Yarrowia lipolytica with high homologous recombination efficiency and / or low lipid degradation capacity and methods of construction thereof

By introducing a copper-inducible promoter and homologous recombination-related genes into *Yersinia lipophila* and knocking out related lipid degradation genes, the homologous recombination efficiency of yeast was improved and the lipid degradation capacity was reduced. This solved the problems of gene editing and product reabsorption in *Yersinia lipophila*, achieving efficient gene editing and reducing waste.

CN122146487APending Publication Date: 2026-06-05JIANGNAN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2026-03-05
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

The low homologous recombination efficiency of Yersinia lipophila leads to low efficiency in precise gene editing, while its excessive lipid degradation ability results in product reabsorption and waste.

Method used

To construct a recombinant lipophilic yeast with high homologous recombination efficiency, copper-inducible promoters and homologous recombination-related genes, such as pCTR2, pMT2, ylKU70, ylKU80, ylRAD51, ylRAD52, scRAD52, and scRAD59, were introduced and overexpressed in yeast. At the same time, POX5, POX2, and POX3 genes were knocked out to reduce lipid degradation capacity.

Benefits of technology

It significantly improves the homologous recombination efficiency and precise gene editing efficiency of *Saccharomyces lilacinus*, reduces lipid degradation capacity, decreases product reabsorption, and improves production efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146487A_ABST
    Figure CN122146487A_ABST
Patent Text Reader

Abstract

The application relates to the technical field of genetically modified yeasts, in particular to a Yarrowia lipolytica with high homologous recombination efficiency and / or low lipid degradation capacity and a construction method thereof. The engineered Yarrowia lipolytica comprises a copper ion inducible promoter and a gene related to homologous recombination; the copper ion inducible promoter is selected from any one or more of the following: a pCTR2 promoter, a pMT2 promoter and a pUAS16MT2 constitutive promoter; wherein the gene related to homologous recombination is selected from any one or more of the following: a ylKU70 gene, a ylKU80 gene, a ylRAD51 gene, a ylRAD52 gene, a scRAD52 gene and a scRAD59 gene. The homologous recombination efficiency of the engineered Yarrowia lipolytica is significantly improved. Furthermore, the POX5 gene, the POX2 gene and / or the POX3 gene are knocked out, so that the lipid degradation capacity of the engineered Yarrowia lipolytica is significantly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of genetically modified yeast, specifically to a lipophilic yeast with high homologous recombination efficiency and / or low lipid degradation capacity, and a method for constructing the same. Background Technology

[0002] Yersinia lipolyticis has low homologous recombination efficiency, resulting in low efficiency in precise gene editing (deletion or integration of gene fragments). In addition, Yersinia lipolyticis has excessive lipid degradation ability, which leads to the reabsorption of products during the production of functional fatty acids, resulting in waste.

[0003] Therefore, it is necessary to propose a method for constructing a lipophilic yeast with high homologous recombination efficiency and / or low lipid degradation capacity. Summary of the Invention

[0004] This application provides a lipophilic yeast with high homologous recombination efficiency and / or low lipid degradation capacity, and a method for constructing the same.

[0005] This application involves the following: In a first aspect, this application provides a recombinant Yersinia lipolytica with high homologous recombination efficiency, wherein the recombinant Yersinia lipolytica contains a copper ion-inducible promoter and genes related to homologous recombination; The copper ion-inducible promoter is selected from any one or more of the following groups: pCTR2 promoter, pMT2 promoter and pUAS16MT2 constitutive promoter; The homologous recombination-related genes are selected from any one or more of the following groups: ylKU70 gene, ylKU80 gene, ylRAD51 gene, ylRAD52 gene, scRAD52 gene, and scRAD59 gene.

[0006] In a further embodiment, the recombinant Yersinia lipolyticis contains the pMT2 promoter, the pUAS16MT2 constitutive promoter, the ylRAD52 gene, the scRAD52 gene, and the scRAD59 gene.

[0007] In a further embodiment, the recombinant Yersinia lipophila may also include any one or more of the following: a marker gene for screening, an upstream homologous arm for homologous recombination, a downstream homologous arm for homologous recombination, and an sgRNA expression unit.

[0008] In a further embodiment, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence.

[0009] In a further embodiment, the recombinant Yersinia lipolytica is a tryptophan-encoding gene defective type.

[0010] In a further embodiment, the recombinant Yersinia lipophila is a TRP1 gene defective type.

[0011] In a further embodiment, the pCTR2 promoter is shown as SEQ ID NO. 1.

[0012] In a further embodiment, the pMT2 promoter is shown as SEQ ID NO. 2.

[0013] In a further embodiment, the pUAS16MT2 constitutive promoter is shown in SEQ ID NO. 3.

[0014] In a further embodiment, the pCTR2 promoter is shown in SEQ ID NO. 1, the pMT2 promoter is shown in SEQ ID NO. 2, and the pUAS16MT2 constitutive promoter is shown in SEQ ID NO. 3.

[0015] In a further embodiment, the ylKU70 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 9 as a template and the gene fragments shown in SEQ ID NO. 48 and 49 as primers.

[0016] In a further embodiment, the ylKU80 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 11 as a template and the gene fragments shown in SEQ ID NO. 51 and 52 as primers.

[0017] In a further embodiment, the ylRAD51 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 13 as a template and the gene fragments shown in SEQ ID NO. 55 and 56 as primers.

[0018] In a further embodiment, the ylRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 15 as a template and the gene fragments shown in SEQ ID NO. 59 and 60 as primers.

[0019] In a further embodiment, the scRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 18 as a template and the gene fragments shown in SEQ ID NO. 65 and 66 as primers.

[0020] In a further embodiment, the scRAD59 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 20 as a template and the gene fragments shown in SEQ ID NO. 64 and 68 as primers.

[0021] Secondly, this application provides a method for constructing the above-mentioned recombinant Yersinia lipolytica with high homologous recombination efficiency, wherein the copper ion-inducible promoter, the homologous recombination-related gene and wild-type Yersinia lipolytica are mixed and contacted, and after homologous recombination, the copper ion-inducible promoter and the homologous recombination-related gene are transformed into the wild-type Yersinia lipolytica to obtain the recombinant Yersinia lipolytica.

[0022] In a further embodiment, the wild-type Yersinia lipolyticis is a competent wild-type Yersinia lipolyticis.

[0023] In a further embodiment, the method further includes transforming the wild-type Yersinia lipophila into any one or more of the following groups: a marker gene for screening, an upstream homologous arm for homologous recombination, a downstream homologous arm for homologous recombination, and an sgRNA expression unit.

[0024] In a further embodiment, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence. In another further embodiment, the upstream homologous arm of the homologous recombination, the downstream homologous arm of the homologous recombination, and the sgRNA expression unit are used for subsequent targeted knockout of tryptophan-encoding genes.

[0025] In a further embodiment, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence. In another further embodiment, the upstream homologous arm of the homologous recombination, the downstream homologous arm of the homologous recombination, and the sgRNA expression unit are used for subsequent targeted knockout of the TRP1 gene.

[0026] In a further embodiment, the construction method includes: The pMT2 promoter, pUAS16MT2 constitutive promoter, ylRAD52 gene, scRAD52 gene, and scRAD59 gene were mixed and contacted with the wild-type Yersinia lipolytica.

[0027] In a further embodiment, the construction method includes: The pUAS16MT2 constitutive promoter, ylRAD52 gene, and scRAD52 gene were mixed with the wild-type Yersinia lipolytica and homologous recombination was performed to obtain the recombinant strain Po1f-yl52. The pMT2 promoter, scRAD52 gene, and scRAD59 gene were mixed and contacted with the recombinant strain Po1f-yl52.

[0028] Thirdly, this application provides a gene-knockout Yersinia lipophilia with low lipid degradation capacity, wherein the gene-knockout Yersinia lipophilia has knocked out any one or more genes from the following group: POX5 gene, POX2 gene and POX3 gene.

[0029] In a further embodiment, the *Yarrowia lipolytica* gene knockout method knocks out the POX5 gene. In a further embodiment, the *Yarrowia lipolytica* gene knocks out the POX2 gene. In a further embodiment, the *Yarrowia lipolytica* gene knocks out the POX3 gene.

[0030] In a further embodiment, the gene knockout Yeast lipophilia knocks out the following genes: POX5, POX2, and POX3.

[0031] In a further embodiment, gene knockout is performed using a gene editing method, namely CRISPR / Cas9; Among them, the gRNA targeting the POX2 gene knockout is shown in SEQ ID NO. 108, and / or, gRNAs targeting and knocking out the POX3 gene are shown in SEQ ID NO. 109, and / or, The gRNA that targets and knocks out the POX5 gene is shown in SEQ ID NO. 110.

