A method of facilitating transport to increase retinyl synthesis
By expressing the ABC transporter Pdr5 and β-carotene-15,15'-monooxygenase BLH in recombinant Pichia pastoris strain and combining them with the surfactant Tween-80, the problems of intracellular accumulation toxicity and limited yield of retinaldehyde were solved, and efficient production and extraction of retinaldehyde were achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NANJING TECH UNIV
- Filing Date
- 2026-01-15
- Publication Date
- 2026-06-05
AI Technical Summary
Existing biosynthetic methods yield limited retinaldehyde, intracellular accumulation leads to toxicity, and the lack of an efficient efflux mechanism affects bacterial growth and metabolism. Furthermore, chemical synthesis methods present environmental pollution and product purity issues.
In recombinant Pichia pastoris strain, ABC transporter Pdr5 and β-carotene-15,15'-monooxygenase BLH were expressed, and the retinaldehyde efflux capacity was enhanced by combining with the surfactant Tween-80. The culture conditions were optimized by fed-batch fermentation.
It significantly increased the extracellular yield of retinaldehyde, reduced cytotoxicity, and achieved the co-production of carotene and retinaldehyde, with yields reaching 317.75 mg/L and 1390 mg/L, respectively. Separation and extraction were also made more convenient, laying the foundation for industrial production.
Smart Images

Figure CN122146486A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of bio-fermentation technology and genetic engineering technology, specifically to a method for high-density biosynthesis of retinaldehyde using surfactants and the synthetic strain thereof. Background Technology
[0002] Vitamin A compounds include retinaldehyde, retinol, retinoic acid, and retinyl esters. Retinaldehyde, as an active form of vitamin A, plays an important role in physiological processes such as visual transmission, cell differentiation, and immune regulation.
[0003] Retinal, an active form of vitamin A, plays a crucial role in physiological processes such as visual transmission, cell differentiation, and immune regulation. Currently, the main methods for synthesizing retinal include chemical synthesis and biosynthesis. Chemical synthesis typically relies on complex organic reaction steps, resulting in harsh reaction conditions, numerous byproducts, severe environmental pollution, and unsatisfactory product purity, limiting its application in food, pharmaceutical, and other fields. In contrast, biosynthesis uses microorganisms as hosts and utilizes renewable carbon sources for fermentation production, offering advantages such as mild reaction conditions, environmental friendliness, and high product specificity, and is gradually becoming a research hotspot. Current research has attempted to construct retinal synthesis pathways in hosts such as *Saccharomyces cerevisiae* or *Yarrowia lipolytica*.
[0004] However, existing biosynthetic systems still suffer from problems such as insufficient activity of key enzymes, imbalanced metabolic flux, and toxicity caused by intracellular product accumulation, limiting further increases in retinaldehyde production. The lack of an efficient product efflux mechanism also leads to intracellular product accumulation, inhibiting cell growth and metabolism. Therefore, it is necessary to construct efficient and stable cellular factories for retinaldehyde synthesis through synergistic optimization of genetic engineering and fermentation processes to promote its industrial production. Summary of the Invention
[0005] This invention provides a method for the biosynthesis of retinal. The method increases the efflux capacity of retinal by adding an ABC transporter to the synthetic strain, increasing the copy number of β-carotene-15,15'-monooxygenase (BLH), or further enhancing retinal yield by adding a surfactant during fermentation. Simultaneously, all retinal is extracted extracellularly, while all carotene remains intracellular, achieving co-production of carotene and retinal.
[0006] A retinaldehyde-producing retinaldehyde-producing recombinant Pichia pastoris strain was obtained by expressing one of the ABC transporters Yor1, Snq2, Pdr5, Pdr10, Pdr12, and Pdr15 from Saccharomyces cerevisiae and β-carotene-15,15'-monooxygenase BLH from Marine bacterium 66A03 in a host bacterium.
[0007] Preferably, the ABC transporter protein is Pdr5.
[0008] The host bacteria are retinaldehyde-producing recombinant bacteria, such as recombinant bacteria PP-B obtained by introducing geranylgeranyl diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR and β-carotene-15,15'-monooxygenase BLH expression cassettes into Pichia pastoris GS115 strain; the strain and its specific construction method have been disclosed in CN 118240674 A.
