its encoded protein to increase the content of cartanbin in plants.
[0023] 4) This invention provides a method for cultivating plant varieties with high cartanbin content, namely, by increasing the expression of the aforementioned genes, plant varieties with high cartanbin content are cultivated. Attached Figure Description
[0024] Figure 1 The expression levels of the gene described in this invention in different organs at different developmental stages of *Pterocarya stenoptera* were detected by Real-time PCR. The vertical axis represents the relative expression levels.
[0025] Figure 2 This is a fluorescence detection of the transgenic hairy roots. (a) Bright: Bright field, overexpressing hairy roots in suspension culture under normal light; (b) GFP: Overexpressing hairy roots observed under 488nm excitation light; (c) Merge: Fusion status of bright field and GFP.
[0026] Figure 3This is a PCR identification diagram of transgenic Huangliangmu hairy roots, where M is Marker 2000, 1 is Huangliangmu hairy root transgenic with empty vector, and 2-4 are transgenic Huangliangmu hairy root lines.
[0027] Figure 4 The expression levels of the target gene in empty vector-transformed and transgenic *Pterocarya stenoptera* were detected by real-time PCR. The vertical axis represents the relative expression levels. Empty Vector represents the control *Pterocarya stenoptera* with empty vector, and OE-1, OE-2, and OE-3 represent three lines of transgenic *Pterocarya stenoptera* with the target gene.
[0028] Figure 5 This is a comparison chart of cartanbin content in transgenic Huangliangmu, where Empty Vector represents Huangliangmu with an empty vector, and OE-1, OE-2, and OE-3 represent three lines of transgenic Huangliangmu with the target gene. Detailed Implementation
[0029] The present invention is further illustrated below with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the following examples, all experimental methods can be performed according to conventional methods, such as those described in J. Sambrook et al.'s *Molecular Cloning: A Laboratory Manual*, F. Osber et al.'s *A Concise Laboratory Manual of Molecular Biology*, or according to the manufacturer's instructions for use of the product.
[0030] Example 1: Cloning of the Yellow Beam Tree Gene
[0031] Using yellow sapwood as the experimental material, the plant material grew normally under natural conditions.
[0032] RNA extraction: Total RNA was extracted from the leaf organs of *Gnaphalium affine* using a plant RNA rapid extraction kit (Huayueyang, Beijing, China). For specific steps of RNA extraction, please refer to the relevant instruction manual.
[0033] Reverse transcription: mRNA was reverse transcribed into cDNA first strand using the Novizan reverse transcription kit, following the instructions in the kit's manual.
[0034] Gene cloning: Using the first strand of reverse-transcribed okra leaf cDNA as a template, and F1: ATGGATGAGCTAATAGTTTCAAGATCTTC and R1: CTAGACATGATGATCAAATGGTAATAATCTTCT as primers, conventional PCR amplification was performed. The full-length target gene was cloned according to the instructions for Phanta Max DNA Polymerase from Novizan. The sample loading system followed the enzyme's instructions, and the PCR reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 80 s, for a total of 34 cycles, followed by a final extension at 72℃ for 5 min. The PCR products were detected by 1.5% agarose gel electrophoresis, and the target band was recovered using the OMEGA gel recovery kit according to the product recovery instructions. The recovered target fragment was ligated into a T-vector using the pClone 007 Blunt Simple Vector Kit, following the instructions of the product. A ligation product containing the target fragment was constructed. 5 μl of the ligation product was transferred to *E. coli* DH5α competent cells (Weidi Biotechnology), and 700 μl of LB broth was added. After 1 h of recovery, the cells were plated on LB agar plates containing 50 mg / L ampicillin (Amp) and incubated overnight at 37°C. White clones were picked and amplified in LB+Amp (50 mg / L) liquid medium, and then sent for sequencing. The nucleotide sequence is shown in SEQ ID NO. 1, with an open reading frame from position 1 to 1578, 1578 bp in length, encoding 526 amino acids. The amino acid sequence is shown in SEQ ID NO. 2, and the gene is named the *Calvatia spp.* kadanobin synthesis gene.