[0032] Fourthly, this application provides an engineered Yersinia lipolytica with high homologous recombination efficiency and low lipid degradation capacity. The engineered Yersinia lipolytica is obtained by knocking out one or more genes from the following group: POX5 gene, POX2 gene and POX3 gene in the above-mentioned recombinant Yersinia lipolytica or the recombinant Yersinia lipolytica constructed by the above method.

[0033] In a further embodiment, the engineered lipolytic yeast has the following genes knocked out: POX5 gene, POX2 gene, and POX3 gene.

[0034] In a further embodiment, gene knockout is performed using a gene editing method, namely CRISPR / Cas9; Among them, the gRNA targeting the POX2 gene knockout is shown in SEQ ID NO. 108, and / or, gRNAs targeting and knocking out the POX3 gene are shown in SEQ ID NO. 109, and / or, The gRNA that targets and knocks out the POX5 gene is shown in SEQ ID NO. 110.

[0035] In a further embodiment, the engineered Yeast lipolyticus also contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette.

[0036] In a further embodiment, the method for constructing the engineered Yersinia lipolytica further includes: transforming the pINA1292spopaid12 plasmid into Yersinia lipolytica; wherein the pINA1292spopaid12 plasmid contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette.

[0037] In a further embodiment, the pINA1292spopaid12 plasmid is transformed into Escherichia coli pJU16-opai-d12; the Escherichia coli pJU16-opai-d12 is a strain with accession number CGMCC No. 7223.

[0038] In a further embodiment, the method for constructing the engineered Yersinia lipolytica further includes: extracting the pINA1292spopaid12 plasmid from Escherichia coli pJU16-opai-d12, and transforming the extracted pINA1292spopaid12 plasmid into Yersinia lipolytica.

[0039] Fifthly, this application provides an engineered Yersinia lipolytica with high homologous recombination efficiency and low lipid degradation capacity. The engineered Yersinia lipolytica contains a copper ion-inducible promoter and genes related to homologous recombination, and the engineered Yersinia lipolytica has knocked out any one or more genes from the following group: POX5 gene, POX2 gene and POX3 gene. The copper ion-inducible promoter is selected from any one or more of the following groups: pCTR2 promoter, pMT2 promoter and pUAS16MT2 constitutive promoter; The homologous recombination-related genes are selected from any one or more of the following groups: ylKU70 gene, ylKU80 gene, ylRAD51 gene, ylRAD52 gene, scRAD52 gene, and scRAD59 gene.

[0040] In a further embodiment, the engineered Yersinia lipolytica includes the pMT2 promoter, the pUAS16MT2 constitutive promoter, the ylRAD52 gene, the scRAD52 gene, and the scRAD59 gene.

[0041] In a further embodiment, the engineered Yeast lipolyticus also comprises any one or more selected from the group consisting of: a marker gene for screening, an upstream homologous arm for homologous recombination, a downstream homologous arm for homologous recombination, and an sgRNA expression unit.

[0042] In a further embodiment, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence. In another further embodiment, the upstream homologous arm of the homologous recombination, the downstream homologous arm of the homologous recombination, and the sgRNA expression unit are used for subsequent targeted knockout of tryptophan-encoding genes.

[0043] In a further embodiment, the upstream homologous arm of the homologous recombination, the downstream homologous arm of the homologous recombination, and the sgRNA expression unit are used for subsequent targeted knockout of the TRP1 gene.

[0044] In a further embodiment, the engineered Yersinia lipolytica is a tryptophan-encoding gene defective type.

[0045] In a further embodiment, the engineered lipolytic yeast is a TRP1 gene defective type.

[0046] In a further embodiment, the pCTR2 promoter is shown as SEQ ID NO. 1.

[0047] In a further embodiment, the pMT2 promoter is shown as SEQ ID NO. 2.

[0048] In a further embodiment, the pUAS16MT2 constitutive promoter is shown in SEQ ID NO. 3.

[0049] In a further embodiment, the pCTR2 promoter is shown in SEQ ID NO. 1, the pMT2 promoter is shown in SEQ ID NO. 2, and the pUAS16MT2 constitutive promoter is shown in SEQ ID NO. 3.

[0050] In a further embodiment, the ylKU70 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 9 as a template and the gene fragments shown in SEQ ID NO. 48 and 49 as primers.

[0051] In a further embodiment, the ylKU80 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 11 as a template and the gene fragments shown in SEQ ID NO. 51 and 52 as primers.

[0052] In a further embodiment, the ylRAD51 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 13 as a template and the gene fragments shown in SEQ ID NO. 55 and 56 as primers.

[0053] In a further embodiment, the ylRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 15 as a template and the gene fragments shown in SEQ ID NO. 59 and 60 as primers.

[0054] In a further embodiment, the scRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 18 as a template and the gene fragments shown in SEQ ID NO. 65 and 66 as primers.

[0055] In a further embodiment, the scRAD59 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 20 as a template and the gene fragments shown in SEQ ID NO. 64 and 68 as primers.

[0056] In a further embodiment, gene knockout is performed using a gene editing method, namely CRISPR / Cas9; Among them, the gRNA targeting the POX2 gene knockout is shown in SEQ ID NO. 108, and / or, gRNAs targeting and knocking out the POX3 gene are shown in SEQ ID NO. 109, and / or, The gRNA that targets and knocks out the POX5 gene is shown in SEQ ID NO. 110.

[0057] In a further embodiment, the engineered Yeast lipolyticus also contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette.

[0058] In a further embodiment, the method for constructing the engineered Yersinia lipolytica further includes: transforming the pINA1292spopaid12 plasmid into Yersinia lipolytica; wherein the pINA1292spopaid12 plasmid contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette.

[0059] In a further embodiment, the pINA1292spopaid12 plasmid is transformed into Escherichia coli pJU16-opai-d12; the Escherichia coli pJU16-opai-d12 is a strain with accession number CGMCC No. 7223.

[0060] In a further embodiment, the method for constructing the engineered Yersinia lipolytica further includes: extracting the pINA1292spopaid12 plasmid from Escherichia coli pJU16-opai-d12, and transforming the extracted pINA1292spopaid12 plasmid into Yersinia lipolytica.

[0061] Beneficial effects: 1. This application achieves dynamic enhancement of homologous recombination efficiency in Yersinia lipophila by dynamically regulating the expression of key homologous recombination pathway genes and their competing NHEJ pathway genes through promoter engineering, thereby further improving its precision gene editing efficiency.

[0062] 2. This application significantly improves the DNA repair efficiency of *Yersinia lipophila* during homologous recombination or HMEJ by simultaneously inserting copper-inducible promoters, such as pCTR2, pMT2, and / or pUAS16MT2 constitutive promoters (especially pMT2 and pUAS16MT2 constitutive promoters), into wild-type *Yersinia lipophila*.

[0063] 3. This application found that by knocking out key genes related to the synthesis of β-oxidative degradation of long-chain unsaturated fatty acids, such as knocking out the POX5 gene, POX2 gene and / or POX3 gene, especially by knocking out the POX5 gene, POX2 gene and POX3 gene simultaneously, the long-chain fatty acid degradation capacity of engineered Yeastia lipolytica can be significantly reduced. Attached Figure Description

[0064] Figure 1 A schematic diagram of TRP1 knockout mediated by homologous recombination assisted by CRISPR-Cas9.

[0065] Figure 2 Hygromycin resistance gene was integrated into the HMEJ plasmid targeting the TRP1 site.

[0066] Figure 3 Lipid degradation capacity of different recombinant strains. Detailed Implementation

[0067] Specific embodiments of the present application will now be described in more detail with reference to the accompanying drawings. While specific embodiments of the present application are shown in the drawings, it should be understood that the present application can be implemented in various forms and should not be limited to the embodiments set forth herein. Rather, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0068] brewing yeast ( Saccharomyces cerevisiaeThe ScRAD52 gene fragment encodes a key homologous recombination (HR) repair protein, whose main function is to mediate the precise repair of DNA double-strand breaks, playing a central role in gene editing and genome stability maintenance.

[0069] brewing yeast ( Saccharomyces cerevisiae The protein encoded by the gene fragment ScRAD59 (RAD59 gene fragment, ScRAD59) is a homologous protein of RAD52. Its core function is to assist in single-strand annealing (SSA), RAD51-independent homologous recombination (HR), and break-induced replication (BIR) in the repair of DNA double-strand breaks (DSB). It also participates in non-homologous end excision and strand annealing to ensure genome stability, and plays a key role, especially in the repair of short homologous fragments.

[0070] The pMT2 promoter in *Yarrowia lipolytica* natively drives the expression of the MT2 gene (metallothionein 2). MT2 encodes a metallothionein protein whose main function is to bind heavy metal ions such as copper and cadmium, participating in heavy metal detoxification and intracellular metal ion homeostasis regulation. Its transcription is activated by copper ions and other heavy metals. In synthetic biology and metabolic engineering, pMT2 is often used as a copper-inducible promoter to drive the controlled expression of heterologous genes such as reporter genes (e.g., lacZ) and key enzyme genes in metabolic pathways (e.g., crtZ and crBKT in the astaxanthin synthesis pathway), thereby achieving the induction of target gene expression and optimization of metabolic regulation.