[0009] Alternatively, it can be obtained by expressing the dehydrogenase Zwf1, phosphate dehydrogenase Gnd2, NADH kinase Pos5 genes, and β-carotene-15,15'-monooxygenase genes derived from Saccharomyces cerevisiae in the recombinant strain PP-B. Using BB3-Z4-intE12 as the vector plasmid, a recombinant plasmid containing the Gnd2, Pos5, and Zwf1 genes was constructed and integrated into the intE12 site of the host strain PP-B genome to obtain the recombinant strain PP-BC; the strain and its specific construction method have been disclosed in CN 120399915 A.
[0010] Alternatively, the recombinant strain PP-BCCIV can be obtained by introducing ATP citrate lyase ACL, acetyl-CoA synthase ACS, choline kinase CK, inositol polyphosphokinase IPK, and the expression cassette of Vibrio hygroscopic hemoglobin VHb into the recombinant strain PP-BC. Using BB3rN-AF as the vector plasmid, a co-expression recombinant plasmid of ACL, ACS, IPK, CK, and VHb is constructed. The recombinant plasmid is then integrated into the RGI2 site of the PP-BC genome to obtain the recombinant Pichia pastoris strain PP-BCCIV with the isopentenol utilization pathway. For the strain and its specific construction method, please refer to CN121006286A.
[0011] In a preferred embodiment, the nucleotide sequences of the ABC transport proteins Yor1, Snq2, Pdr5, Pdr10, Pdr12, and Pdr15 derived from Saccharomyces cerevisiae and the β-carotene-15,15'-monooxygenase BLH derived from Marine bacterium 66A03 are shown in SEQ ID NO: 1-7, respectively.
[0012] The method for constructing the above-mentioned recombinant Pichia pastoris strain includes:
[0013] Using BB3rN-AF as a vector plasmid, a co-expression recombinant plasmid of ACL, ACS, IPK, CK, and VHb was constructed. The recombinant plasmid was integrated into the RGI2 site of the PP-BC genome to obtain the recombinant Pichia pastoris strain PP-BCCIV with the isopentenol utilization pathway.
[0014] Using BB3eH-AC as the vector plasmid, a recombinant plasmid co-expressing ABC transporter Pdr5 and BLH was constructed. The recombinant plasmid was integrated into the ENO site of the PP-BCCIV genome to obtain the recombinant Pichia pastoris strain PP-B2CCIV5 that enhances retinaldehyde efflux.
[0015] A method for synthesizing retinaldehyde using surfactants involves adding surfactants to a fermentation medium in a certain amount, using retinaldehyde-producing recombinant bacteria as the fermentation strain, and fermenting to produce retinaldehyde.
[0016] A method for high-density biological synthesis of retinaldehyde, comprising the following steps, involves culturing the aforementioned recombinant Pichia pastoris and adding a surfactant to synthesize retinaldehyde:
[0017] Take the strain from the preservation tube and inoculate it into a YPD test tube at an inoculum of 1-5% and culture it at 28-32℃ for 24 hours to obtain the seed liquid;
[0018] Inoculate the seed culture into the fermentation medium at an inoculation rate of 1-10%, and culture at 25℃ and 220 rpm for 5 days with shaking.
[0019] The fermentation medium consisted of 40 g / L carbon source, 10 g / L yeast extract, and 20 g / L tryptone.
[0020] In a preferred embodiment, the fermentation culture uses glucose or methanol as a carbon source.
[0021] More preferably, a batch feeding fermentation is adopted, with an initial carbon source concentration of 40 g / L in the fermenter. When the carbon source is about to be exhausted, feed is added to maintain the carbon source concentration in the fermenter between 0 g / L and 10 g / L.
[0022] During the fed-batch fermentation, the fermentation temperature was 25℃, the rotation speed was 500 rpm, and the dissolved oxygen was maintained at 40%.
[0023] The surfactant was added to the fermentation medium at 24 hours of fermentation;
[0024] The surfactant is one of Tween-80, Triton, rhamnose ester, and dodecane; preferably Tween-80.
[0025] The amount of surfactant added is 10%.
[0026] Furthermore, after centrifugation of the fermentation broth, β-carotene-containing bacterial cells and retinaldehyde-containing supernatant were obtained, and then retinaldehyde and β-carotene products were obtained through separation and extraction.
[0027] A method for co-producing retinaldehyde and β-carotene involves fermenting recombinant Pichia pastoris. At the 24th hour of fermentation, 10% Tween-80 is added. The recombinant Pichia pastoris strain is obtained by expressing the ABC transporter Pdr5 from Saccharomyces cerevisiae and the β-carotene-15,15'-monooxygenase BLH from Marine bacterium 66A03 in the recombinant strain PP-BCCIV. After fermentation, the fermentation broth is centrifuged to obtain cells containing β-carotene and a supernatant containing retinaldehyde. Retinaldehyde is extracellular, and β-carotene is intracellular. The retinaldehyde and β-carotene products are obtained through separation and extraction.