[0035] Example 2: Analysis of gene expression patterns in *Symplocos edulis*
[0036] Roots, stems, and leaves of *Pterocarya stenoptera* trees grown for one month, three months, six months, nine months, and one year were collected to detect the expression levels of the cardanin synthesis gene described in this invention in different organs at five physiological ages of *Pterocarya stenoptera*. Total RNA was extracted using a plant RNA rapid extraction kit (Huayueyang, Beijing, China), and genomic DNA was removed by treatment with DNase I (Takara). After measuring OD260, 2 μg of RNA was quantitatively extracted and then reverse transcribed using a Novizan reverse transcription kit (method as per the manufacturer's instructions). The cDNA was diluted 5-fold and transcribed using a Novizan quantitative qPCR kit (ChamQ). TMAccording to the UniversalSYBR qPCR Mix product manual, qPCR detection was performed using a real-time quantitative PCR instrument (LightCycler 480 II, Roche). The primer sequences were F2: CAGACACAGTGCTGGGCTTA and R2: AATACCCATCTCCCCAGCCT. The internal control primers were NcUPL-F: GGTTGGTGGTAGAGTTGTGACTC and NcUPL-R: CGAGCACTACCACGACACG. The expression levels of the gene described in this invention in different tissues and organs of *Pterocarya stenoptera* at different physiological ages were detected by real-time quantitative PCR.
[0037] The qPCR reaction mixture (20 μl) is as follows:
[0038] The reaction procedure is as follows: ① Pre-denaturation at 95℃ for 30 seconds; ② PCR reaction for 40 cycles: 95℃ for 5 seconds, 60℃ for 10 seconds. 95℃ for 15 seconds.
[0039] The obtained data were processed and analyzed using ABI 7500 Real-time PCR system software. The results showed ( Figure 1 In *Pterocarya stenoptera* at different physiological ages, the cadanin synthesis gene was highly expressed in leaves, with the weakest expression in roots. In six-month-old seedlings and pre-seedling stages, the expression level of the target gene in leaves was significantly higher than that in roots and stems. With increasing seedling age, the expression level of the target gene in stems increased compared to roots. In nine-month-old and one-year-old *Pterocarya stenoptera*, there was no significant difference in the expression level of the target gene between stems and leaves, indicating that in the early stages of *Pterocarya stenoptera*, the target gene is mainly expressed in stems and leaves.
[0040] Example 3: Overexpression of the cadanbin synthesis gene in hairy roots of *Symplocos henryi* and functional identification of transgenic hairy roots
[0041] (1) Construction of the target gene-cadanbin synthesis gene overexpression vector
[0042] The Gateway method was used to construct the overexpression vector. Using the cDNA obtained from reverse transcription as a template, amplification was performed using Phanta Max DNA Polymerase, a high-fidelity DNA polymerase reagent from Novizan. The reaction system followed the product instructions, and the amplification primers were: F3: GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGATGAGCTAATAGTTTCAAGATCTTC;
[0043] R3: GGGGACCACTTTGTACAAGAAAGCTGGGTCTAGACATGATGATCAAATGGTAATAATCTTCT.
[0044] The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 80 s, for a total of 34 cycles, followed by a 72℃ extension for 5 min. The amplified products were subjected to agarose gel electrophoresis, gel recovery, and sequencing to confirm the gene described in this invention. The recovered PCR product of the target fragment was placed on ice and ligated to the donor vector pDONR221 using Gateway BP cloning technology. The ligation reaction system is as follows:
[0045] After mixing, briefly centrifuge and incubate at 25°C for 1 h. Then add 1 μL of proteinase K and mix well, incubating at 37°C for 10 min to terminate the reaction. Transform the ligation product into competent E. coli DH5α cells and incubate at LB + 50 mg / L Kansin. + Screening cultures were conducted on the culture medium, and single colonies were selected for suspension culture. Colony PCR was performed, and colonies with correctly amplified bands were sent to Qingke Company for sequencing. After propagation culture of the correctly sequenced colonies, plasmids were extracted; these plasmids were designated as primary vectors carrying the target gene. The plasmids were ligated to the terminal vector pk7WG2D via a Gateway LR reaction. The ligation reaction system is as follows:
[0046] After mixing, centrifuge and incubate at 25°C for 1 h. Then add 1 μL of proteinase K and incubate at 37°C for 10 min to terminate the reaction. Transform the ligation product into E. coli competent cells DH5α, screen and identify positive single clones on LB + 50 mg / L Spec medium, thus successfully constructing the overexpression vector carrying the target gene.
[0047] (2) Transform the recombinant plasmid expression vector into Agrobacterium competent cells Ar.Qual
[0048] Mix 5 μl of the recombinant overexpression vector carrying the target gene with Agrobacterium tumefaciens Ar.Qual competent cells and incubate on ice for 30 min. Then, flash freeze in liquid nitrogen for 1 min and immediately transfer to 37°C for 5 min. Add 700 μl of antibiotic-free LB medium and incubate at 28°C and 180 rpm for 2 h. Centrifuge at 6000 rpm for 1 min at room temperature, remove excess supernatant, and resuspend 100 μl of supernatant. Spread evenly on LB agar plates containing Kan (50 mg / L) using a spreader. Invert the plates and incubate at 28°C until colonies appear (approximately 2 days). Select single colonies for colony PCR identification. The PCR primers used for colony identification were F1 and R1, and the total amplified length was 1578 bp, confirming that the overexpression vector had been transferred into Agrobacterium tumefaciens Ar.Qual. Select positive clones for subsequent hairy root infection experiments.