[0071] The pCTR2 promoter of *Yarrowia lipolyticis* naturally drives the expression of its own CTR2 gene (a copper ion transport-related gene encoding a copper ion transporter protein), regulating the yeast's absorption and balance of copper ions to adapt to changes in environmental copper ion concentration. In synthetic biology and metabolic engineering applications, pCTR2 is also frequently used as an inducible promoter to initiate the expression of target genes (such as reporter genes, key enzyme genes in metabolic pathways, etc.) under low copper conditions, thereby achieving controlled gene expression and metabolic regulation.

[0072] ylKU70 is a gene in *Yarrowia lipolytica* that encodes Ku70, a core factor in the non-homologous end joining (NHEJ) pathway. Its core function is to form a heterodimer with Ku80, recognize and bind to DNA double-strand breaks (DSBs), and initiate NHEJ repair to maintain genome stability. It also participates in telomere protection and replication fork stability. In genetic engineering, knocking out ylKU70 significantly inhibits random integration and increases homologous recombination (HR) efficiency, making it a common strategy for efficient gene editing. The mechanism of action of this gene includes: heterodimer assembly and DNA binding: ylKU70 and ylKU80 form a circular heterodimer, which specifically binds to DSB ends through a central β-barrel structure, without sequence specificity, ensuring rapid recognition of various break sites. Repair complex recruitment: After binding to DSBs, DNA-PKcs are recruited through the C-terminal domain of ylKU70, activating their kinase activity, phosphorylating downstream factors (such as XRCC4), and promoting Lig4-catalyzed DNA end joining. Telomere protection function: It interacts with telomere-binding proteins to stabilize telomere DNA-protein complexes, preventing telomere ends from being misidentified as DSBs and triggering abnormal repair, thus maintaining chromosome end stability. Knockout of ylKU70 can inhibit NHEJ-mediated random integration, increasing homologous recombination efficiency to over 90%, significantly improving the targeting efficiency of gene knockout, knock-in, and site-specific integration, making it a key modification target for Yersinia lipophila metabolic engineering and synthetic biology.

[0073] ylKU80 is the gene encoding the Ku80 protein in Yersinia lipolyticis. Its core function is to form a heterodimer with ylKU70, initiate non-homologous end joining (NHEJ) to repair DNA double-strand breaks (DSBs), and participate in telomere protection and replication fork stabilization. In genetic engineering, knocking out ylKU80 can significantly inhibit random integration and improve homologous recombination (HR) efficiency, making it a key target for efficient gene editing.

[0074] ylRAD51 is a gene in *Yarrowia lipolytica* that encodes Rad51, a core recombinase for homologous recombination (HR). Its core function is to catalyze precise HR repair of DNA double-strand breaks (DSBs), maintaining genome stability, and participating in meiotic recombination and replication fork protection. In genetic engineering, overexpression of ylRAD51 can enhance targeted integration efficiency, making it a key target in metabolic engineering and synthetic biology. Its main functions are as follows: As a core recombinase in the HR pathway: In DSB repair, it binds to single-stranded DNA (ssDNA) to form nucleoprotein filaments, mediating homologous sequence search and strand invasion, initiating precise template-dependent repair. It is an essential component of the HR pathway, ensuring genome integrity and faithful transmission of genetic information. In meiosis and genetic diversity: It participates in homologous chromosome pairing, crossing over, and gene recombination during meiosis, and is a key factor in the generation of genetic diversity, ensuring gamete genome stability and fertility. Replication fork protection and stress response: Under DNA replication stress (such as DNA damage, nucleotide depletion), it stabilizes stalled replication forks, prevents their collapse, promotes replication restart, and enhances the cell's tolerance to DNA damage (such as ionizing radiation, cross-linking agents). Synergy and competition with the NHEJ pathway: It competes with the ylKU70 / ylKU80-mediated NHEJ pathway for DSB substrates. The HR pathway relies on precise repair by ylRAD51. Together with NHEJ, it maintains genome stability and influences gene-targeted integration efficiency.

[0075] ylRAD52 is the gene encoding Rad52, a core regulatory protein of homologous recombination (HR), in *Yersinia lipolytica*. Its function is highly conserved with that of *Saccharomyces cerevisiae* ScRAD52. Its core role is to mediate precise HR repair of DNA double-strand breaks (DSBs), assisting the recombinase ylRAD51 in completing nucleoprotein filament assembly. It also participates in the single-strand annealing (SSA) repair pathway, making it a key factor in maintaining genome stability. In genetic engineering, overexpression of ylRAD52 can significantly improve homologous directed repair (HDR) efficiency, making it an important target for optimizing gene editing in *Yersinia lipolytica*. ylRAD52 is a key accessory protein of ylRAD51. After single-stranded DNA (ssDNA) is generated from the DSB ends by nuclease excision, ylRAD52 preferentially binds to ssDNA and protects it from degradation. Simultaneously, it mediates the dissociation of replication protein A (RPA) from ssDNA, assisting ylRAD51 in loading onto ssDNA to form nucleoprotein filaments, thereby initiating homologous sequence search and strand invasion to complete precise template-dependent repair. When homologous repeat sequences exist at both ends of the DSB, ylRAD52 can directly catalyze the annealing reaction at the complementary ssDNA ends, completing SSA repair (accompanied by fragment deletion between repeat sequences), independent of ylRAD51. This function is particularly important in short homologous fragment-mediated repair and is the core pathway of RAD51-independent DSB repair.

[0076] The MT2scRAD52 expression cassette is a standardized expression element that drives the Saccharomyces cerevisiae ScRAD52 gene with the MT2 promoter. Its core purpose is to overexpress ScRAD52 in heterologous hosts (such as Yersinia lipophila), enhance homologous recombination (HR) / homological targeted repair (HDR) efficiency, and improve the success rate of gene editing targeted integration. It is a commonly used toolkit for optimizing chassis cell genetic manipulation in metabolic engineering and synthetic biology.

[0077] The MT2scRAD59 expression cassette is a standardized functional element that drives the Saccharomyces cerevisiae ScRAD59 gene using the MT2 promoter. Its core purpose is to overexpress the ScRAD59 protein in heterologous hosts (such as Yersinia lipophila), enhance single-chain annealing (SSA) repair and RAD51-independent homologous recombination (HR) activity, and especially improve the efficiency of short homologous arm-mediated targeted integration. It is a key toolkit for optimizing gene editing and chassis modification in industrial yeast.

[0078] HMEJ plasmids are a class of universal donor DNA plasmids designed based on the HMEJ (Homology-mediated end joining) gene editing strategy. It is a highly efficient gene knock-in / replacement strategy that combines the advantages of homologous recombination and classical end joining. Long homologous arms and sgRNA target sites are simultaneously located on both sides of the donor DNA plasmid; the long homologous arms contain sequences homologous to the genomic target sites on both sides (typically >200 bp, even over 800 bp), used to guide high-fidelity homologous recombination, while the sgRNA target sites are located on the outer side of the homologous arms, allowing them to be recognized and cleaved by sgRNA that forms a complex with Cas9 protein (or other nucleases). A donor plasmid for HMEJ knock-in typically contains the following modules (from 5' to 3'): left sgRNA target site - left homologous arm - target gene fragment - right homologous arm - right sgRNA target site. Two of the sgRNA target sites are designed on the outside of the homologous arm; when they are cleaved, the homologous arm and the target gene fragment in the middle are released as a linear molecule to participate in the repair.

[0079] The TRP1 gene: In *Saccharomyces cerevisiae*, the TRP1 gene encodes phosphoribosyl-2-aminobenzoic acid isomerase, a key enzyme in the tryptophan synthesis pathway. Knockout of the TRP1 gene prevents yeast from growing on tryptophan-free synthetic media, but allows growth on tryptophan-supplemented complete media or YPD. Therefore, it is both a target for manipulation and a commonly used nutritional selection marker. Homologous recombination-mediated TRP1 gene knockout is a classic and precise genetic manipulation method commonly used in yeast (especially *Saccharomyces cerevisiae*). It primarily utilizes the DNA homologous recombination mechanism to replace the target TRP1 gene in the genome with a modified DNA sequence, thereby achieving the loss of the gene's function.