[0028] The fermentation temperature was 25℃, the rotation speed was 500 rpm, and the dissolved oxygen was maintained at 40%.
[0029] In this invention, the expression of the ABC transporter protein Pdr5 has a synergistic effect with the surfactant Tween-80. In recombinant bacteria expressing Pdr5, the extracellular retinaldehyde production far exceeds that of other transporters, with almost all of it being extracellular retinaldehyde. At the same time, β-carotene remains entirely intracellular, further relieving product inhibition and increasing retinaldehyde production. This achieves the co-production of carotene and retinaldehyde, and precise separation, making product separation and extraction more convenient.
[0030] Beneficial effects:
[0031] The recombinant Pichia pastoris of this invention enhances the conversion of β-carotene to retinaldehyde by increasing the copy number of β-carotene-15,15'-monooxygenase (BLH). Furthermore, since large accumulations of retinaldehyde intracellularly can be toxic, the addition of the ABC transporter Pdr5 and the surfactant Tween-80 increases the efflux capacity of the retinaldehyde product, reducing intracellular toxicity and significantly increasing the yield of retinaldehyde. This achieves the co-production of carotene and retinaldehyde, with all retinaldehyde extracted extracellularly while β-carotene remains entirely intracellular, making product separation and extraction more convenient and preventing mutual interference.
[0032] In a 5 L fermenter, the PP-B2CCIV5 strain, using glucose as a carbon source, achieved complete extracellular secretion of retinaldehyde, yielding 317.75 mg / L, while β-carotene remained entirely intracellular, yielding 1390 mg / L. Using glycerol and methanol as common carbon sources, the retinaldehyde yield reached 262.01 mg / L (all extracellular) and the β-carotene yield reached 390 mg / L (all intracellular), laying the foundation for further industrial-scale production. Attached Figure Description
[0033] Figure 1 The structure diagram of plasmid BB3eH-AC-BLH-Yor1 / Snq2 / Pdr5 / Pdr20 / Pdr10 / Pdr15 is shown. The hygromycin gene carried by all plasmids is used as a selection marker for Pichia pastoris.
[0034] Figure 2 The graph shows the yield of retinaldehyde produced by the engineered strain PP-B2CCIV using different ABC transporters.
[0035] Figure 3 The graph shows the yield of retinaldehyde produced by the engineered strain PP-B2CCIVT5 using different surfactants.
[0036] Figure 4 The graph shows the yield of β-carotene produced by the engineered strain PP-B2CCIVT5 using different surfactants.
[0037] Figure 5 The graph shows the yield of retinaldehyde produced by the engineered strain PP-B2CCIVT5 using different concentrations of Tween-80.
[0038] Figure 6 The graph shows the yield of β-carotene produced by the engineered strain PP-B2CCIVT5 using different concentrations of Tween-80.
[0039] Figure 7The graph shows the yield of retinaldehyde produced by the engineered strain PP-B2CCIVT5 in a 5 L bioreactor using glucose as the carbon source and adding Tween-80.
[0040] Figure 8 The graph shows the yield of retinaldehyde produced by engineered strain PP-B2CCIV5 in a 5 L bioreactor using methanol as the carbon source and adding Tween-80. Detailed Implementation
[0041] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.
[0042] The original strain used in the examples was *Pichia pastoris* PP-BCCIV, which is a modified strain of *Pichia pastoris*. It was obtained by introducing *Pichia pastoris* GS115 with gerany-gerany diphosphate synthase CrtE, phytoene synthase / lycopene cyclase CrtYB, phytoene desaturase CrtI, 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR, β-carotene-15,15'-monooxygenase BLH, dehydrogenase Zwf1, phosphate dehydrogenase Gnd2, NADH dehydrogenase Pos5, ATP citrate lyase ACL, acetyl-CoA synthase ACS, choline kinase CK, inositol polyphosphokinase IPK, and *Vibrio hygroscopicis* hemoglobin VHb. The *Pichia pastoris* GS115 strain can be purchased commercially.
[0043] The recombinant strain PP-B was obtained by expressing the dehydrogenase Zwf1, phosphate dehydrogenase Gnd2, NADH kinase Pos5 genes, and β-carotene-15,15'-monooxygenase genes derived from *Saccharomyces cerevisiae*. Using BB3-Z4-intE12 as the vector plasmid, a recombinant plasmid containing the Gnd2, Pos5, and Zwf1 genes was constructed and integrated into the intE12 site of the host strain PP-B genome to obtain the recombinant strain PP-BC. The strain and its specific construction method have been disclosed in CN 120399915 A.