[0049] (3) Induction and identification of transgenic hairy roots
[0050] 1. Select one positive clone and inoculate it into LB + Kan (kanamycin) 50 mg / L liquid medium. Incubate at 28℃ with shaking at 220 rpm for 24-36 h to allow OD to develop. 600 =Approximately 0.8. Centrifuge at 5000 rpm for 10 min to collect bacterial cells, suspend the bacterial cells in MS liquid medium + 100 mM AS, adjust the OD value to approximately 0.8, and prepare the infection solution for later use.
[0051] 2. The selected material was three-month-old clonal tissue culture seedlings of *Pterocarya stenoptera*. The infection solution was injected into the stem segment or petiole of the seedling using a 1 mL sterile syringe, and the seedlings were cultured in the dark for 2 days, followed by cultivation under normal light conditions for approximately 20 days.
[0052] 3. Cut stem segments with hairy roots and inoculate them sequentially into 1 / 2 MS plates containing 400 mg / L, 200 mg / L, and 100 mg / L cephalosporins, reducing the antibiotic resistance every week. After the antibiotic resistance reduction treatment, place the hairy roots of *Pterocarya stenoptera* in 1 / 2 MS liquid medium for suspension culture. After 15 days, take a portion of the hairy roots, grind them, and extract DNA for transgenic identification.
[0053] 4. Detection of GFP fluorescence in transgenic hairy roots: The overexpression vector used in the transgene carries a green fluorescent protein (GFP) tag. Fluorescence can be observed visually in the hairy roots by emitting excitation light of the corresponding wavelength using a LUYOR-3415RG dual-fluorescent protein observation lamp. When the excitation light source emits green fluorescence, the overexpressing hairy roots containing GFP can be detected by observing through a yellow filter. Figure 2 )
[0054] 5. PCR identification of transgenic hairy roots: Hairy root lines that fluoresce normally under fluorescence irradiation were selected, and genomic DNA was extracted from a portion of the roots through grinding for PCR identification. Figure 3 Hairy roots transformed with the empty expression vector amplified a specific fragment of the green fluorescent protein (GFP) tag, which was the same size as the GFP sequence carried by the vector; hairy roots with the target gene overexpression vector amplified a specific fragment of the same size as the corresponding gene and with a single band. These results indicate that hairy roots overexpressing the target gene have been successfully obtained.
[0055] (4) Functional analysis of transgenic hairy roots
[0056] 1. Detection of target gene expression level in overexpressing hairy roots: Transgenic hairy roots cultured in suspension for 45 days were flash-frozen in liquid nitrogen and then ground to extract RNA. The extracted RNA was of good quality and did not degrade, and was immediately reverse transcribed into cDNA for subsequent analysis of transgenic hairy root gene expression levels. The three lines of transgenic hairy roots overexpressing the target gene showed significant differences compared to the empty vector control. The expression levels of the target gene—the *Cartaninia serratifolia* kadanobin synthesis gene—were significantly upregulated by 16-fold, 20-fold, and 19-fold, respectively, in the three overexpressing lines. Figure 4 ).
[0057] 2. Determination of Cartanbin Content in Hairy Roots. The method for determining cartanbin content is as follows: A mortar was pre-cooled with liquid nitrogen, and hairy roots were added and ground into a fine powder. 0.1 g of each fresh sample was weighed, dissolved in 1 mL of 70% ethanol, and resuspended and mixed thoroughly. After ultrasonic disruption for 30 min, the mixture was centrifuged at 12700 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and stored at -20℃ for later use. The samples were analyzed using ultra-high performance liquid chromatography-mass spectrometry (LC-QQQ-MS) (Agilent). The mobile phase consisted of 0.2% formic acid aqueous solution (A) and methanol (B). The chromatographic gradient was 3 min, 60% methanol; 5 min, 90% methanol; 6 min, 90% methanol; 6.5 min, 10% methanol; 10 min, 10% methanol. The flow rate was 0.3 mL / min, the column oven temperature was 40°C, the sample pan temperature was 4°C, and the injection volume was 2 μL.