[0080] The linoleic acid isomerase (PAI) derived from Propionibacterium acnes acts on the C9 double bond of the (c9,c12-LA) linoleic acid molecule to generate a highly specific t10,c12-CLA monomer. 1. Introduction to plasmid backbone sources: CRISPR / Cas9 plasmids were purchased from the Addgene platform; the backbone of the pLox series plasmids is the pUC57-LPR-Leu plasmid (from Sangon Biotech (Shanghai) Co., Ltd.), which carries a leucine marker (from the Yersinia lipolytica genome), a LoxP / R fragment (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), a homologous arm (from the Yersinia lipolytica genome), and a fragment to be integrated (synthesized by Sangon Biotech (Shanghai) Co., Ltd.); the backbone of the pHR series plasmids is the pUC57-LPR-Leu plasmid (from Sangon Biotech (Shanghai) Co., Ltd.), which carries a leucine marker (from the Yersinia lipolytica genome), a homologous arm (from the Yersinia lipolytica genome), a fragment to be integrated (synthesized by Sangon Biotech (Shanghai) Co., Ltd.), and an sgRNA expression unit (from the CRISPR / Cas9 plasmid).

[0081] In pLox-Leu-MT2scRAD52-D17, D17 is the code name for a pseudogene in the *Yarrowia lipolytica* genome. This gene does not perform any function and can therefore serve as an insertion site. Similarly, in pLox-Leu-MT2scRAD59-A1, A1 is the code name for a pseudogene in the *Yarrowia lipolytica* genome. This gene does not perform any function and can therefore serve as an insertion site.

[0082] 2. Construction of chassis strains with high gene editing efficiency 2.1 Construction of pLox series plasmids The pCTR2 promoter (as shown in SEQ ID NO. 1) and pMT2 promoter (as shown in SEQ ID NO. 2) from *Yersinia lipolytica*, and the gene fragment scRAD52 (as shown in SEQ ID NO. 4) and gene fragment scRAD59 (as shown in SEQ ID NO. 5) from *Saccharomyces cerevisiae* were cloned. The constitutive promoter pUAS16MT2 (as shown in SEQ ID NO. 3) was constructed using the 16-fragment UAS enhancement unit preserved in our laboratory. The specific sequences are shown in Table 3. The recombinant plasmids were constructed by ligating them into the pLox plasmid using seamless cloning technology: pLox-Leu-CTR2-ylKU70 (used to replace the promoter of the ylKU70 gene), pLox-Leu-CTR2-ylKU80 (used to replace the promoter of the ylKU80 gene), pLox-Leu-UAS16MT2-ylRAD51 (used to replace the promoter of the ylRAD51 gene), pLox-Leu-UAS16MT2-ylRAD52 (used to replace the promoter of the ylRAD52 gene), pLox-Leu-MT2scRAD52-D17 (used to integrate the MT2scRAD52 expression cassette into the D17 site), and pLox-Leu-MT2scRAD59-A1 (used to integrate the MT2scRAD59 expression cassette into the A1 site).

[0083] The plasmid construction process is as follows: First, primers are designed according to requirements. Then, the target DNA fragment is amplified by PCR and subjected to agarose gel electrophoresis (120 V) and DNA fragment recovery. The fragments are ligated using the Novizan ClonExpress II One Step Cloning Kit, and the product is transformed into *E. coli* DH5α for preservation. Primers used for plasmid construction are shown in Table 4.

[0084] Specifically, when constructing the recombinant plasmid pLox-Leu-CTR2-ylKU70, fragments 1 through 4 were ligated. Fragment 1, pUC57-LPR-Leu (1836 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 6 using I-SceI. Fragment 2, pHR1-Leu-gpKU70-pCTR2 (1448 bp in length), was the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 7 as a template and CTR2-LPR-F (SEQ ID NO. 46) and KU70-LPR-R1 (SEQ ID NO. 47) as primers. Fragment 3, pUC57-LPR-Leu (2728 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 8 using I-SceI. Among them, fragment 4 is pHR1-Leu-gpKU70-pCTR2 (fragment 4 is 1040bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 9 as a template and KU70-UP-PLR-F1 (SEQ ID NO. 48) and KU70-UP-PLR-R (SEQ ID NO. 49) as primers.

[0085] When constructing the recombinant plasmid pLox-Leu-CTR2-ylKU80, fragments 1 through 4 were ligated. Fragment 1, pUC57-LPR-Leu (1836 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 6 using I-SceI. Fragment 2, pHR1-Leu-gpKU80-pCTR2 (1448 bp in length), was the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 10 as a template and CTR2-LPR-F (SEQ ID NO. 46) and KU80-LPR-R (SEQ ID NO. 50) as primers. Fragment 3, pUC57-LPR-Leu (2728 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 8 using I-SceI. Among them, fragment 4 is pHR1-Leu-gpKU80-pCTR2 (fragment 4 is 1040bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 11 as a template and KU80-UP-PLR-F (SEQ ID NO. 51) and KU80-UP-PLR-R (SEQ ID NO. 52) as primers.

[0086] When constructing the recombinant plasmid pLox-Leu-UAS16MT2-ylRAD51, fragments 1 through 4 were ligated. Fragment 1, pUC57-LPR-Leu (1836 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 6 with I-SceI. Fragment 2, pHR1-Leu-pRAD51-pUAS16MT2 (3784 bp in length), was the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 12 as a template and MT2-LPR-F (SEQ ID NO. 53) and RAD51-LPR-R (SEQ ID NO. 54) as primers. Fragment 3, pUC57-LPR-Leu (2728 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 8 with I-SceI. Among them, fragment 4 is pHR1-Leu-pRAD51-pUAS16MT2 (fragment 4 is 1040bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 13 as a template and RAD51-UP-PLR-F (SEQ ID NO. 55) and RAD51-UP-PLR-R (SEQ ID NO. 56) as primers.

[0087] When constructing the recombinant plasmid pLox-Leu-UAS16MT2-ylRAD52, fragments 1 through 4 were ligated. Fragment 1, pUC57-LPR-Leu (1836 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 6 using I-SceI. Fragment 2, pHR1-Leu-pRAD52-pUAS16MT2 (3786 bp in length), was the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 14 as a template and MT2-LPR-F2 (SEQ ID NO. 57) and RAD52-LPR-R (SEQ ID NO. 58) as primers. Fragment 3, pUC57-LPR-Leu (2728 bp in length), was obtained by digesting the fragment with sequence SEQ ID NO. 8 using I-SceI. Among them, fragment 4 is pHR1-Leu-pRAD52-pUAS16MT2 (fragment 4 is 1040bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 15 as a template and RAD52-UP-PLR-F (SEQ ID NO. 59) and RAD52-UP-PLR-R (SEQ ID NO. 60) as primers.

[0088] When constructing the recombinant plasmid pLox-Leu-MT2scRAD52-D17, fragments 1 through 3 were ligated. Fragment 1, pLox-D17-TEFinopai (6690 bp = 133.8 bp), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 16 as a template and LoxMarker-F2 (SEQ ID NO. 61) and CY-F (SEQ ID NO. 62) as primers. Fragment 2, pLox-pRAD52-pUAS16MT2 (982 bp = 19.64 bp), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 17 as a template and MTR52-F (SEQ ID NO. 63) and MT2Lox-R (SEQ ID NO. 64) as primers. Among them, fragment 3 is the genome of Saccharomyces cerevisiae CEN.PK2-1C (fragment 3 is 1541bp=30.82 in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 18 as a template and ScRAD52-F1 (SEQ ID NO. 65) and ScRAD52-R1 (SEQ ID NO. 66) as primers.

[0089] When constructing the recombinant plasmid pLox-Leu-MT2scRAD59-A1, fragment 1 and fragment 2 were ligated. Fragment 1, pLox-Leu-A1 (6546 bp = 130.92 bp), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 19 as a template and LoxMarker-F (SEQ ID NO. 67) and A1-UP-R (SEQ ID NO. 61) as primers. Fragment 2, pLox-Leu-A1-MsR52 (2715 bp = 54.3 bp), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 20 as a template and cycA1-F (SEQ ID NO. 64) and MT2Lox-R (SEQ ID NO. 68) as primers.

[0090] 2.2 Construction of strains The transformation process is as follows: The target fragments of each recombinant plasmid constructed in section 2.1 were amplified by PCR, followed by electrophoresis and recovery. The recovered DNA fragments were then transformed into yeast cells (Yarrowia lipolyticis strain Polf, ATCC number MAY-2613) using the lithium acetate transformation method. Specifically, 1 mL of the culture medium was used to transform the DNA fragments into yeast cells (Yarrowia lipolyticis strain Polf, ATCC number MAY-2613). 600 For cells with a molecular weight of 1, add buffer solution (10 μL TE solution; 80 μL 50% PEG4000 solution; 5 μL 2M lithium acetate solution) and mix thoroughly to obtain competent cells. Then add 100 μg denaturing vector DNA and the recovered DNA fragment, incubate the mixture in a 30°C water bath for 30-45 min, shaking for 10 s every 10 min, and finally heat shock at 39°C for 10 min. The transformed bacterial suspension is then plated on selection plates and incubated at 30°C and 60% humidity.