[0044] The recombinant strain PP-BCCIV was obtained by introducing ATP citrate lyase ACL, acetyl-CoA synthase ACS, choline kinase CK, inositol polyphosphokinase IPK, and the expression cassette of Vibrio hygroscopic hemoglobin VHb into the recombinant strain PP-BC. Using BB3rN-AF as the vector plasmid, a co-expression recombinant plasmid of ACL, ACS, IPK, CK, and VHb was constructed. The recombinant plasmid was integrated into the RGI2 site of the PP-BC genome to obtain the recombinant Pichia pastoris strain PP-BCCIV with the isopentenol utilization pathway. The strain and its specific construction method are described in CN121006286A. The Pichia pastoris strain PP-BCCIV can be obtained by replacing the strain PP-B2C introduced in the construction process of the recombinant strain PP-B2CCIV in this patent with PP-BC.
[0045] In this embodiment, the product extraction and quantitative analysis steps are as follows:
[0046] 1. Extraction of intracellular products
[0047] (1) Take 1 mL of the mixed fermentation broth and centrifuge at 12000 rpm for 5 min (wash twice with pure water).
[0048] (2) After draining the water, resuspend the contents in 2 mL of dimethyl sulfoxide (DMSO) (preheated at 60℃) and shake evenly on a vortex mixer. Then place the container in a 55℃ water bath for 15 min.
[0049] (3) Add 4 mL of anhydrous ethanol.
[0050] (4) Centrifuge the sample at 12,000 rpm for 5 min. Transfer the supernatant to a new centrifuge tube and store it away from light.
[0051] 2. Extraction of extracellular products
[0052] (1) Take 1 mL of the mixed fermentation broth, centrifuge at 12000 rpm for 5 min, and take the supernatant.
[0053] (2) Dilute with an appropriate amount of anhydrous ethanol and store away from light.
[0054] 3. Quantitative analysis of retinaldehyde: High performance liquid chromatography (HPLC) was used to detect the concentration of retinaldehyde.
[0055] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C18 column; the UV absorption wavelength was 325 nm; the mobile phase was methanol and acetonitrile (95:5); the flow rate was controlled at 1.0 mL / min; and the column temperature was 40℃.
[0056] 4. Quantitative analysis of β-carotene: High performance liquid chromatography (HPLC) was used to detect the concentration of β-carotene.
[0057] The liquid chromatograph used in this study was an Agilent Technologies 1200 Infinity series; the column was an Acclaim™ 120 C30 column; the UV absorption wavelength was 450 nm; the mobile phase was methanol and methyl tert-butyl ether (19:1); the flow rate was controlled at 1.0 mL / min; and the column temperature was 25℃.
[0058] Example 1: Amplification of Gene Elements and Preparation of Target Plasmids
[0059] (I) Preparation of target gene
[0060] Based on the coding gene sequences of six ABC transporters (Yor1, Snq2, Pdr5, Pdr10, Pdr12, Pdr15) from Saccharomyces cerevisiae provided on NCBI, PCR amplification was performed using the Saccharomyces cerevisiae genome as a template. The gene sequences are shown in SEQ ID No: 1-6.
[0061] Based on the gene of β-carotene-15,15'-monooxygenase BLH from the marine bacterium Marine bacterium 66A03 provided on NCBI, GenScript Biotech Co., Ltd. was commissioned to synthesize the gene and perform codon optimization. The gene sequence is shown in SEQ ID No: 7.
[0062] (II) Construction of recombinant plasmids
[0063] 1. Using BB1-23 (Plasmid #98496) as the vector plasmid, recombinant plasmids containing Yor1, Snq2, Pdr5, Pdr10, Pdr12, Pdr15 and BLH were constructed respectively.
[0064] The BLH gene sequence was synthesized by Genscript Biotech Inc. The coding gene sequences of six ABC transporters (Yor1, Snq2, Pdr5, Pdr10, Pdr12, and Pdr15) were amplified by PCR using the Saccharomyces cerevisiae genome as a template, and the gene sequences of Yor1, Snq2, Pdr5, Pdr10, Pdr12, and Pdr15 were obtained.