[0058] To verify whether overexpression of the target gene—the cartanbin synthesis gene from *Gynostemma pentaphyllum*—affects cartanbin content, the cartanbin content in fresh samples of overexpressed hairy roots was measured. The results are as follows: Figure 5 The results showed that in the three hairy root lines overexpressing the target gene, the content of cartanbin was significantly increased by nearly 10 times compared with the control, indicating that overexpression of the target gene can promote cartanbin synthesis in *Symplocos edulis*.
[0059] The above results indicate that the gene of this invention is a key gene for cartanbin synthesis. Overexpression of this gene in the hairy roots of *Symplocos henryi* can promote cartanbin synthesis, increase cartanbin content, and thus improve the medicinal value of the plant.
[0060] SEQ ID NO.1 (nucleotide sequence of the target gene) TTCAGAAGGAGCAGCAGCAGCCCAACAACAACAATAGTGTTAATCATAATAAGAAAGTGAAGATGGAATTGGCTGCCGCCGATAGTACGATGGATAACCAAAGCACCACCACTACTTCTGTCGATCAAATAATTAAGTCGTCGTCGTCGTCTAATAATAATAATAGTAATTTACTAGTCATGTCATCTTTTTCATCGGTTGAAGTTGAAGTTAAGTTGGTGGGCCCAGAATCAGACGCCATGATCAGGGTTCAATCTGACAGCAGCAATTATCCAGCAGCCAGGTTAATGGATGCCCTAAGGGATCTGGAGCTGCAAGTCCACCATGCCAGCATGTCCAACGTCTCAGATCTCATGCTTCAAGATCATGTTATCAAGGTTCCAAATGGGATGAGAAGTGAGCTGGGACTAAAGGCAGCTCAGCTTAGAAGATTATTACCATTTGATCATCATGTCTAG
[0061] SEQ ID NO.2 (Amino acid sequence encoded by the target gene) MDELIVSRSSSPSIMSLRQESPTTSLQLNLQYILQSQTQCWAYAIIWQTSDDDNGRVVLGWGDGYFQPTKDAAVAGNKSNITTTGSQSERKKVMKGIQALIGENPENDGPVDCDVTDAEWFYVMSLAQSFSMGEGVLGKAFGSGSLIWLTGGQQLGFYNCDRAKEAQIHGIQTLVCIPTPGGVLELGSNELIKENWSLVQQAKSLFGSDADVRRGLNLVVTGQADEDDPAAGGINLEGAISFPDFGLVMGGLQEEEDAKGEKKKGDSIHGRKGTVVQMNPSCYLDSEHSDSDCVLVVETVERKAGKKRGRKGRETPLNHVEAERQRREKLNHRFYALRSVVPNVSRMDKASLLSDAVSYINELKSKVEELESQLQKEQQQPNNNNSVNHNKKVKMELAAADSTMDNQSTTTTSVDQIIKSSSSSNNNNSNLLVMSSFSSVEVEVKLVGPESDAMIRVQSDSSNYPAARLMDALRDLELQVHHASMSNVSDLMLQDHVIKVPNGMRSELGLKAAQLRRLLPFDHHV。
Claims
1. A key protein for the synthesis of cardanidine in *Symplocos edulis*, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.
2.
2. A key gene for the synthesis of kadaminozin in *Symplocos edulis*, characterized in that, The gene encodes the amino acid sequence shown in SEQ ID NO.2, preferably, the nucleotide sequence of the gene is shown in SEQ ID NO.
1.
3. A recombinant plant expression vector for expressing the protein as described in claim 1.
4. The recombinant plant expression vector according to claim 3, characterized in that, The plant expression vectors mentioned are pBI series vectors, pBin series vectors, and Gateway vectors. TW Series vectors or pCAMBIA series vectors.
5. A method for increasing the content of cartanbin compounds in plants, characterized in that, The gene encoding the protein of claim 1 is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are then cultured into plants, so that the gene is overexpressed in the plants.
6. The method according to claim 5, characterized in that, The gene is introduced into plant cells, tissues, or organs via a plant expression vector, and the plant in question is *Gnaphalium affine*.
7. The use of the protein of claim 1, the gene of claim 2, or the recombinant plant expression vector of any one of claims 3-4 in regulating the synthesis of cartanabine in plants.
8. The application according to claim 7, characterized in that, The regulation of cartanben synthesis in plants is achieved by increasing the expression of key genes involved in cartanben synthesis in *Symplocos macrantha*, thereby increasing the content of cartanben compounds.
9. The application of the protein of claim 1, the gene of claim 2, or the recombinant plant expression vector of any one of claims 3-4 in the cultivation of plant varieties with high cartanbin content.
10. The application according to claim 9, characterized in that, The cultivation of plant varieties with high cartanbin content is achieved by increasing the expression of key genes involved in cartanbin synthesis in *Symplocos edulis*.