[0091] After the recovered DNA fragments are introduced into yeast cells, the cells have a certain probability of using these fragments as templates for homologous recombination, integrating them into the genome. The fragments also contain nutrient markers for screening successfully integrated yeast cells. The following recombinant yeast cells were constructed: Po1f-yl70 (dynamically regulated ylKU70 expression using plasmid pLox-Leu-CTR2-ylKU70), Po1f-yl80 (dynamically regulated ylKU80 expression using plasmid pLox-Leu-CTR2-ylKU80), Po1f-yl51 (dynamically regulated ylRAD51 expression using plasmid pLox-Leu-UAS16MT2-ylRAD51), and Po1f-yl52 (dynamically regulated ylRAD52 expression using plasmid pLox-Leu-UAS16MT2-ylRAD52). Po1f-sc52 (which can dynamically regulate the expression level of scRAD52, using plasmid pLox-Leu-MT2scRAD52-D17), Po1f-sc59 (which can dynamically regulate the expression level of scRAD59, using plasmid pLox-Leu-MT2scRAD59-A1), and Po1f-DyHR (constructed based on recombinant yeast Po1f-yl52, which can dynamically regulate the expression levels of ylRAD52, scRAD52, and scRAD59, using plasmids pLox-Leu-MT2scRAD52-D17 and pLox-Leu-MT2scRAD59-A1).

[0092] Taking recombinant yeast Po1f-yl70 as an example, specifically, the recombinant plasmid pLox-Leu-CTR2-ylKU70 was cut with the restriction enzyme MluI, and the recovered sequence fragment (SEQ ID NO.6+SEQ ID NO.7+SEQ ID NO.9) was retrieved. Competent cells of strain Po1f were prepared according to the above steps and co-incubated with the recovered fragment to allow it to enter the cells. After transformation, the bacterial suspension was spread onto the screening solid medium YNBD+Ura (medium components: 2 wt.% glucose, 0.5 wt.% ammonium sulfate, 0.17 wt.% amino acid-free and ammonium sulfate-free yeast nitrogen source, 0.01 wt.% uracil, all purchased from Sangon Biotech (Shanghai) Co., Ltd.). Single colonies were recovered after cultivation.

[0093] The recovered fragments described below are complete fragments whose sequences are combined sequences of the listed sequences in their order. For example, for recombinant yeast Po1f-yl80, the recovered sequence is (SEQ ID NO.6+SEQ ID NO.10+SEQ ID NO.11), meaning that SEQ ID NO.6+SEQ ID NO.10+SEQ ID NO.11 is a complete fragment whose sequence is a sequential combination of SEQ ID NO.6+SEQ ID NO.10+SEQ ID NO.11. In this application, other recovered sequences have similar meanings.

[0094] All other strains were constructed using the methods described above. The differences are as follows: for recombinant yeast Po1f-yl80, the recovered sequence is (SEQ ID NO.6+SEQ ID NO.10+SEQ ID NO.11); for recombinant yeast Po1f-yl51, the recovered sequence is (SEQ ID NO.6+SEQ ID NO.12+SEQ ID NO.13); for recombinant yeast Po1f-yl52, the recovered sequence is (SEQ ID NO.6+SEQ ID NO.14+SEQ ID NO.15); for recombinant yeast Po1f-sc52, the recovered sequence is (SEQ ID NO.16+SEQ ID NO.17+SEQ ID NO.18); for recombinant yeast Po1f-sc59, the recovered sequence is (SEQ ID NO.19+SEQ ID NO.20); and for recombinant yeast Po1f-DyHR, the recovered sequence is (NO.16+SEQ ID NO.17+SEQ ID NO.18+SEQ ID NO.19+SEQ ID NO.20).

[0095] The specific construction method of recombinant yeast Po1f-DyHR is as follows: The recombinant plasmid pLox-Leu-MT2scRAD52-D17 was digested with the restriction enzyme MluI, and the recovered sequence was (SEQ ID NO.16+SEQ ID NO.17+SEQ ID NO.18); the recombinant plasmid pLox-Leu-MT2scRAD59-A1 was digested with the restriction enzyme MluI, and the recovered sequence was (SEQ ID NO.19+SEQ ID NO.20). Competent cells of the recombinant strain Po1f-yl52 were prepared according to the above steps and co-incubated with all recovered fragments to allow them to enter the cells. After transformation, the bacterial suspension was plated on the screening solid medium YNBD+Ura (medium composition: 2 wt.% glucose, 0.5 wt.% ammonium sulfate, 0.17 wt.% amino acid-free and ammonium sulfate-free yeast nitrogen source, 0.01 wt.% uracil, all purchased from Sangon Biotech (Shanghai) Co., Ltd.). Single colonies were recovered after cultivation.

[0096] 2.3 Validation of gene editing efficiency 2.3.1 Detection Indicators Three parameters are used: knockout efficiency (knockout efficiency = number of transformants successfully knocked out by TRP1 / total number of transformants × 100%, representing the success rate of TRP1 knockout; the screening method for successfully knocked-out transformants is: resuspend a single colony of the grown transformant in a certain volume of water, then take a small amount of bacterial solution and inoculate it into a medium without TRP amino acids; if the strain does not grow, it means that the transformant has been successfully knocked out, otherwise it has failed), and transformation efficiency (transformation efficiency = total number of transformants / OD of bacterial solution before transformation). 600 The efficiency of precise gene editing of the *Yarrowia lipolytica* strain constructed in section 2.2 was evaluated using transformant survival rate and relative gene expression. Knockout efficiency is characterized by homologous recombination-mediated TRP1 gene knockout, as follows: Figure 1 As shown. Transformation efficiency is measured by the number of transformants on the screening plate and the OD of competent cells. 600 To characterize.

[0097] 2.3.2 Exploration of Inducer Addition Strategies The inducer was copper ions, and the effects of the concentration and timing of copper ion addition on the results were investigated.

[0098] Reference Figure 1The plasmid pHR-Ura-gTRP contains an upstream homologous arm (a fragment homologous to the gene sequence upstream of the promoter of the TRP1 gene expression unit), a URA marker gene, an sgRNA expression unit, and a downstream homologous arm (a fragment homologous to the gene sequence downstream of the terminator of the TRP1 gene expression unit). The genome contains the upstream homologous arm, the TRP1 gene expression unit (i.e., for example...) Figure 1 The plasmid pHR-Ura-gTRP contains the promoter, TRP1 coding region, terminator, sgRNA recognition site, and downstream homologous arms. After mixing and contacting this plasmid with *Yersinia lipolytica* and the Cas9 system (containing the Cas9 enzyme and sgRNA), the sgRNA recognizes the sgRNA recognition site, and the Cas9 enzyme cleaves the *Yersinia lipolytica* genome, removing the TRP1 gene expression unit. Therefore, the final result is a strain lacking TRP1 and containing the URA marker gene and sgRNA expression unit. Only the successfully labeled strain grows normally on a medium lacking uracil but containing tryptophan, or on a medium without tryptophan.

[0099] Construct the plasmid required for detection: pHR-Ura-gTRP; specifically, fragments 1 through 4 need to be ligated. Fragment 1 is pCEN-Ura-gTrp (fragment length 1 is 1864 bp), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 21 as a template and NdeI-F2 (SEQ ID NO. 69) and gRNA2-Trp-R2 (SEQ ID NO. 70) as primers. Fragment 2 is pCEN-Ura-gTrp (fragment length 2 is 3075 bp), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 22 as a template and gRNA2-Trp-F2 (SEQ ID NO. 71) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 3 is a colony (1040 bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 23 as a template and Trp-DW-F3 (SEQ ID NO. 73) and Trp-DW-R3 (SEQ ID NO. 74) as primers. Fragment 4 is a colony (1020 bp in length), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 24 as a template and Trp-UP-F3 (SEQ ID NO. 75) and Trp-UP-R (SEQ ID NO. 76) as primers.