[0065] Each gene fragment was inserted into plasmid BB1-23 using the GoldenGate method, resulting in recombinant plasmids BB1-23-Yor1, BB1-23-Snq2, BB1-23-Pdr5, BB1-23-Pdr10, BB1-23-Pdr12, BB1-23-Pdr15, and BB1-23-BLH, as detailed below:
[0066] Using Yor1-F and Yor1-R / Snq2-F and Snq2-R / Pdr5-F and Pdr5-R / Pdr10-F and Pdr10-R / Pdr12-F and Pdr12-R / Pdr15-F and Pdr15-R as primers and the *Saccharomyces cerevisiae* genome as a template, the Yor1 / Snq2 / Pdr5 / Pdr10 / Pdr12 / Pdr15 fragment was amplified. The primer sequences are shown in Table 1. Using BLH-F and BLH-R as primers and the BLH gene sequence as a template, the BLH fragment was amplified. The primer sequences are shown in Table 1.
[0067] The amplified Yor1, Snq2, Pdr5, Pdr10, Pdr12, Pdr15, and BLH fragments were recovered and purified by agarose gel electrophoresis. GoldenGate assembly was performed using Bsa1 and T4 ligases from Beyotime Biotechnology Co., Ltd.
[0068] The circular recombinant vector was transformed into E. coli DH5α competent cells. Positive recombinant plasmids BB1-23-Yor1, BB1-23-Snq2, BB1-23-Pdr5, BB1-23-Pdr10, BB1-23-Pdr12, BB1-23-Pdr15 and BB1-23-BLH were obtained by screening for kanamycin sulfate resistance plates and verifying by colony PCR and sequencing.
[0069] 2. Construct expression cassettes for transport proteins and BLH.
[0070] Plasmids BB1-23-BLH, BB1-12-pGCW14, and BB1-34-RPS25Att were inserted into plasmid BB2-AB using the GoldenGate method with Bpi1 enzyme and T4 ligase to obtain plasmid BB2-AB-pGCW14-BLH-RPS25Att.
[0071] Plasmids BB1-23-Yor1, BB1-23-Snq2, BB1-23-Pdr5, BB1-23-Pdr10, BB1-23-Pdr12, and BB1-23-Pdr15 were inserted into plasmid BB2-BC using the GoldenGate method with Bpi1 and T4 ligases, respectively, along with plasmids BB1-12-pGAP and BB1-34-CYC1tt. The plasmids obtained are BB2-BC-pGAP-Yor1-CYC1tt, BB2-BC-pGAP-Snq2-CYC1tt, BB2-BC-pGAP-Pdr5-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, and BB2-BC-pGAP-Pdr15-CYC1tt.
[0072] The construction process of the recombinant plasmid BB2-AB-pGCW14-BLH-RPS25Att is as follows:
[0073] GoldenGate assembly was performed using Bpi1 enzyme and T4 ligase from Nanjing Fomax Biotechnology Co., Ltd. The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB2-AB-pGCW14-BLH-RPS25Att were obtained through ampicillin resistance plate screening and colony PCR and sequencing verification.
[0074] The construction process of the recombinant plasmid BB2-BC-pGAP-Yor1 / Snq2 / Pdr5 / Pdr10 / Pdr12 / Pdr15-CYC1tt was the same as above. The circular recombinant vector was transformed into *E. coli* DH5α competent cells. Positive recombinant plasmids BB2-BC-pGAP-Yor1-CYC1tt, BB2-BC-pGAP-Snq2-CYC1tt, BB2-BC-pGAP-Pdr5-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, and BB2-BC-pGAP-Pdr15-CYC1tt were obtained through ampicillin resistance plate screening and colony PCR and sequencing verification.
[0075] 3. Using BB3eH-AC (Plasmid#98544) as a vector, construct a recombinant plasmid for co-expression of the transporter protein and BLH:
[0076] Plasmids BB2-AB-pGCW14-BLH-RPS25Att were mixed with BB2-BC-pGAP-Yor1-CYC1tt, BB2-BC-pGAP-Snq2-CYC1tt, BB2-BC-pGAP-Pdr5-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, BB2-BC-pGAP-Pdr10-CYC1tt, and BB2-BC-pGAP-Pdr15-CYC1tt, respectively. Recombinant plasmids BB3eH-AC-BLH-Yor1, BB3eH-AC-BLH-Snq2, BB3eH-AC-BLH-Pdr5, BB3eH-AC-BLH-Pdr10, BB3eH-AC-BLH-Pdr12, and BB3eH-AC-BLH-Pdr15 were obtained by inserting the plasmid BB3eH-AC into the plasmid using the GoldenGate method with Bsa1 enzyme and T4 ligase.