[0100] The detection procedure is as follows: The recombinant single colonies (recombinant yeast Po1f-yl70, recombinant yeast Po1f-yl80, recombinant yeast Po1f-yl51, recombinant yeast Po1f-yl52, recombinant yeast Po1f-sc52, recombinant yeast Po1f-sc59, and recombinant yeast Po1f-DyHR) from the activated plate were inoculated into 5 mL LYPD medium (medium composition: 2 wt.% glucose, 1 wt.% yeast extract, 2 wt.% peptone, all purchased from Sangon Biotech (Shanghai) Co., Ltd.) and cultured for 24 h (seed culture stage); the second stage was the shake flask stage: the seed culture was inoculated into 25 mL at a 5 vol.% inoculum volume and cultured for 12 h (shake flask stage). Then, an appropriate amount of cells was taken and transformed into pCRISPRyl (commercially available, Plasmid ID) using the transformation method described in 2.2. #70007, a plasmid carrying the Cas9 expression unit, and pHR-Ura-gTRP (a plasmid carrying the gRNA expression unit and upstream and downstream homologous arm sequences of TRP) constructed using the above method were plated on selection medium (YNBD medium, whose components are: 2% glucose, 0.5% ammonium sulfate, 2% amino acid-free and ammonium sulfate-free yeast nitrogen source, and 0.01% specific amino acid, all purchased from Shanghai Sangon Biotech Co., Ltd., where the specific amino acid selected here is TRP) (gene editing stage). For knockout efficiency, transformants from the selection medium were planted onto plates without TRP (tryptophan), and the total number of plantations and the number of growths were counted to identify the number of successfully knocked-out TRP strains, thus calculating the knockout efficiency. For transformation efficiency, the number of transformants on the selection plate and the OD of competent cells were used as the ratio. 600 It is represented by a numerical value.

[0101] The effects of copper ion concentration are shown in Table 1. Dynamic upregulation of the three genes ylRAD52, scRAD52, and scRAD59 successfully improved the knockout efficiency. In the three strains Po1f-yl52, Po1f-sc52, and Po1f-sc59, the addition of 0.2 mM copper ions increased the knockout efficiency to 30.83±3.07%, 41.67±3.12%, and 38.33±4.25%, respectively, representing an average increase of 84% compared to the parental strain (18.89±1.57%). When the copper ion concentration was further increased, the transformation efficiency decreased to 50 CFU / OD. 600 The concentration of approximately 0.2 mM significantly affects the survival rate of transformants, hindering method expansion (integration of multi-fragment and long-fragment DNA). Therefore, a concentration of 0.2 mM was determined to be optimal.

[0102] Table 1. Effect of copper ion concentration on destruction efficiency Note: In Table 1, "*" indicates p < 0.05; "**" indicates p < 0.01.

[0103] The effect of copper ion addition time is shown in Table 2. In the aforementioned experiments, copper ions were added only during the shake-flask stage 8 hours before transformation (Strategy P1). The results showed that maintaining copper induction throughout the entire culture process (Strategy P2: adding copper ions during both the seed culture and shake-flask stages) further improved the destruction efficiency. Strategy P3, which only added copper ions during the seed culture stage, did not further improve the destruction efficiency. Specifically, compared with Strategy P2, the homologous recombination (HR) efficiency (homological recombination efficiency = number of successful colonies / total number of colonies × %) in recombinant strain Po1f-yl52 increased from 31.33±2.49% to 38.33±3.07%; the homologous recombination (HR) efficiency in recombinant strain Po1f-sc52 increased from 40.56±2.08% to 46.67±1.36%; and the homologous recombination (HR) efficiency in recombinant strain Po1f-sc59 increased from 38.89±2.08% to 44.91±1.47%. Based on this, the three most effective genes (scRAD59, scRAD52, and ylRAD52) and the optimal copper ion addition scheme (strategy P2, adding copper ions at a concentration of 0.2 mM during both the seed culture and shake-flask stages) were identified. Finally, these schemes were combined to construct the recombinant strain Polf-DyHR (also known as recombinant yeast Polf-DyHR). This strain exhibited a destruction efficiency of 56.41 ± 3.84% and a transformation efficiency of 75 ± 5 CFU / OD. 600 Its performance is significantly stronger than all the recombinant strains mentioned above. The homologous recombination (HR) efficiency is calculated as (number of colonies successfully recombinated / total number of colonies × 100%).

[0104] Table 2. Effects of copper ion addition strategy on knockout efficiency and conversion efficiency Note: "*" in Table 2 indicates that p < 0.05.

[0105] 2.4 Design and introduction of HMEJ plasmids to improve integration efficiency Combining HMEJ with a dual gRNA cleavage strategy can improve the integration efficiency of lipolysinic yeast. Based on this approach, two gRNAs were designed to target the upstream and downstream regions of TRP1 (the gRNAs were designed online using the CHOPCHOP website). Simultaneously, the corresponding HMEJ donor plasmid pHMEJ-Leu-hyph-gTRP (primers are also listed in Table 4) was constructed to integrate the hygromycin resistance gene (HPH) into the TRP1 locus. In contrast, previous studies only required one gRNA to assess knockout efficiency, and there was no additional DNA fragment between the two homologous arms in the donor plasmid. Here, integration efficiency was evaluated to determine whether this method can effectively promote homologous donor replacement in the recombinant strain Po1f-DyHR.

[0106] Two gRNAs were designed: 5'-CTGCTCTTCTTAAGGATCAT-3' (SEQ ID NO. 106); 5'-CAACAGCTTTTTTTGTTCTGT-3' (SEQ ID NO. 107).

[0107] The results showed that the introduction of HMEJ plasmid significantly improved the integration efficiency of the control strain Po1f (Yersinia lipophila strain Polf, ATCC number MAY-2613) and the recombinant strain Po1f-DyHR (integration efficiency = number of transformants with successful insertion of exogenous DNA into the genome / total number of transformants × 100%). The latter had a higher integration efficiency than the former, with the highest efficiency reaching over 60%, which was higher than the control's approximately 30%.

[0108] The detection procedure is as follows: First, the recombinant plasmid pHMEJ-Leu-hyph-gTRP is constructed, and fragments 1 to 5 are ligated together. Fragment 1 is pCEN1-Leu-dul-gPEX10 (fragment length 4212 bp), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 25 as a template and NdeI-F2 (SEQ ID NO. 69) and Leu-R2 (SEQ ID NO. 77) as primers. Fragment 2 is pCEN1-Leu-dul-gPEX10 (fragment length 3968 bp), which is the purified product after PCR amplification using the fragment with sequence SEQ ID NO. 26 as a template and Leu-F (SEQ ID NO. 78) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 3 is a *Yarrowia lipolytica* colony (fragment length 1 kbp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 27 as a template and Trp-DW-F (SEQ ID NO. 79) and Trp-DW-R3 (SEQ ID NO. 74) as primers. Fragment 4 is pUB4-Cre (fragment length 1676 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 28 as a template and hph-F (SEQ ID NO. 80) and hph-R (SEQ ID NO. 81) as primers. Fragment 5 is a *Yarrowia lipolytica* colony (fragment length 1 kbp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 29 as a template and Trp-UP-F3 (SEQ ID NO. 75) and Trp-UP-R (SEQ ID NO. 76) as primers.

[0109] Then, the integration efficiency was tested: the recombinant single colonies (recombinant yeast Po1f-DyHR and control strain Po1f) on the activation plate were inoculated into 5 mL LYPD medium (medium composition: 2 wt.% glucose, 1 wt.% yeast extract, 2 wt.% peptone, all purchased from Sangon Biotech (Shanghai) Co., Ltd.) and cultured for 24 h (seed culture stage); the second stage was the shake flask stage: the seed culture was inoculated into 25 mL at a volume of 5 vol.% and cultured for 12 h (shake flask stage). Then, an appropriate amount of bacterial cells were taken and transformed into pCRISPRyl (commercially available, Plasmid ID #70007, plasmid carrying Cas9 expression unit) and pHMEJ-Leu-hyph-gTRP (carrying two gRNA expression units, TRP upstream and downstream homologous arm sequences, HPH resistance gene expression cassette, and two gTRP sequences, all contained in the provided plasmid sequences) constructed by the above method and then plated on the selection medium (gene editing stage). To determine the knockout efficiency, transformants from the selection medium were spotted onto plates lacking TRP (tryptophan). The total number of spotted transformants and the number of cells that grew were counted to identify the number of successfully knocked-out TRP strains, thus calculating the knockout efficiency. Transformation efficiency was calculated as the number of transformants on the selection plate and the OD of competent cells. 600 It is represented by a numerical value.

[0110] 3. Identification of key genes involved in the degradation of long-chain fatty acids 3.1 Transcriptomics Screening To identify key genes in *Yersinia lipolytica* that degrade long-chain fatty acids and address product waste during lipid production, a recombinant *Yersinia lipolytica* strain capable of producing conjugated linoleic acid (CLA) was selected. This strain (CCFM-JU277-9, deposited at the China General Microbiological Culture Collection Center, accession number CGMCCNo. 7222, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, January 28, 2013; see Chinese application 201310120175.1) was used. Transcriptomic analysis was performed on samples from six time points across three stages of CLA fermentation: yield ramp-up, yield peak, and yield depletion. The results showed that the POX2, POX3, and POX5 genes played major roles in the fermentation process, with POX5 expression remaining the highest throughout the entire process.

[0111] 3.2 Construction of different knockout combinations of bacterial strains The recombinant plasmid constructed is as follows: pHR-gPOX2 (carries a gRNA expression unit and homologous arm targeting POX2, and knocks out POX2) pHR-gPOX3 (carries a gRNA expression unit and homologous arm targeting POX3, knocking out POX3) pHR-gPOX5 (carrying a gRNA expression unit and homologous arm targeting POX5, POX5 knocked out), and pHR-gPEX10 (carries a gRNA expression unit and homologous arm targeting PEX10, and knocks out PEX10).

[0112] The specific construction steps are as follows: When constructing the recombinant plasmid pHR-gPOX2, fragments 1 through 4 were ligated. Fragment 1, pCEN-Ura-gTrp (1864 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 30 as a template and NdeI-F2 (SEQ ID NO. 69) and gRNA-Pox2-R (SEQ ID NO. 82) as primers. Fragment 2, pCEN-Ura-gTrp (3075 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 31 as a template and gRNA-Pox2-F (SEQ ID NO. 83) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 3 is a *Yarrowia lipolytica* colony (fragment length 1040 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 32 as a template and Pox2-DW-F1 (SEQ ID NO. 84) and Pox2-DW-R1 (SEQ ID NO. 85) as primers. Fragment 4 is a *Yarrowia lipolytica* colony (fragment length 1020 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 33 as a template and Pox2-UP-F1 (SEQ ID NO. 86) and Pox2-UP-R (SEQ ID NO. 87) as primers.

[0113] When constructing the recombinant plasmid pHR-gPOX3, fragments 1 through 4 were ligated. Fragment 1, pCEN-Ura-gTrp (1864 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 34 as a template and NdeI-F2 (SEQ ID NO. 69) and gRNA-Pox3-R (SEQ ID NO. 88) as primers. Fragment 2, pCEN-Ura-gTrp (3075 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 35 as a template and gRNA-Pox3-F (SEQ ID NO. 89) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 3 is a *Yarrowia lipolytica* colony (fragment length 1040 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 36 as a template and Pox3-DW-F1 (SEQ ID NO. 90) and Pox3-DW-R1 (SEQ ID NO. 91) as primers. Fragment 4 is a *Yarrowia lipolytica* colony (fragment length 1020 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 37 as a template and Pox3-UP-F1 (SEQ ID NO. 92) and Pox3-UP-R (SEQ ID NO. 93) as primers.

[0114] When constructing the recombinant plasmid pHR-gPOX5, fragments 1 through 4 were ligated. Fragment 1, pCEN-Ura-gTrp (1864 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 38 as a template and NdeI-F2 (SEQ ID NO. 69) and gRNA-Pox5-R (SEQ ID NO. 94) as primers. Fragment 2, pCEN-Ura-gTrp (3075 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 39 as a template and gRNA-Pox5-F (SEQ ID NO. 95) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 3 is a *Yarrowia lipolytica* colony (fragment length 1040 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 40 as a template and Pox5-DW-F1 (SEQ ID NO. 96) and Pox5-DW-R1 (SEQ ID NO. 97) as primers. Fragment 4 is a *Yarrowia lipolytica* colony (fragment length 1020 bp), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 41 as a template and Pox5-UP-F1 (SEQ ID NO. 98) and Pox5-UP-R (SEQ ID NO. 99) as primers.

[0115] When constructing the recombinant plasmid pHR-gPOX10, fragments 1 through 4 were ligated. Fragment 1 is a *Yarrowia lipolytica* colony (1864 bp in length), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 42 as a template and PEX10-UP-F (SEQ ID NO. 100) and PEX10-UP-R2 (SEQ ID NO. 101) as primers. Fragment 2 is a *Yarrowia lipolytica* colony (3075 bp in length), which is the purified product of PCR amplification using the fragment with sequence SEQ ID NO. 43 as a template and PEX10-DW-F2 (SEQ ID NO. 102) and PEX10-DW-R2 (SEQ ID NO. 103) as primers. Fragment 3, pCEN-Ura-sgTrp (1040 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 44 as a template and gRNA-PEX10-F (SEQ ID NO. 104) and NdeI-R (SEQ ID NO. 72) as primers. Fragment 4, pCEN-Ura-sgTrp (1020 bp in length), is a purified product obtained by PCR amplification using the fragment with sequence SEQ ID NO. 45 as a template and NdeI-F2 (SEQ ID NO. 69) and gRNA-PEX10-R (SEQ ID NO. 105) as primers.

[0116] Further construction of recombinant strains (or recombinant yeast): Po1f-DyHR-dPOX5 (single knockout of POX5, use pHR-gPOX5), Po1f-DyHR-dPOX3 (single knockout of POX3, use pHR-gPOX3), Po1f-DyHR-dPOX2 (single knockout of POX2, use pHR-gPOX2), Po1f-DyHR-dPOX5-dPOX2 (double-knock out POX5 and POX2, then use pHR-gPOX5 and pHR-gPOX2). Po1f-DyHR-dPOX5-dPOX3 (double-knock out POX5 and POX3, then use pHR-gPOX5 and pHR-gPOX3). Po1f-DyHR-dPOX3-dPOX2 (double-knock out POX3 and POX2, then use pHR-gPOX3 and pHR-gPOX2) Po1f-DyHR-dPOX5-dPOX3-dPOX2 (three knockouts of POX5, POX3, and POX2, followed by pHR-gPOX5, pHR-gPOX3, and pHR-gPOX2), and Po1f-DyHR-dPEX10 (control strain, PEX10 knocked out, pHR-gPEX10 used).

[0117] All gRNA designs were performed online using the CHOPCHOP website. All plasmid primers are listed in Table 3. The plasmid and strain construction procedures were the same as above. For recombinant yeast Po1f-DyHR-dPOX2, the recovered sequence was (SEQ ID NOs. 30~33); for recombinant yeast Po1f-DyHR-dPOX3, the recovered sequence was (SEQ ID NOs. 34~37); for recombinant yeast Po1f-DyHR-dPOX5, the recovered sequence was (SEQ ID NOs. 38~41); and for recombinant yeast Po1f-DyHR-dPOX10, the recovered sequence was (SEQ ID NOs. 42~45). For recombinant yeast Po1f-DyHR-dPOX5-dPOX2, the fragments with sequences (SEQ ID NOs. 30-33) were further recovered based on Po1f-DyHR-dPOX5; for recombinant yeast Po1f-DyHR-dPOX5-dPOX3, the fragments with sequences (SEQ ID NOs. 34-37) were further recovered based on Po1f-DyHR-dPOX5; for recombinant yeast Po1f-DyHR-dPOX3-dPOX2, the fragments with sequences (SEQ ID NOs. 30-33) were further recovered based on Po1f-DyHR-dPOX3; and for recombinant yeast Po1f-DyHR-dPOX5-dPOX3-dPOX2, the fragments with sequences (SEQ ID NOs. 34-37) were further recovered based on strain Po1f-DyHR-dPOX5-dPOX3.

[0118] The sequences of each gRNA are as follows: gPOX2: TAGAACTTTCGCAGGTCTCC (SEQ ID NO. 108), gPOX3: CCTTACTATGAGAGCACTCT (SEQ ID NO. 109), gPOX5: TGGCGACCCAGTAATCGTAC (SEQ ID NO. 110), and gPEX10: TCCATGTTTCCGGGCTGGGC (SEQ ID NO. 111).

[0119] 3.3 Identification of lipid degradation capacity The long-chain fatty acid (LCFA) degradation capacity of each recombinant strain was assessed using linoleic acid (LA)-rich safflower seed oil (composed of 77 wt.% linoleic acid, 6 wt.% palmitic acid, 3 wt.% stearic acid, 12 wt.% oleic acid, and 2 wt.% other components) as the fermentation substrate. Intracellular and extracellular lipid content was analyzed by gas chromatography (Figures A and B below). Compared to the control group, the extracellular lipid content of single or double POX knockout strains increased by approximately 30%, while the triple knockout strain increased by 64.19% relative to Po1f-HR. Intracellular lipid content showed a similar trend. At the end of fermentation, the lipid content (extracellular and intracellular) of the triple knockout strain was 89.42% and 54.93% higher than that of the control group, respectively, while the lipid utilization of strain Po1f-HR-dPEX10 was similar to that of the control group. However, with increasing POX gene knockout counts, lipid-free biomass gradually decreased, reaching its lowest level in the triple knockout strain, although slightly higher than that of Po1f-HR-PEX10. Therefore, the combined knockout of POX2, POX3 and POX5 is a better strategy to weaken lipid degradation.