[0077] The structure of the recombinant plasmid BB3eH-AC-BLH-Yor1 / Snq2 / Pdr5 / Pdr20 / Pdr10 / Pdr15 is shown in the figure. Figure 1 The specific construction process is as follows:
[0078] GoldenGate assembly was performed using Bsa1 and T4 ligases. The circular recombinant vector was transformed into E. coli DH5α competent cells, and positive recombinant plasmids BB3eH-AC-BLH-Yor1 / Snq2 / Pdr5 / Pdr10 / Pdr12 / Pdr15 were obtained by screening with hygromycin resistance plates and verification by colony PCR and sequencing.
[0079] Table 1 Primer sequences
[0080] Primer name Sequence (5'-3') Yor1-F GGTCTCCCatgacgattaccgtgggggat Yor1-R GGTCTCGAAGCttaacttctgttctcgaaatcattttcca Snq2-F GGTCTCCCatgagcaatatcaaaagcacgca Snq2-R GGTCTCGAAGCttactgcttctttttccttatgttttt Pdr5-F GGTCTCCCatgcccgaggccaagctta Pdr5-R GGTCTCGAAGCttatttcttggagagtttaccgttctt Pdr10-F GGTCTCCCatgttgcaagcgccctcaagt Pdr10-R GGTCTCGAAGCttatttctttaattttttgcttttcttt Pdr12-F GGTCTCCCatgtcttcgactgacgaacatattg Pdr12-R GGTCTCGAAGCttatttcttcgtgattttattttcgtca Pdr15-F GGTCTCCCatgtcatcagatatcagagacgtagag Pdr15-R GGTCTCGAAGCtcacttcttgggtttttcggaaatct BLH-F GGTCTCCCATGGGACTCATGCTAAT BLH-R GGTCTCGAAGCTCAATTTTTAATCTTAATT
[0081] Example 2 Construction of recombinant bacteria
[0082] 1. Construction of recombinant strain PP-B2CCIVT
[0083] The gene expression cassette plasmids BB3eH-AC-BLH-Yor1 / Snq2 / Pdr5 / Pdr10 / Pdr12 / Pdr15 were introduced into Pichia pastoris PP-BCCIV to obtain recombinant strains PP-B2CCIVT1, PP-B2CCIVT2, PP-B2CCIVT5, PP-B2CCIVT10, PP-B2CCIVT12 and PP-B2CCIVT15.
[0084] The specific method is as follows:
[0085] ① Competent cells were prepared by overnight culture of Pichia pastoris in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose).
[0086] ② Using an electroporator, BB3eH-AC-BLH-Yor1 / Snq2 / Pdr5 / Pdr10 / Pdr12 / Pdr15 were introduced into the corresponding Pichia pastoris competent cells for homologous recombination.
[0087] ③ Use YPD selection plates with added hygromycin for screening. Single colonies will grow in 2-3 days. The positive clones that are correctly identified by PCR are named recombinant bacteria PP-B2CCIVT1, PP-B2CCIVT2, PP-B2CCIVT5, PP-B2CCIVT10, PP-B2CCIVT12 and PP-B2CCIVT15, respectively.
[0088] Example 3: Application of recombinant bacteria in the production of retinaldehyde
[0089] The engineered bacteria were cultured using recombinant strain PP-B2CCIV (the strain and its specific construction method have been disclosed in CN121006286A) and recombinant strains PP-B2CCIVT1, PP-B2CCIVT2, PP-B2CCIVT5, PP-B2CCIVT10, PP-B2CCIVT12 and PP-B2CCIVT15 from Example 2 to produce retinaldehyde.
[0090] The specific method is as follows: Take the strain from the preservation tube, inoculate it into the YPD test tube with a 1% inoculation amount, and culture it at 30℃ for 24 hours to obtain the seed liquid;
[0091] The seed culture was inoculated at a rate of 1% into 50 mL of fermentation medium (40 g / L glucose, 10 g / L yeast extract, and 20 g / L tryptone). The culture was incubated at 25°C with shaking at 220 rpm for 5 days. At 24 h, 40 g / L glucose was added as the sole carbon source. The intracellular retinaldehyde yields of the recombinant strains PP-B2CCIV, PP-B2CCIVT1, PP-B2CCIVT2, PP-B2CCIVT5, PP-B2CCIVT10, PP-B2CCIVT12, and PP-B2CCIVT15 were 64.40 mg / L, 60.26 mg / L, 62.02 mg / L, 66.55 mg / L, 64.89 mg / L, 61.13 mg / L, 59.60 mg / L, and 59.60 mg / L, respectively. mg / L, and extracellular retinaldehyde was detected at 0.93 mg / L, 1.48 mg / L, 3.00 mg / L, 1.26 mg / L, and 0.50 mg / L for PP-B2CCIVT1, PP-B2CCIVT2, PP-B2CCIVT5, PP-B2CCIVT10, and PP-B2CCIVT15, respectively. Figure 2 Compared with the control strain, PP-B2CCIVT5 had the highest retinaldehyde yield, indicating that Pdr5 was the most effective strain for retinaldehyde production. Therefore, PP-B2CCIVT5 was selected as the subsequent experimental strain.
[0092] Example 4: Production of retinaldehyde by shake-flask fermentation of recombinant strain PP-B2CCIVT5 using different surfactants
[0093] ① Seed culture:
[0094] a. Primary seed culture: Take 1% of the recombinant strain PP-B2CCIVT5 bacterial culture from the cryopreservation tube and inoculate it into YPD test tubes. Incubate at 30°C and 200 rpm for 24 hours to obtain the primary seed culture. The YPD medium contains 2% peptone, 1% yeast extract and 2% glucose.
[0095] b. Secondary seed culture: Take the primary seed culture and inoculate it into a new seed culture medium at an inoculation rate of 10%, and culture it at a constant temperature under the same conditions as a to obtain the seed culture for fermentation culture.
[0096] ② The seed culture obtained from the seed culture was inoculated into an Erlenmeyer flask containing 50 ml of fermentation medium and fermented at 25℃ and 200 rpm. During fermentation, glucose was added every 24 hours from the 24th hour until the concentration reached 40 g / L. At the 24th hour of fermentation, 10% surfactant (Tween-80, Triton, rhamnose ester, dodecane) was added respectively.
[0097] After 120 hours of incubation, OD was measured. 600Retinaldehyde was extracted from the fermentation broth, and its content was determined. For example... Figure 3 As shown, after 120 hours of fermentation using Tween-80, the highest retinaldehyde yield reached 147.51 mg / L (of which extracellular retinaldehyde reached 144.59 mg / L), an increase of 112.06% compared to the control without surfactant. This indicates that Tween-80 is most effective for retinaldehyde production by the recombinant strain PP-B2CCIVT5. It was also found that the use of surfactant only caused retinaldehyde to be secreted extracellularly, while β-carotene remained completely intracellular.
[0098] Example 5: Retinaldehyde was produced by shake-flask fermentation of recombinant strain PP-B2CCIVT5 using different concentrations of Tween-80.
[0099] ① Seed culture:
[0100] Same as Case 4.
[0101] ② The seed culture obtained from the seed culture was inoculated into an Erlenmeyer flask containing 50 ml of fermentation medium and fermented at 25℃ and 200 rpm. During fermentation, glucose was added every 24 hours from the 24th hour to a concentration of 40 g / L. At the 24th hour of fermentation, 5~25% Tween-80 was added.
[0102] After 120 hours of incubation, OD was measured. 600 Retinaldehyde and β-carotene were extracted from the fermentation broth, and their contents were determined. For example... Figure 4 As shown, after 120 hours of fermentation with 10% Tween-80, the highest retinaldehyde yield reached 147.51 mg / L (of which extracellular retinaldehyde reached 144.59 mg / L, indicating that retinaldehyde was almost completely transferred to the extracellular environment), which was 112.06% higher than the control without surfactant. The intracellular yield of β-carotene was 456.33 mg / L, and β-carotene was not detected extracellularly. This indicates that 10% Tween-80 is most effective for the production of retinaldehyde by the recombinant strain PP-B2CCIVT5, and can transfer almost all of the retinaldehyde to the extracellular environment, while β-carotene remains intracellular.
[0103] Implementation Case 6: High-density fermentation of recombinant strain PP-B2CCIVT5 using surfactants to produce retinaldehyde
[0104] ① Seed culture:
[0105] Same as Case 4.