[0120] 4. Application of β-oxidation-inhibiting strains in the production of conjugated linoleic acid Using the multi-copy plasmid pINA1292spopaid12 (a plasmid constructed in our laboratory and deposited in Escherichia coli pJU16-opai-d12 at the China General Microbiological Culture Collection Center with accession number CGMCC No. 7223, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, January 28, 2013; see Chinese application 201310120175.1), a strain producing high and stable levels of conjugated fatty acids was constructed based on the Po1f-DyHR-dPOX5-dPOX3-dPOX2 strain (transformation method as above). To obtain the multi-copy plasmid pINA1292spopaid12, *E. coli* pJU16-opai-d12 was first cultured using conventional methods in the art, followed by extraction of the multi-copy plasmid pINA1292spopaid12 using conventional methods. All transformants were cultured in amino acid-free YNBD medium to prepare a seed culture, which was then inoculated into YPD medium at a 1% inoculum for expansion. Then, on the one hand, a certain amount of bacterial cells was lysed and the genome extracted for quantitative PCR to detect the PAI copy number; on the other hand, safflower seed oil emulsion was added to the bacterial culture in the early stationary phase to a final concentration of 30 g / L as a substrate for fermentation to produce CLA.

[0121] Finally, after screening, strain Po1f-DyHR-dPOX5-dPOX3-dPOX2-spopaid12 was obtained (preserved and named DyHR-dβ7-spopaid12; this is a lipophilic Yersinia). Yarrowia lipolytica The strain is deposited at the China General Microbiological Culture Collection Center (CGMCC No. 39103, deposit date: December 16, 2025), with a maximum yield of 6.8 g / L. The degradation rate of the product in the later stages of fermentation was reduced from 95.7% to 23.5% compared to the recombinant *Yarrowia lipolytica* strain (CCFM-JU277-9, deposited in our laboratory at the China General Microbiological Culture Collection Center, CGMCC No. 7222, located at No. 3, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, deposited on January 28, 2013; see Chinese application 201310120175.1).

[0122] Table 3. Sequence of related components Table 4 Primers used for plasmid construction Table 5 Primers used for plasmid construction The description in this disclosure is provided for illustrative and descriptive purposes only and is not intended to be exhaustive or to limit the disclosure to its forms. Many modifications and variations will be apparent to those skilled in the art. The embodiments were chosen and described in order to better illustrate the principles and practical application of this disclosure and to enable those skilled in the art to understand this disclosure and to design various embodiments with various modifications suitable for a particular purpose.

Claims

1. A recombinant lipophilic yeast with high homologous recombination efficiency, characterized in that, The recombinant Yersinia lipolytica contains a copper-inducible promoter and genes related to homologous recombination. The copper ion-inducible promoter is selected from any one or more of the following groups: pCTR2 promoter, pMT2 promoter and pUAS16MT2 constitutive promoter; The homologous recombination-related genes are selected from any one or more of the following groups: ylKU70 gene, ylKU80 gene, ylRAD51 gene, ylRAD52 gene, scRAD52 gene, and scRAD59 gene. Preferably, the recombinant Yersinia lipophila comprises the pMT2 promoter, the pUAS16MT2 constitutive promoter, the ylRAD52 gene, the scRAD52 gene, and the scRAD59 gene. More preferably, the recombinant Yersinia lipophila further comprises any one or more selected from the group consisting of: a marker gene for screening, an upstream homologous arm for homologous recombination, a downstream homologous arm for homologous recombination, and an sgRNA expression unit; more preferably, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence. More preferably, the recombinant Yersinia lipolyticis is a tryptophan-encoding gene defective type, preferably a TRP1 gene defective type.

2. The recombinant Yersinia delavayi according to claim 1, characterized in that, in, The pCTR2 promoter is shown in SEQ ID NO. 1; and / or The pMT2 promoter is shown in SEQ ID NO. 2; and / or The pUAS16MT2 constitutive promoter is shown in SEQ ID NO.

3.

3. The recombinant Yersinia delbrueckii according to claim 1, characterized in that, in, The ylKU70 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 9 as a template and the gene fragments shown in SEQ ID NO. 48 and 49 as primers; and / or The ylKU80 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 11 as a template and the gene fragments shown in SEQ ID NO. 51 and 52 as primers; and / or The ylRAD51 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 13 as a template and the gene fragments shown in SEQ ID NO. 55 and 56 as primers; and / or The ylRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 15 as a template and the gene fragments shown in SEQ ID NO. 59 and 60 as primers; and / or The scRAD52 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 18 as a template and the gene fragments shown in SEQ ID NO. 65 and 66 as primers; and / or The scRAD59 gene is obtained by amplification using the gene fragment shown in SEQ ID NO. 20 as a template and the gene fragments shown in SEQ ID NO. 64 and 68 as primers.

4. The method for constructing recombinant Yersinia lipolyticis with high homologous recombination efficiency as described in any one of claims 1-3, characterized in that, The copper ion-inducible promoter, the gene related to homologous recombination, and wild-type Yersinia lipolytica were mixed and contacted. After homologous recombination, the copper ion-inducible promoter and the gene related to homologous recombination were transformed into wild-type Yersinia lipolytica to obtain the recombinant Yersinia lipolytica. Preferably, the wild-type Yersinia lipolyticis is a competent wild-type Yersinia lipolyticis; More preferably, it further includes transforming the wild-type Yersinia lipophila into any one or more of the following groups: a marker gene for screening, an upstream homologous arm of homologous recombination, a downstream homologous arm of homologous recombination, and an sgRNA expression unit; more preferably, the sgRNA expression unit comprises a gRNA target recognition sequence and a gRNA scaffold sequence; preferably, the upstream homologous arm of homologous recombination, the downstream homologous arm of homologous recombination, and the sgRNA expression unit are used for subsequent targeted knockout of tryptophan-encoding genes, preferably knocking out the TRP1 gene.

5. The construction method according to claim 4, characterized in that, The construction method includes: The pMT2 promoter, pUAS16MT2 constitutive promoter, ylRAD52 gene, scRAD52 gene and scRAD59 gene were mixed and contacted with the wild-type Yersinia lipophila. Preferably, the construction method includes: The pUAS16MT2 constitutive promoter, ylRAD52 gene, and scRAD52 gene were mixed with the wild-type Yersinia lipolytica and homologous recombination was performed to obtain the recombinant strain Po1f-yl52. The pMT2 promoter, scRAD52 gene, and scRAD59 gene were mixed and contacted with the recombinant strain Po1f-yl52.

6. A gene-knockout lipophilic yeast with low lipid degradation capacity, characterized in that, The gene knockout in *Yarrowia lipophila* involved knocking out one or more genes from the following group: POX5 gene, POX2 gene, and POX3 gene. Preferably, the gene knockout Yeast lipophilia knocks out the following genes: POX5 gene, POX2 gene and POX3 gene.

7. The gene knockout Yersinia lipophila according to claim 6, characterized in that, Gene knockout is performed using a gene editing method, namely CRISPR / Cas9. Among them, the gRNA targeting the POX2 gene knockout is shown in SEQ ID NO. 108, and / or, gRNAs targeting and knocking out the POX3 gene are shown in SEQ ID NO. 109, and / or, The gRNA that targets and knocks out the POX5 gene is shown in SEQ ID NO.

110.

8. An engineered lipolytic yeast with high homologous recombination efficiency and low lipid degradation ability, characterized in that, The engineered Yersinia lipolytica is a recombinant Yersinia lipolytica according to any one of claims 1-3 or a recombinant Yersinia lipolytica constructed by the method described in claim 4 or 5, wherein any one or more genes from the following group have been knocked out: POX5 gene, POX2 gene and POX3 gene. Preferably, the engineered lipolytic yeast has the following genes knocked out: POX5 gene, POX2 gene and POX3 gene.

9. The engineered lipolytic Yersinia according to claim 8, characterized in that, Gene knockout is performed using a gene editing method, namely CRISPR / Cas9. Among them, the gRNA targeting the POX2 gene knockout is shown in SEQ ID NO. 108, and / or, gRNAs targeting and knocking out the POX3 gene are shown in SEQ ID NO. 109, and / or, The gRNA that targets and knocks out the POX5 gene is shown in SEQ ID NO.

110.

10. The engineered lipolytic Yersinia according to claim 8 or 9, characterized in that, The engineered lipolytic yeast also contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette. Preferably, the method for constructing the engineered Yersinia lipolytica further includes: transforming the pINA1292spopaid12 plasmid into Yersinia lipolytica; The pINA1292spopaid12 plasmid contains a PAI gene expression cassette and a Δ12 dehydrogenase expression cassette. Preferably, the pINA1292spopaid12 plasmid is transformed into Escherichia coli pJU16-opai-d12; the Escherichia coli pJU16-opai-d12 is a strain with accession number CGMCC No. 7223; More preferably, the method for constructing the engineered Yersinia lipolytica further comprises: extracting the pINA1292spopaid12 plasmid from Escherichia coli pJU16-opai-d12, and transforming the extracted pINA1292spopaid12 plasmid into Yersinia lipolytica.

Citation Information

Patent Citations

  • Method for optimizing conjugated linoleic acid synthesis by using Yarrowia lipolytica yeast recombinant strain based on genetic engineering strategy

    CN103233036A