[0106] ② Batch feeding fermentation
[0107] The seed culture obtained from seed culture was inoculated into a 5 L fermenter containing fermentation medium (40 g / L glucose, 20 g / L peptone, 10 g / L yeast extract). Recombinant strain PP-B2CCIVT5 underwent fed-batch fermentation in the 5 L fermenter at 25℃, 500 rpm, and dissolved oxygen maintained at 40%. The initial glucose concentration in the fermenter was 40 g / L. When the glucose was nearly depleted, glucose was added continuously to maintain the glucose concentration in the fermenter between 0 g / L and 10 g / L. 10% Tween-80 was added at 24 hours of fermentation. Samples were taken every 12 hours to determine cell dry weight, extract retinal from the fermentation broth, and determine the retinal content. Cell OD... 600 The highest concentration can reach 167.6 mg / L, with retinaldehyde completely secreted extracellularly, yielding up to 317.75 mg / L, while β-carotene remains completely intracellularly, yielding 1390 mg / L. Figure 5 In addition, glycerol was used as the carbon source for the first 24 hours, and then methanol was used after 24 hours. The bacterial OD... 600 The highest concentration reached 202.4 mg / L, with retinaldehyde production reaching 262.01 mg / L (all extracellular) and β-carotene production reaching 390 mg / L (all intracellular). Figure 6 ).
[0108] This invention reduces intracellular toxicity by introducing an exogenous ABC transporter and utilizing the surfactant Tween-80 to increase product efflux. Furthermore, it adds one copy of 15,15'-β-carotene monooxygenase (BLH) to increase retinaldehyde synthesis. Simultaneously, it achieves co-production of carotene and retinaldehyde, with all retinaldehyde extracted extracellularly while β-carotene remains entirely intracellular, making product separation and extraction easier and preventing mutual interference. Finally, continuous fed-batch fermentation was conducted in a 5 L fermenter, and the production capacity of the strain was comprehensively evaluated by measuring the OD of the recombinant strain in the fermenter. 600 The detection of retinaldehyde production status is expected to further increase retinaldehyde production in larger fermentation tanks, laying the foundation for subsequent industrialization.
Claims
1. A recombinant Pichia pastoris strain capable of increasing the efflux of retinaldehyde products, characterized in that, The recombinant Pichia pastoris strain was obtained by expressing an ABC transporter protein derived from Saccharomyces cerevisiae and a β-carotene-15,15'-monooxygenase BLH derived from Marine bacterium 66A03 in the host bacteria.
2. The recombinant Pichia pastoris according to claim 1, characterized in that, The ABC transporter protein is at least one of Yor1, Snq2, Pdr5, Pdr10, Pdr12, and Pdr15, and the encoding genes are shown in SEQ ID No: 1-6, respectively.
3. The recombinant Pichia pastoris according to claim 1, characterized in that, The gene for β-carotene-15,15'-monooxygenase BLH is derived from marine bacteria 66A03, and the encoding gene is shown in SEQ ID No:
7.
4. The recombinant Pichia pastoris according to claim 1, characterized in that, The host bacterium is any one of recombinant bacteria PP-B, recombinant bacteria PP-BC, or recombinant bacteria PP-BCCIV.
5. The application of the recombinant Pichia pastoris according to any one of claims 1-4 in the fermentation production of retinaldehyde.
6. The application according to claim 5, characterized in that, Includes the following steps: (1) The recombinant Pichia pastoris according to any one of claims 1-4 was cultured in YPD medium to obtain the fermentation product; a surfactant was added at 24 h of fermentation; (2) The fermentation product was extracted with dimethyl sulfoxide and ethanol to obtain retinaldehyde.
7. The application according to claim 6, characterized in that, The surfactant is any one of Tween-80, Triton, rhamnose ester, and dodecane.
8. The application according to claim 6, characterized in that, The amount of surfactant added is 5% to 25%.
9. The method for high-density biosynthesis of retinaldehyde according to claim 6, characterized in that, The fermentation temperature was 25°C, the rotation speed was 500 rpm, and the dissolved oxygen was maintained at 40%.
10. A method for co-producing retinaldehyde and β-carotene, characterized in that, Recombinant Pichia pastoris was fermented and cultured. 10% Tween-80 was added at 24 hours of fermentation. The recombinant Pichia pastoris strain was obtained by expressing the ABC transporter Pdr5 from Saccharomyces cerevisiae and the β-carotene-15'-monooxygenase BLH from Marine bacterium 66A03 in the recombinant strain PP-BCCIV. After fermentation, the fermentation broth was centrifuged to obtain cells containing β-carotene and a supernatant containing retinaldehyde. Retinaldehyde was extracellular, and β-carotene was intracellular. Retinaldehyde and β-carotene products were obtained through separation and extraction.
Citation Information
Patent Citations
Recombinant pichia pastoris capable of producing retinol as well as construction method and application of recombinant pichia pastoris
CN118240674A
Recombinant pichia pastoris strain with high yield of retinaldehyde as well as construction method and application of recombinant pichia pastoris strain
CN120399915A
Method for biological high-density synthesis of retinaldehyde and synthetic strain thereof
CN121006286A